ID: 1180181299

View in Genome Browser
Species Human (GRCh38)
Location 21:46119767-46119789
Sequence CCACACGCCTGTTCTCTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 177}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180181288_1180181299 18 Left 1180181288 21:46119726-46119748 CCTCCACAGGCTCTGGGCTTGGA 0: 1
1: 0
2: 0
3: 30
4: 330
Right 1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 177
1180181286_1180181299 19 Left 1180181286 21:46119725-46119747 CCCTCCACAGGCTCTGGGCTTGG 0: 1
1: 0
2: 4
3: 46
4: 373
Right 1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 177
1180181285_1180181299 22 Left 1180181285 21:46119722-46119744 CCACCCTCCACAGGCTCTGGGCT 0: 1
1: 0
2: 9
3: 59
4: 599
Right 1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 177
1180181290_1180181299 -10 Left 1180181290 21:46119754-46119776 CCCCCTCCCTCACCCACACGCCT 0: 1
1: 0
2: 11
3: 112
4: 1305
Right 1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 177
1180181282_1180181299 24 Left 1180181282 21:46119720-46119742 CCCCACCCTCCACAGGCTCTGGG 0: 1
1: 2
2: 11
3: 177
4: 2849
Right 1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 177
1180181289_1180181299 15 Left 1180181289 21:46119729-46119751 CCACAGGCTCTGGGCTTGGACTC 0: 1
1: 0
2: 1
3: 31
4: 284
Right 1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 177
1180181284_1180181299 23 Left 1180181284 21:46119721-46119743 CCCACCCTCCACAGGCTCTGGGC 0: 1
1: 2
2: 1
3: 44
4: 473
Right 1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 177
1180181280_1180181299 25 Left 1180181280 21:46119719-46119741 CCCCCACCCTCCACAGGCTCTGG 0: 1
1: 0
2: 33
3: 331
4: 1885
Right 1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180181299 Original CRISPR CCACACGCCTGTTCTCTGCA GGG Exonic
903233156 1:21934014-21934036 CAAGACGCCTGTCCCCTGCAGGG + Intronic
906702109 1:47867024-47867046 CCACCCGCCTGTCTCCTGCAAGG + Intronic
909746137 1:79099434-79099456 CCATACGCCTGTGCTTTACAGGG + Intergenic
912940017 1:114036573-114036595 CCACATCTCTGTTCTCTGGAAGG - Intergenic
916530427 1:165651505-165651527 CCACCCTCCTTTGCTCTGCATGG - Intronic
918218630 1:182415572-182415594 ACACACGCCTGCTCTCCACATGG - Intergenic
919495223 1:198256757-198256779 CCTCACACCTGTTCTCTTCAAGG - Intronic
919818824 1:201459872-201459894 CCACAGGCTTGTACTCTGTACGG + Intergenic
921786922 1:219242385-219242407 CCCCTGGCCTGTTCTCTGCTAGG - Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063139042 10:3240393-3240415 CGAGACCCGTGTTCTCTGCAGGG + Intergenic
1069629501 10:69889164-69889186 CCCCACCCCTGCTCTCTGAAGGG + Intronic
1073083896 10:100876429-100876451 CCAGACGGCTGTCCTATGCAGGG + Intergenic
1073142820 10:101260522-101260544 CCAAACGCTTGTTCTGTGCCAGG - Intergenic
1073920625 10:108454074-108454096 CTACACCCATGTTCCCTGCAAGG + Intergenic
1075114648 10:119615929-119615951 TCACATGCTTGTTCTCTGCCAGG + Intergenic
1075598749 10:123751562-123751584 CCACATGCCTGTCCTTTGCTTGG - Intronic
