ID: 1180177783

View in Genome Browser
Species Human (GRCh38)
Location 21:46098604-46098626
Sequence GAGAGGCCCTGCGCCCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180177783_1180177810 27 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177810 21:46098654-46098676 GCGGGGGGAGGAGGGGCTTTCGG 0: 1
1: 0
2: 2
3: 38
4: 618
1180177783_1180177799 5 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177799 21:46098632-46098654 GCCGGACGGAAGGGGCGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 254
1180177783_1180177804 11 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177804 21:46098638-46098660 CGGAAGGGGCGGCGGGGCGGGGG 0: 1
1: 1
2: 40
3: 1143
4: 5791
1180177783_1180177802 9 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177802 21:46098636-46098658 GACGGAAGGGGCGGCGGGGCGGG 0: 1
1: 0
2: 7
3: 55
4: 755
1180177783_1180177798 4 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177798 21:46098631-46098653 GGCCGGACGGAAGGGGCGGCGGG 0: 1
1: 0
2: 0
3: 34
4: 267
1180177783_1180177790 -5 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177790 21:46098622-46098644 CTCTCCCCGGGCCGGACGGAAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1180177783_1180177805 12 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177805 21:46098639-46098661 GGAAGGGGCGGCGGGGCGGGGGG 0: 1
1: 1
2: 66
3: 3980
4: 5552
1180177783_1180177791 -4 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177791 21:46098623-46098645 TCTCCCCGGGCCGGACGGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1180177783_1180177792 -3 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177792 21:46098624-46098646 CTCCCCGGGCCGGACGGAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 113
1180177783_1180177797 3 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177797 21:46098630-46098652 GGGCCGGACGGAAGGGGCGGCGG 0: 1
1: 0
2: 0
3: 41
4: 463
1180177783_1180177808 19 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177808 21:46098646-46098668 GCGGCGGGGCGGGGGGAGGAGGG 0: 1
1: 2
2: 36
3: 392
4: 4506
1180177783_1180177788 -9 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177788 21:46098618-46098640 GGGCCTCTCCCCGGGCCGGACGG 0: 1
1: 0
2: 2
3: 22
4: 176
1180177783_1180177807 18 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177807 21:46098645-46098667 GGCGGCGGGGCGGGGGGAGGAGG 0: 1
1: 11
2: 139
3: 1008
4: 8106
1180177783_1180177803 10 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177803 21:46098637-46098659 ACGGAAGGGGCGGCGGGGCGGGG 0: 1
1: 0
2: 3
3: 53
4: 591
1180177783_1180177801 8 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177801 21:46098635-46098657 GGACGGAAGGGGCGGCGGGGCGG 0: 1
1: 1
2: 5
3: 89
4: 973
1180177783_1180177795 0 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177795 21:46098627-46098649 CCCGGGCCGGACGGAAGGGGCGG 0: 1
1: 0
2: 1
3: 20
4: 240
