ID: 1180177609

View in Genome Browser
Species Human (GRCh38)
Location 21:46098132-46098154
Sequence GCTCCCGACGGCCCGAGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180177609_1180177620 25 Left 1180177609 21:46098132-46098154 CCGCGCCTCGGGCCGTCGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1180177620 21:46098180-46098202 GCCTCCCGGACCCCGCACCCTGG 0: 1
1: 0
2: 2
3: 31
4: 312
1180177609_1180177614 -9 Left 1180177609 21:46098132-46098154 CCGCGCCTCGGGCCGTCGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1180177614 21:46098146-46098168 GTCGGGAGCGGAGCCTCCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 89
1180177609_1180177615 -3 Left 1180177609 21:46098132-46098154 CCGCGCCTCGGGCCGTCGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1180177615 21:46098152-46098174 AGCGGAGCCTCCTCGGGACCAGG 0: 1
1: 0
2: 1
3: 7
4: 104
1180177609_1180177618 11 Left 1180177609 21:46098132-46098154 CCGCGCCTCGGGCCGTCGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1180177618 21:46098166-46098188 GGGACCAGGTGAGCGCCTCCCGG 0: 1
1: 0
2: 3
3: 14
4: 154
1180177609_1180177613 -10 Left 1180177609 21:46098132-46098154 CCGCGCCTCGGGCCGTCGGGAGC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1180177613 21:46098145-46098167 CGTCGGGAGCGGAGCCTCCTCGG 0: 1
1: 0
2: 0
3: 10
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180177609 Original CRISPR GCTCCCGACGGCCCGAGGCG CGG (reversed) Exonic