ID: 1180177655

View in Genome Browser
Species Human (GRCh38)
Location 21:46098262-46098284
Sequence GTCCCTCGGGTCCCCGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180177645_1180177655 9 Left 1180177645 21:46098230-46098252 CCGAGTCCTGGGAAGGCGGCGGC 0: 1
1: 0
2: 4
3: 24
4: 248
Right 1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 114
1180177636_1180177655 25 Left 1180177636 21:46098214-46098236 CCCGCGGGGGGTGACCCCGAGTC 0: 1
1: 0
2: 1
3: 4
4: 58
Right 1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 114
1180177648_1180177655 3 Left 1180177648 21:46098236-46098258 CCTGGGAAGGCGGCGGCGGCGGC 0: 2
1: 3
2: 54
3: 336
4: 843
Right 1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 114
1180177642_1180177655 11 Left 1180177642 21:46098228-46098250 CCCCGAGTCCTGGGAAGGCGGCG 0: 1
1: 0
2: 3
3: 8
4: 102
Right 1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 114
1180177637_1180177655 24 Left 1180177637 21:46098215-46098237 CCGCGGGGGGTGACCCCGAGTCC 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 114
1180177643_1180177655 10 Left 1180177643 21:46098229-46098251 CCCGAGTCCTGGGAAGGCGGCGG 0: 1
1: 0
2: 4
3: 25
4: 207
Right 1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180177655 Original CRISPR GTCCCTCGGGTCCCCGGGAA GGG Intronic
900238415 1:1603394-1603416 GTCCCTGGGGACCTGGGGAATGG + Intergenic
900964442 1:5948042-5948064 GTCTCTTGGGTCCCCAGGGATGG - Intronic
901665397 1:10823313-10823335 GTCCCTGGGGACTCCGGAAAAGG - Intergenic
902417767 1:16251546-16251568 CTCCTTCAGGTTCCCGGGAAGGG - Exonic
903446397 1:23424939-23424961 GTCCCCCGGCGCCCCTGGAAGGG - Intergenic
910795575 1:91094467-91094489 GCCCCTCAGGTCCCAGGGAGTGG + Intergenic
913129787 1:115828879-115828901 GACCCTCGCGTCCCAGGGGAGGG - Intergenic
917329728 1:173868611-173868633 CTCCCTCAGGACCCCGGGAAGGG + Intronic
1064909397 10:20383969-20383991 GTCCCTCTGGTGTCCTGGAATGG - Intergenic
1067725597 10:48768357-48768379 GGCCCTCGGGTGCCCTGCAAAGG - Intronic
1069590591 10:69639335-69639357 GTCCCTCAGGTCCCTGCAAAAGG - Intergenic
1069865264 10:71498440-71498462 TTCCCCAGGGTCCCGGGGAAAGG + Intronic
1070319559 10:75344218-75344240 GTCCCTCGGGTGGCTGGGAAGGG + Intergenic
1072039276 10:91591755-91591777 GTCACTCGGGCCCACGGCAATGG - Intergenic
1075780839 10:125016169-125016191 GTCCCTTGGGGCACTGGGAAGGG - Intronic
1076160814 10:128242976-128242998 ATCCCTGGGGAACCCGGGAAGGG + Intergenic
1077028147 11:450783-450805 GCCCCCCGGGTCCCGGGGAGCGG + Intronic
1077219709 11:1410568-1410590 GGCTCTCTGGTCCCCGGGAGTGG + Intronic
1079003397 11:16776005-16776027 GGCCCTGGGGTCTCCTGGAAGGG + Intergenic
1083144484 11:60748513-60748535 GCACCTGGGATCCCCGGGAAAGG + Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1090274199 11:125408352-125408374 CTCCCACGGGGCCCCAGGAAGGG + Intronic
1091331731 11:134736184-134736206 TTCCCACGGGCCCCCAGGAATGG - Intergenic
1091390295 12:122148-122170 GTCTCTCAGGTCCCCGAGCACGG + Intronic
1091563256 12:1630149-1630171 GTCCCCAGGCTCCCCGGGAGGGG - Intronic
1094817791 12:34204395-34204417 GTCTCTCGTGTCCTCGGGACTGG - Intergenic
1101504053 12:105330642-105330664 GTCCGGCGGGTCCCCGGGCGGGG + Exonic
1105277272 13:18943545-18943567 GTCCCCCGGGTCACGGGGACGGG - Intergenic
1118776675 14:68978216-68978238 GCCCCTCCGACCCCCGGGAAAGG - Intronic
1119392856 14:74302909-74302931 GTCCCTCGGGTCTCAGGTCATGG - Exonic
1121074831 14:91059898-91059920 GCCCCTCTGGTCCCCGCGATGGG - Intronic
1122231514 14:100308399-100308421 GTCCCTGGGGTCCTTGGGAAGGG + Intergenic
1122231882 14:100310228-100310250 GTCCCTGGGGTCCTTGGGAAGGG + Intergenic
1122888551 14:104722389-104722411 GCCCCAGGGGTCCCCAGGAAGGG + Intronic
1125889253 15:43253478-43253500 GTCCCTGGCGTGCCCGGGGAGGG - Intronic
1125916438 15:43492455-43492477 GTCCATCTGCTCCCCTGGAATGG + Exonic
1128457519 15:67840560-67840582 GTCTCTCGGGTCCCCGCGCAGGG - Intergenic
1131511541 15:93051894-93051916 GGGCCTCGGGTGCCTGGGAATGG - Intronic
1132724946 16:1334420-1334442 GGCGCCCGGGGCCCCGGGAAAGG + Intronic
1132750933 16:1457332-1457354 GTCCTTCTGGTCTCCAGGAAGGG - Exonic
1132750942 16:1457382-1457404 GTCCTTCTGGTCTCCAGGAAGGG - Intronic
1132750950 16:1457432-1457454 GTCCTTCTGGTCTCCAGGAAGGG - Intronic
1132750958 16:1457482-1457504 GTCCTTCTGGTCTCCAGGAAGGG - Intronic
1132750967 16:1457532-1457554 GTCCTTCTGGTCTCCAGGAAGGG - Intronic
1132750976 16:1457582-1457604 GTCCTTCTGGTCTCCAGGAAGGG - Intronic
1133246689 16:4453782-4453804 GGGCCACAGGTCCCCGGGAAGGG - Intronic
1139774998 16:69311438-69311460 GTACCTCGGCTCCCCGGGGCCGG + Exonic
1148468182 17:47877400-47877422 GACCCTCTGATCCCAGGGAAGGG - Intergenic
1151458583 17:74241426-74241448 GTCTCTGGGGTTCCCCGGAATGG - Intronic
1151461459 17:74256589-74256611 CTTCCTGGGGTCCCCGGGAGTGG + Intronic
1152174985 17:78781807-78781829 GTCGCTGGGGTCCCCGGGGCAGG - Intronic
1152546841 17:81004373-81004395 GTCCCTGGTGATCCCGGGAAAGG - Intronic
1158718434 18:59900546-59900568 GTTCCTCGTGGCCCCGGGGAAGG - Intronic
1160731775 19:644533-644555 GTTCCTCGGATCCCCCGGGAAGG + Intergenic
1161196089 19:2987484-2987506 GCCCCTCGGGTCCCCCGGGGGGG + Intronic
1163640776 19:18460918-18460940 CTTCCTGGGGTCCCTGGGAAGGG - Intronic
1167641969 19:50687122-50687144 CTCCCTCGGGGCCCCGGGGTGGG + Intronic
927205770 2:20609379-20609401 GTCCCCCCGGGCCCCTGGAACGG - Intronic
938027099 2:127959152-127959174 GGACCTCGGGACCCCAGGAATGG + Intronic
938245242 2:129771683-129771705 GTCCCTGGGCTCCCCAGGCATGG - Intergenic
940316933 2:152335907-152335929 GTCTCTCGGGGTCCCGGGATGGG + Intronic
946484110 2:220084599-220084621 GGCCCTGGGGTCCCAGGGGAGGG - Intergenic
948368881 2:237475185-237475207 GGCCCCGGGGTCCCCGGGAAGGG + Intergenic
1169204392 20:3732115-3732137 GGCCCTCGGGTCCCCAGGCTAGG - Intergenic
1171452747 20:25247748-25247770 GGCCCTCGGGTTCCTGGGACCGG - Intergenic
1173161563 20:40656500-40656522 GTCCCTCTGGTTCACGGGGAGGG - Intergenic
1176128867 20:63487904-63487926 CACCCTGGGGTCCCCGGGCAGGG + Intergenic
1176546741 21:8205546-8205568 GTCCCCCGGGTGCCGGGGAGCGG + Intergenic
1176554636 21:8249736-8249758 GTCCCCCGGGTGCCGGGGAGCGG + Intergenic
1176565692 21:8388593-8388615 GTCCCCCGGGTGCCGGGGAGCGG + Intergenic
1176573557 21:8432761-8432783 GTCCCCCGGGTGCCGGGGAGCGG + Intergenic
1178936337 21:36865349-36865371 GTTCCTGGGGACCCCGAGAAAGG + Intronic
1179925016 21:44529522-44529544 CTGCCTGGGGTCCCCAGGAAGGG + Intronic
1180075536 21:45459678-45459700 GTCCCTCAGGTCCACGAGGAAGG + Intronic
1180177655 21:46098262-46098284 GTCCCTCGGGTCCCCGGGAAGGG + Intronic
1183243710 22:36677392-36677414 CTTTCTCGGGTCCACGGGAAAGG + Intronic
1183414881 22:37676296-37676318 CTTCCTCGGGCCCCAGGGAAAGG + Intronic
1185324073 22:50217143-50217165 GTCCCTGTGGTCCCTGGGAGGGG + Intronic
1203251606 22_KI270733v1_random:121812-121834 GTCCCCCGGGTGCCGGGGAGCGG + Intergenic
1203259656 22_KI270733v1_random:166894-166916 GTCCCCCGGGTGCCGGGGAGCGG + Intergenic
950518166 3:13480535-13480557 GTCCCTCGGGCCACCGAGCAGGG - Intronic
950583800 3:13879418-13879440 GTCCGAAGGGTCCCCGGGATGGG + Intronic
954325565 3:49861564-49861586 GTCCCTCAGGGCCACGGGGAGGG - Exonic
957342878 3:78923426-78923448 GTCACTCTGGTCCTGGGGAAAGG - Intronic
967124694 3:186413279-186413301 GGGTCTGGGGTCCCCGGGAATGG - Intergenic
967980337 3:195061572-195061594 GATCCTGGGGTCCCTGGGAAAGG + Intergenic
972783515 4:42306472-42306494 ATCCCTGGGGTCACCGGGAGCGG + Intergenic
976226176 4:82797455-82797477 GTCCCTGGGGCCCAGGGGAAGGG + Intronic
979703131 4:123689952-123689974 GTTCCACAGGTCCCTGGGAAGGG + Intergenic
984759392 4:183350691-183350713 GTCCCATGGGTCCCCTGAAACGG + Intergenic
986206347 5:5628533-5628555 GTCCCTCTTGTCCCTGGGCAAGG - Intergenic
999386521 5:151157616-151157638 GTCCCTGCAGCCCCCGGGAAGGG + Intronic
1006589017 6:35140948-35140970 GTCCCTGGGGGCGGCGGGAAGGG + Intronic
1011259138 6:85453627-85453649 GTCTCTAGGGTCCCCTAGAAAGG + Intronic
1016329940 6:142945349-142945371 CACCCTCGGGCCACCGGGAAGGG + Intergenic
1016760969 6:147737202-147737224 GTCCCTCCCATCCTCGGGAAGGG + Intronic
1017445651 6:154505072-154505094 GTCTCTGTGGTCCCTGGGAAAGG - Intronic
1019275657 7:174129-174151 CTCCCTCGAGGCCCAGGGAATGG - Intergenic
1020261204 7:6531586-6531608 GTCCCTCCCGACCCCGGGGAGGG - Intronic
1022100424 7:27166158-27166180 ATCCCTGCGGTCCCCGGGAGAGG + Intronic
1035238578 7:157515905-157515927 GGCCCTCGGGGCCCCTGGAGTGG + Intergenic
1039185299 8:34909769-34909791 GTGCCTGGGGTCACAGGGAATGG - Intergenic
1048252477 8:132878212-132878234 GTTCCTCGGGTCCTCATGAAGGG + Intronic
1049222956 8:141436191-141436213 GGCTCTCGGCTCCCGGGGAAGGG + Intergenic
1052933267 9:34073001-34073023 GTCCCCTGAGTCCCGGGGAAAGG + Intergenic
1053022036 9:34701625-34701647 GTCCCTGGGGTCCCCGCGCGCGG + Intergenic
1055626053 9:78178603-78178625 GTCCCACGGTGCCACGGGAAAGG + Intergenic
1057208012 9:93184773-93184795 GTCTCTGGGGGCCCTGGGAAAGG - Intergenic
1060230924 9:121824702-121824724 GTCCCTGGGCTCTTCGGGAAAGG + Intronic
1060358351 9:122931486-122931508 GCCCCTCGGGGCTCCGGGAAGGG + Exonic
1060794321 9:126504066-126504088 GTCCCTGTGGTCCCCGGGTCAGG - Exonic
1062024030 9:134332292-134332314 GACCCCCGGGTCCCAGGGCAGGG + Intronic
1062327498 9:136019263-136019285 ATCCCTCGTGGCCCCCGGAAGGG + Intronic
1062483742 9:136764061-136764083 GTCCCCTGGGTCCCTGGGCAAGG - Intronic
1203468008 Un_GL000220v1:104963-104985 GTCCCCCGGGTGCCGGGGAGCGG + Intergenic
1203475829 Un_GL000220v1:148935-148957 GTCCCCCGGGTGCCGGGGAGCGG + Intergenic
1185682490 X:1899956-1899978 TTCCCGCATGTCCCCGGGAATGG - Intergenic
1189309869 X:40011708-40011730 GTCTCTCGGGATTCCGGGAAGGG - Intergenic
1195615631 X:106909749-106909771 GTCCCTTGGGTTCCTGGGACGGG + Intronic
1199720733 X:150541245-150541267 GTGCCTCTGGTCCCCAGGCACGG - Intergenic
1199770708 X:150973522-150973544 GTGCCTCGGGCCCCAGGGCAAGG + Intergenic
1200111471 X:153743094-153743116 CTCCCTGGGGTCCCCTGGAAGGG + Intronic
1200216845 X:154371796-154371818 GGCCCTGGGGGCCCGGGGAAGGG - Intronic