ID: 1180175332

View in Genome Browser
Species Human (GRCh38)
Location 21:46084411-46084433
Sequence GCCGTCCTGGGGGCTGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180175318_1180175332 11 Left 1180175318 21:46084377-46084399 CCATCTGCTCCCGTGTTCCCGTC No data
Right 1180175332 21:46084411-46084433 GCCGTCCTGGGGGCTGCGGGAGG No data
1180175322_1180175332 -7 Left 1180175322 21:46084395-46084417 CCGTCTGAACCCTCCTGCCGTCC No data
Right 1180175332 21:46084411-46084433 GCCGTCCTGGGGGCTGCGGGAGG No data
1180175320_1180175332 1 Left 1180175320 21:46084387-46084409 CCGTGTTCCCGTCTGAACCCTCC No data
Right 1180175332 21:46084411-46084433 GCCGTCCTGGGGGCTGCGGGAGG No data
1180175321_1180175332 -6 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175332 21:46084411-46084433 GCCGTCCTGGGGGCTGCGGGAGG No data
1180175317_1180175332 12 Left 1180175317 21:46084376-46084398 CCCATCTGCTCCCGTGTTCCCGT No data
Right 1180175332 21:46084411-46084433 GCCGTCCTGGGGGCTGCGGGAGG No data
1180175319_1180175332 2 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175332 21:46084411-46084433 GCCGTCCTGGGGGCTGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180175332 Original CRISPR GCCGTCCTGGGGGCTGCGGG AGG Intergenic
No off target data available for this crispr