1180177783_1180177809 20 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177809 21:46098647-46098669 CGGCGGGGCGGGGGGAGGAGGGG 0: 1
1: 2
2: 26
3: 372
4: 3208
1180177783_1180177806 15 Left 1180177783 21:46098604-46098626 CCTCCGGGGGCGCAGGGCCTCTC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1180177806 21:46098642-46098664 AGGGGCGGCGGGGCGGGGGGAGG 0: 1
1: 4
2: 82
3: 829
4: 9902

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180177783 Original CRISPR GAGAGGCCCTGCGCCCCCGG AGG (reversed) Intronic
900335449 1:2160840-2160862 GAGACGCCCCGCCCCGCCGGGGG + Intronic
903049036 1:20587407-20587429 GAGAGGCCCTCAGCCCCAGCAGG + Intergenic
903668657 1:25022746-25022768 CAGAGGCCCAGAGCCCACGGTGG - Intergenic
903734976 1:25524137-25524159 GAGTGGCTCTGGGTCCCCGGAGG - Intergenic
904584651 1:31573452-31573474 GAGAGGGGCTGCGCTGCCGGGGG + Intergenic
905922269 1:41727588-41727610 GAGGGGCGCGGCGCCGCCGGAGG + Intronic
906298274 1:44662467-44662489 GAGAGGCCCTGGGCCTCAGTGGG + Intronic
907459147 1:54594802-54594824 GAGAGGCCCAGGGCCACCAGTGG - Intronic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
920071446 1:203305762-203305784 GAGGGGCCTGGCGCCACCGGGGG + Intronic
922782385 1:228263696-228263718 GAGAGGGCCTGGGCCTCCTGTGG - Intronic
923127079 1:231041235-231041257 GAGAAGGCCAGCGCGCCCGGCGG - Intergenic
1065590677 10:27258787-27258809 GAGACGCTCTGCGCCCGCGCTGG - Intergenic
1065660318 10:27999059-27999081 GAGACGCTCTGCGCCCGCGCTGG + Intergenic
1066370637 10:34815525-34815547 GAGGGGTCCCGCGCCCCCGGAGG - Intergenic
1067700618 10:48568785-48568807 GAGAGGCCCTGTGTCCCCAAGGG - Intronic
1067799317 10:49348103-49348125 GAGAAGCCCTGTGCTCCTGGAGG - Intergenic
1073660051 10:105464976-105464998 AAGAGGCCATGTGCCCCCAGTGG - Intergenic
1074313550 10:112342785-112342807 GAGAGGCCCTGGGCCCAGAGCGG - Intergenic
1074823377 10:117197932-117197954 GAAAGGCCCTGAGCACCCTGAGG + Intronic
1074843773 10:117378968-117378990 CAGGGGCGCTGCGCCCCAGGTGG + Intergenic
1076852158 10:133098552-133098574 GACAGAGCCTGCGCCCCAGGGGG + Intronic
1076856211 10:133116598-133116620 GAGAGGCCCTGCCACACCTGGGG - Intronic
1077369920 11:2177053-2177075 GAAAGGCCCTGCACCCCAGGCGG - Intergenic
1077441767 11:2572191-2572213 GAGATGCGCTGAGGCCCCGGGGG + Intronic
1077915947 11:6611783-6611805 GGGTGGCGCGGCGCCCCCGGAGG - Exonic
1084003940 11:66313532-66313554 GAGTGGCCCAGCGCCCCCTTCGG - Intergenic
1084936587 11:72590169-72590191 GTGAGTCCCTGCGCCCCTGCCGG - Intronic
1085896382 11:80644534-80644556 GAGATGCCCTGCGCCACCTCAGG + Intergenic
1094852845 12:34389981-34390003 GGGAAGCCCTGCGTCCCCTGGGG - Intergenic
1096580734 12:52583074-52583096 GACAGGCTCTGCGCCCCTCGCGG - Intergenic
1096627255 12:52903571-52903593 GAGGGGCCCCGGGCCCCCGGCGG - Intronic
1103558292 12:121779001-121779023 GATAGGCCCAGCCCCCTCGGTGG + Exonic
1104031255 12:125066789-125066811 GGGAGTCCCTGCGCCAGCGGAGG - Intronic
1104971477 12:132532780-132532802 GAGAGGCCCTGAGGCCCCTGAGG + Intronic
1112318815 13:98388873-98388895 TGGAGGCCCTGAGCCCCCAGTGG + Intronic
