ID: 1180175323

View in Genome Browser
Species Human (GRCh38)
Location 21:46084398-46084420
Sequence TCTGAACCCTCCTGCCGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180175318_1180175323 -2 Left 1180175318 21:46084377-46084399 CCATCTGCTCCCGTGTTCCCGTC No data
Right 1180175323 21:46084398-46084420 TCTGAACCCTCCTGCCGTCCTGG No data
1180175316_1180175323 20 Left 1180175316 21:46084355-46084377 CCTGTGAGCAGCGGCAGCAGACC No data
Right 1180175323 21:46084398-46084420 TCTGAACCCTCCTGCCGTCCTGG No data
1180175317_1180175323 -1 Left 1180175317 21:46084376-46084398 CCCATCTGCTCCCGTGTTCCCGT No data
Right 1180175323 21:46084398-46084420 TCTGAACCCTCCTGCCGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180175323 Original CRISPR TCTGAACCCTCCTGCCGTCC TGG Intergenic
No off target data available for this crispr