ID: 1180175338

View in Genome Browser
Species Human (GRCh38)
Location 21:46084431-46084453
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180175321_1180175338 14 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175330_1180175338 0 Left 1180175330 21:46084408-46084430 CCTGCCGTCCTGGGGGCTGCGGG No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175319_1180175338 22 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175322_1180175338 13 Left 1180175322 21:46084395-46084417 CCGTCTGAACCCTCCTGCCGTCC No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175328_1180175338 3 Left 1180175328 21:46084405-46084427 CCTCCTGCCGTCCTGGGGGCTGC No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175336_1180175338 -8 Left 1180175336 21:46084416-46084438 CCTGGGGGCTGCGGGAGGGGCTA No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175327_1180175338 4 Left 1180175327 21:46084404-46084426 CCCTCCTGCCGTCCTGGGGGCTG No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175333_1180175338 -4 Left 1180175333 21:46084412-46084434 CCGTCCTGGGGGCTGCGGGAGGG No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175320_1180175338 21 Left 1180175320 21:46084387-46084409 CCGTGTTCCCGTCTGAACCCTCC No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180175338 Original CRISPR AGGGGCTACCAGCCAGACGA GGG Intergenic
No off target data available for this crispr