1112805767 13:103162523-103162545 GAGTGGCCCTGCCTCCCCAGAGG + Intergenic
1113904104 13:113811400-113811422 GAGTGGCCCTGGGTCTCCGGGGG + Intronic
1116862173 14:50003470-50003492 GGGCGTCCCCGCGCCCCCGGGGG - Intronic
1117723045 14:58646096-58646118 CAGAGGCCCTGCCCCGCCGCAGG + Exonic
1118276632 14:64391445-64391467 GTGAGCCACTGCGCCCCCGCTGG + Intronic
1118370759 14:65135445-65135467 AAGAGGCCCTGCTCCCGCAGAGG - Intergenic
1118887357 14:69878556-69878578 GAGAGGCCCTGGTCCCCTGATGG - Intronic
1119180137 14:72599995-72600017 GGGAGGGCCTGCCCCTCCGGTGG + Intergenic
1119743353 14:77027951-77027973 GCGAGGCGCTGCGCCGGCGGTGG - Exonic
1122519812 14:102335389-102335411 GAAAGGCCCTGAGCCCCGGCTGG - Intronic
1122599074 14:102912382-102912404 GAGAGGCCCTGAGACCCTGAGGG - Intergenic
1122744580 14:103890261-103890283 GAGGGGCCCTGTGCTCCCAGTGG - Intergenic
1127613218 15:60657343-60657365 GAGAGGGCCTGCTTCCCCAGGGG - Intronic
1128506822 15:68278354-68278376 CAGCTGCCGTGCGCCCCCGGAGG - Exonic
1129392989 15:75229741-75229763 GAGGGGTCCTGTGCACCCGGTGG + Intergenic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1131383018 15:91980208-91980230 GAGAGGCCTCGCTGCCCCGGTGG + Intronic
1132924976 16:2424589-2424611 GTGAGGCCCTGTGCAGCCGGCGG + Intergenic
1133033831 16:3023882-3023904 GAGGGGCCCAGCGCCTCCCGCGG - Exonic
1133128993 16:3664679-3664701 GAGAGCCCCTGGGCCACCTGGGG - Exonic
1133229637 16:4360443-4360465 GAGTGGCCCTGAGCCCCTGCAGG - Exonic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134614890 16:15643263-15643285 GCGAGGCCCCGCCCCCCCCGGGG - Exonic
1136271903 16:29153541-29153563 GAAGGGCCCAGAGCCCCCGGAGG - Intergenic
1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG + Intronic
1137057943 16:35754281-35754303 GAAAGGCCCTGGGCCCCAGCAGG - Intergenic
1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG + Intronic
1138595392 16:58026703-58026725 GCGAGGCCCTGCGCCCTCAAGGG - Intronic
1139359588 16:66389430-66389452 GAGATGCCCAGGGCCTCCGGGGG + Exonic
1139923389 16:70473123-70473145 GCGAGGCCCTGCGAGCCTGGCGG + Exonic
1142168377 16:88605959-88605981 CAGAGGCCCCGCGTCCCCAGAGG - Intronic
1142496949 17:310919-310941 CAGAGGCACTGCCCCCCTGGGGG - Intronic
1142799660 17:2337402-2337424 GAGAGGCCGTGCGCGCCTAGGGG - Exonic
1143126036 17:4641432-4641454 GGGAGGACATGCGCCCCCGTTGG - Intronic
1144707137 17:17377162-17377184 GAGGTGCCCGGCGCCCCGGGCGG - Intergenic
1147142324 17:38466610-38466632 GGGAGGCGCTGCGGGCCCGGGGG - Exonic
1148240812 17:45998376-45998398 GAGAGTCCCTGCGTGCCAGGCGG + Intronic
1149833660 17:59893326-59893348 GTGAGGCCCGGGGTCCCCGGGGG + Intronic
1152654944 17:81515008-81515030 GAGTGGCCCGGCGCCTCCGAGGG + Intronic
1160846298 19:1167676-1167698 CAGAGCCCCTGTGCCCCGGGAGG + Intronic
1161062741 19:2223201-2223223 GAGAGCCCCCCCGCCCCAGGAGG - Intronic
1161331119 19:3688240-3688262 GAGGGACGCTGCGCCCCTGGAGG - Intronic
1161743946 19:6043277-6043299 CTGAGGCCCTGCGTCCCCGCTGG + Intronic
