ID: 1180175328

View in Genome Browser
Species Human (GRCh38)
Location 21:46084405-46084427
Sequence GCAGCCCCCAGGACGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180175328_1180175341 13 Left 1180175328 21:46084405-46084427 CCTCCTGCCGTCCTGGGGGCTGC No data
Right 1180175341 21:46084441-46084463 AGCCAGACGAGGGCTGACCCGGG No data
1180175328_1180175340 12 Left 1180175328 21:46084405-46084427 CCTCCTGCCGTCCTGGGGGCTGC No data
Right 1180175340 21:46084440-46084462 CAGCCAGACGAGGGCTGACCCGG No data
1180175328_1180175344 28 Left 1180175328 21:46084405-46084427 CCTCCTGCCGTCCTGGGGGCTGC No data
Right 1180175344 21:46084456-46084478 GACCCGGGAGGCGAGTACAGTGG No data
1180175328_1180175337 2 Left 1180175328 21:46084405-46084427 CCTCCTGCCGTCCTGGGGGCTGC No data
Right 1180175337 21:46084430-46084452 GAGGGGCTACCAGCCAGACGAGG No data
1180175328_1180175338 3 Left 1180175328 21:46084405-46084427 CCTCCTGCCGTCCTGGGGGCTGC No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175328_1180175343 16 Left 1180175328 21:46084405-46084427 CCTCCTGCCGTCCTGGGGGCTGC No data
Right 1180175343 21:46084444-46084466 CAGACGAGGGCTGACCCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180175328 Original CRISPR GCAGCCCCCAGGACGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr