ID: 1180175336

View in Genome Browser
Species Human (GRCh38)
Location 21:46084416-46084438
Sequence TAGCCCCTCCCGCAGCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180175336_1180175351 29 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175351 21:46084468-46084490 GAGTACAGTGGTGCCGGGGAGGG No data
1180175336_1180175338 -8 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175336_1180175340 1 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175340 21:46084440-46084462 CAGCCAGACGAGGGCTGACCCGG No data
1180175336_1180175348 24 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175348 21:46084463-46084485 GAGGCGAGTACAGTGGTGCCGGG No data
1180175336_1180175349 25 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175349 21:46084464-46084486 AGGCGAGTACAGTGGTGCCGGGG No data
1180175336_1180175347 23 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175347 21:46084462-46084484 GGAGGCGAGTACAGTGGTGCCGG No data
1180175336_1180175350 28 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175350 21:46084467-46084489 CGAGTACAGTGGTGCCGGGGAGG No data
1180175336_1180175343 5 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175343 21:46084444-46084466 CAGACGAGGGCTGACCCGGGAGG No data
1180175336_1180175344 17 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175344 21:46084456-46084478 GACCCGGGAGGCGAGTACAGTGG No data
1180175336_1180175341 2 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175341 21:46084441-46084463 AGCCAGACGAGGGCTGACCCGGG No data
1180175336_1180175337 -9 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175337 21:46084430-46084452 GAGGGGCTACCAGCCAGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180175336 Original CRISPR TAGCCCCTCCCGCAGCCCCC AGG (reversed) Intergenic
No off target data available for this crispr