1075649839 10:124120131-124120153 CCACCCGCATCTTCTATGCAAGG - Intergenic
1075672602 10:124272812-124272834 ACACAGGACTGTTCTCTCCAGGG + Intergenic
1075734521 10:124655662-124655684 CCAGCAGCCTGTTCTCTGCTGGG + Intronic
1076445016 10:130508536-130508558 CCACAAGCCAGTTCTCTTCCAGG - Intergenic
1079399164 11:20091988-20092010 TCAAAGGCCTGTTCTCTGAATGG + Intronic
1081107020 11:39083289-39083311 CCAGATGGCTGTTCTCTGCTGGG - Intergenic
1083506750 11:63164966-63164988 TGACACTCCTGTTTTCTGCAAGG - Intronic
1083767486 11:64848835-64848857 CAACACACCTGCCCTCTGCAGGG - Intergenic
1084466884 11:69328471-69328493 CGCCACGCCTGTTCTGTGCCAGG - Intronic
1084784804 11:71435878-71435900 CCACACTCCTGTCCTCTCCCTGG - Intronic
1085779315 11:79393998-79394020 CCTCAGGCTTGTTCTCTGAAAGG + Intronic
1086965680 11:93025692-93025714 CCACGTCCCTGTTCTCTGCAAGG + Intergenic
1088950117 11:114560231-114560253 TCACCCACCAGTTCTCTGCATGG - Intergenic
1090078054 11:123591784-123591806 CCACAAGGCTGTTGTGTGCATGG - Intronic
1091714621 12:2768026-2768048 CCAAATGCCTTTTCTCTGTAGGG + Intergenic
1091979209 12:4852045-4852067 ACACACCCCTTTTCTCTGCCAGG + Intergenic
1092557738 12:9575380-9575402 CCACACAACTGTTCCCTGGAAGG + Intergenic
1098092790 12:66921936-66921958 CCACCTGCCTGCTATCTGCAAGG + Intergenic
1103436822 12:120933159-120933181 CCACACGCCTCTTCTACGCGTGG - Intergenic
1103957607 12:124586730-124586752 CCACACACCTGTGCACTGCCGGG - Intergenic
1105690132 13:22829362-22829384 CCACACTCCTCTTATCTTCATGG - Intergenic
1106599983 13:31179421-31179443 TCTCACCCCTGCTCTCTGCAGGG + Intergenic
1109242871 13:59912441-59912463 CTACATGCCTTTTATCTGCAAGG - Intronic
1110270201 13:73580896-73580918 CCGCACACATGTACTCTGCAGGG - Intergenic
1111995983 13:95166815-95166837 CCACACGCCTTTTTCCAGCAGGG - Intronic
1112108047 13:96263936-96263958 CCACATGCCTGTTCTCAAAATGG + Intronic
1113470406 13:110540905-110540927 CCTCACGGCTGGTCTCTGCTGGG + Intronic
1116861696 14:50000775-50000797 CCACATCCCTGTCCACTGCATGG - Intronic
1116950956 14:50877959-50877981 CCACACTCCTGTTCAATGCTCGG + Exonic
1117547466 14:56805162-56805184 CCCAACCCCTGTTCTCTGCTTGG + Intronic
1118688014 14:68310956-68310978 CCACACACCTCATCTTTGCATGG + Intronic
1118729676 14:68657596-68657618 CCACCAGACTGATCTCTGCAGGG - Intronic
1120281282 14:82441674-82441696 CCACACTCCTGATCGTTGCATGG + Intergenic
1122833943 14:104421817-104421839 CCACAAGCCTGCTCTATGAAGGG - Intergenic
1122881021 14:104690424-104690446 CCCCACGCCTGTGCTCCCCAGGG - Intronic
1123572332 15:21626309-21626331 CCACTCTTCTTTTCTCTGCAAGG + Intergenic
1123608946 15:22068896-22068918 CCACTCTCCTTTTCTCTGCAAGG + Intergenic
1127258578 15:57311154-57311176 CCACTAGGCTGTTCTCTGCTGGG + Intergenic
1128582275 15:68818522-68818544 CCACACGCCTGCCCCCTGCCTGG - Intronic
1129718418 15:77864951-77864973 CCCCACCCCTGCTCTGTGCAGGG + Intergenic
1130370506 15:83282955-83282977 CCAGACGCCTGGTCTCAGCCAGG - Intronic
1130828858 15:87579028-87579050 CCTCATGCCTGTTCTGTCCATGG - Intergenic
1130886845 15:88100325-88100347 CAACACCCCTGTTCTCCACAGGG + Intronic