1162954462 19:14090528-14090550 CCGAGGCGCTGCGCCCCCCGGGG - Exonic
1163490898 19:17616723-17616745 CAGAGACCCAGCGCCCACGGAGG + Intronic
1163701761 19:18789804-18789826 GTCTGGCCGTGCGCCCCCGGAGG + Intronic
1163767620 19:19172180-19172202 GGGGAGCCCTGGGCCCCCGGAGG + Intronic
1163884821 19:19956335-19956357 GTGAGGACCTGCGCCCGCGCTGG - Intergenic
1165403680 19:35617572-35617594 GAGAGGCTCTGGGCACCCAGAGG + Intronic
1165901648 19:39172205-39172227 GAGAGGCCCTGGGCGCAGGGGGG + Intronic
1167311323 19:48739443-48739465 AGGAGGCCCTGGGACCCCGGGGG - Exonic
1167331603 19:48859625-48859647 GAGGGCCCCGGCGGCCCCGGTGG - Exonic
1167469369 19:49666807-49666829 GAGTGGCCCTTCTCCCCCAGGGG + Intronic
1168073112 19:53963471-53963493 GAGAGACCCTGAGCCTCCCGGGG + Intronic
1168492353 19:56821518-56821540 GAGAGTCCCAGCGCTCCAGGAGG - Intronic
927606347 2:24490783-24490805 GAGAGGCCCTGCGGACGGGGCGG - Intergenic
929141638 2:38671707-38671729 GAGAGCCACTGTGCCCCTGGAGG - Intronic
929789669 2:45013642-45013664 GAGAGGCGCTGGGCTCCGGGCGG + Intergenic
930641665 2:53859803-53859825 GAGAGGCCGCGGGCCCCTGGAGG - Intronic
932445648 2:71779415-71779437 GAGAGGCCCTGAACCCTGGGTGG + Intergenic
934678261 2:96265352-96265374 GGGCAGCCCTGCGCCTCCGGGGG + Exonic
938265225 2:129923426-129923448 GAGGGTCCCAGCGCCCCCTGGGG - Intergenic
948771422 2:240253068-240253090 GAGGGGCACCGAGCCCCCGGAGG + Intergenic
948939975 2:241190730-241190752 GAGAGGCCCTGTGCCCTCCCTGG - Intronic
1168757314 20:326288-326310 GCGCGGCCCCGCCCCCCCGGTGG + Exonic
1172756643 20:37289875-37289897 GCGAGGCCCTCCGCCTCCCGGGG - Intronic
1176115517 20:63430298-63430320 CAGAGGCCCTGCTGCCCCTGGGG - Intronic
1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG + Intergenic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180560186 22:16609600-16609622 GTGAGGCCCAGCCCCTCCGGCGG + Intergenic
1181104525 22:20565948-20565970 GAAAGGCTCTGGGCCCCCCGAGG - Intronic
1183211780 22:36455545-36455567 GCGAGGACCTGCGGCCCAGGTGG - Intergenic
1183535285 22:38397851-38397873 GAGAGGCCCAGCCCCTCCCGCGG + Intronic
1184250823 22:43259210-43259232 CAGGGGCCCTGCACCCCCTGGGG - Intronic
1184838666 22:47039648-47039670 GAATGGCCCTGCTCCCCCAGGGG + Intronic
959944825 3:112115350-112115372 GAGAGGCCCAGGGCCCTGGGAGG + Intronic
968624138 4:1618884-1618906 GATAAGCCCTGAGCCCTCGGGGG - Intronic
968660121 4:1795376-1795398 GGGAGGCCCCGCGCGCCCGCAGG - Intronic
969264957 4:6058180-6058202 GAGAGGACCTACCCCCCTGGGGG + Intronic
978578677 4:110211231-110211253 GAGAGGCCCTGAGTCCCCAGGGG - Intergenic
985129226 4:186724452-186724474 GGGAGGCCAGGCGCCCGCGGCGG - Intronic
985784571 5:1887061-1887083 GAGCGGCCCAGCGCCACCGCAGG - Exonic
997869928 5:137498329-137498351 GAGAGGCTCCGCGCCCCCCAGGG + Intronic
999319576 5:150605218-150605240 CAGAGGCCCTGAGCCCCAGGTGG + Intronic
1001575830 5:172763257-172763279 ATGAGGCCCGGCGGCCCCGGCGG + Intergenic
1003603619 6:7541364-7541386 GGGAGGACCTGCGCTCGCGGGGG - Intergenic
1005896319 6:30182144-30182166 GAGGGGTCCTGCCCTCCCGGTGG - Intergenic
1006671501 6:35732143-35732165 GAGGGGGCCAGCGCCCCCAGAGG - Intergenic
1010428135 6:75749051-75749073 CAGAGGCTCTGCGCCGCGGGCGG + Intergenic
1011627294 6:89293846-89293868 GAGAAACCCTGTGCCCCTGGAGG + Intronic
1017810625 6:157981486-157981508 GGGAGGCGCAGCGCCCCCGGCGG + Intergenic
1019068397 6:169321801-169321823 GGGAGGCCTTGCGCCCCTGCAGG - Intergenic
1019174581 6:170153729-170153751 GAGGTGCCCTGTGTCCCCGGAGG + Intergenic
1019503161 7:1375670-1375692 GGGAGGCCCTGGGCCCCAAGGGG + Intergenic
1019604139 7:1900066-1900088 CAGCGGCCCTGCGCTCTCGGCGG - Intronic
1019612221 7:1942295-1942317 CAGAGGTCCTGGGCCCCCAGGGG - Intronic
1023221242 7:37921381-37921403 GAGGGGCGCTGCGCCCACCGAGG + Intronic
1024084277 7:45880837-45880859 GAGAGGTCCTGCTGCCCCTGTGG + Intergenic
1024963318 7:55001328-55001350 GAGATGCCCTGCACCACCTGGGG + Intergenic
1026960736 7:74405703-74405725 GGGAGGAGCTGAGCCCCCGGAGG + Exonic
1029437845 7:100572823-100572845 GGGCAGCCTTGCGCCCCCGGGGG + Intronic
1032013305 7:128360543-128360565 CCGAGGCCCTGTGCCCCCTGGGG - Intronic
1032795191 7:135270790-135270812 GCCAGGCCAGGCGCCCCCGGAGG + Intergenic
1034419169 7:150979953-150979975 GGAAGGCCCTGGGCCCCCGGGGG - Intergenic
1035283486 7:157792257-157792279 GAGAGGCCAGGCGCCCGCAGCGG + Intronic
1035567169 8:649509-649531 CAGAGCCCCTGGGCCCCGGGGGG + Intronic
1039473759 8:37828823-37828845 GAGCCGCCCTGCTCCCCGGGAGG - Intronic
1042784987 8:72537033-72537055 CAGAGCCCCGGCGTCCCCGGCGG + Intergenic
1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG + Exonic
1043640475 8:82443659-82443681 GAGAAGCCCTGAGCACCCAGGGG + Intergenic
1048984990 8:139730479-139730501 GAGAGGCCCTCCACCCGTGGTGG - Exonic
1053294391 9:36902569-36902591 GAGAGGCCCTGAAGCCCAGGTGG + Intronic
1053489680 9:38489161-38489183 GAGCGGCCCTGCACCCCCTCTGG - Intergenic
1054775732 9:69122019-69122041 GTGAGGCGCTGCCGCCCCGGGGG - Intronic
1055933561 9:81584354-81584376 CAGAGGCCCTGCTCCCTCGGAGG + Intronic
1057146045 9:92760201-92760223 GGGAGCCCCTGGGCCCCTGGGGG - Intronic
1059102539 9:111484065-111484087 GACTGGCCCTGCGCGCGCGGCGG - Exonic
1060770054 9:126326476-126326498 TAGAGGCCGTGGGCTCCCGGGGG + Intergenic
1061285469 9:129620188-129620210 GAGAGCGCGAGCGCCCCCGGAGG - Exonic
1061678735 9:132232223-132232245 GAGAGGCCCTGGGGGCCAGGTGG - Intronic
1061873309 9:133531965-133531987 GACAGGCCCTGCTCCCACTGCGG + Intergenic
1062120671 9:134832502-134832524 GTGAGGCCCTGCTCTCCTGGTGG - Intronic
1062247384 9:135576163-135576185 GAGAGGTCCTCAGGCCCCGGGGG - Intergenic
1062277791 9:135738938-135738960 GAGAGGCCCTGTCCCCCCATTGG - Intronic
1062321536 9:135992736-135992758 GAGAGGCCATGCGGCTCCCGGGG + Intergenic
1062685255 9:137809407-137809429 CGGCGGCCCTGCGCCCTCGGAGG + Intronic
1185778811 X:2828855-2828877 GAGAGGACCCGCGCCCGCGGGGG + Exonic
1199798683 X:151227959-151227981 GAGAGGCGCTGCCGCCACGGCGG - Intergenic
1201634877 Y:16111833-16111855 GAGAGGCCCCGCTCCCCTGCTGG + Intergenic