1131902526 15:97104008-97104030 CCACACTCCCGTTATCTGAAGGG - Intergenic
1202981187 15_KI270727v1_random:360696-360718 CCACTCTCCTTTTCTCTGCAAGG + Intergenic
1133270519 16:4609020-4609042 CCACAATCCTTTTCTCTGCAAGG + Exonic
1134004355 16:10808023-10808045 TCACACACCTGTTCACTTCAAGG - Intronic
1135923529 16:26672415-26672437 CCCCACCCCCGTTCTCTGCGTGG + Intergenic
1138596076 16:58029640-58029662 ACACTGGGCTGTTCTCTGCAAGG - Intronic
1139472669 16:67186633-67186655 CCACACGAATGTTCTCTTCCAGG + Exonic
1139968634 16:70759985-70760007 CCTCACGACGGTTCTCTGCGGGG - Intronic
1141172781 16:81701727-81701749 CCCCACGTCTGTGCTCTCCAGGG - Exonic
1142212719 16:88816134-88816156 CCACACCTGTGCTCTCTGCAGGG - Intronic
1142343977 16:89542234-89542256 CCACAGCCCTGGCCTCTGCAAGG + Intronic
1144370755 17:14589464-14589486 CCTCAGGCCTGGTCTCTGCTAGG - Intergenic
1144814112 17:18021314-18021336 ACTCACTCCTGTTCTCTGCTAGG - Intronic
1144850244 17:18240557-18240579 CTACGCGCTTGTTTTCTGCAGGG + Exonic
1148769170 17:50056952-50056974 GCACTAGCCTGTTCTCTCCAGGG + Intronic
1149407386 17:56367706-56367728 CCATACTCCTGATCTCTGCAAGG - Intronic
1149991058 17:61383863-61383885 CCACTCTCCTGTGGTCTGCAGGG + Intronic
1151518796 17:74614079-74614101 CCATACGGGTGTTCTGTGCATGG - Intronic
1152641080 17:81449532-81449554 CCACACGCCTGTAGCCTGCAAGG + Intronic
1153934930 18:9913379-9913401 CCCCACGCCTGTTCTCCACAGGG + Intergenic
1154272628 18:12933110-12933132 CCTCACTCCTGTGCTCTGGAGGG - Intergenic
1154322811 18:13368320-13368342 CCAGGCCCCCGTTCTCTGCAGGG - Intronic
1155364330 18:25035253-25035275 CCACTCCCCTTTTCCCTGCAGGG - Intergenic
1156461696 18:37325003-37325025 CCACACTCCTGGCCTCTGCTTGG - Intronic
1160331925 18:78001604-78001626 CCACATGTCTCTTCTGTGCATGG + Intergenic
1161589105 19:5120793-5120815 CCACAAACCTGCTCCCTGCATGG - Intronic
1162499257 19:11042098-11042120 CCACACTCCTGCTCTCTGCCAGG + Intronic
1162781000 19:13007007-13007029 CCCCATGCCTGTTCCCTGGAAGG + Intronic
1166275311 19:41749582-41749604 CAACACGCCCCTGCTCTGCACGG + Intronic
1166280335 19:41788379-41788401 CAACACGCCCCTGCTCTGCACGG + Intergenic
1166396407 19:42444365-42444387 CAACACGCCCCTGCTCTGCACGG - Intergenic
1166703030 19:44893108-44893130 CCAAACCCCTGCTCTCTGCCTGG + Intronic
1167105291 19:47426859-47426881 CCACAAACCTGTTCTCATCAAGG + Intergenic
925152629 2:1625612-1625634 CCACATTCCTGGCCTCTGCAAGG + Intergenic
925359861 2:3270236-3270258 CCACACGGGTGCTCGCTGCAGGG + Intronic
926716956 2:15932328-15932350 CCACACCCCTTTACTCTTCATGG - Intergenic
930210443 2:48631555-48631577 CCAAACACCGGTTCTCTGAAAGG - Intronic
932331351 2:70900145-70900167 CCAACCTCCTGTTCTCTGCTAGG + Intergenic
934568423 2:95353236-95353258 CCCCACCCAGGTTCTCTGCATGG - Intronic
934576007 2:95402130-95402152 CTACACGCCTGCCCTCTGCAGGG + Intergenic
934611562 2:95741302-95741324 CCCCATGACTGTTCTCTGCTAGG + Intergenic
934638185 2:96009987-96010009 CTGCACGCCTGCCCTCTGCAGGG + Intergenic
934795466 2:97095423-97095445 CCGCACGCCTGCCCTCTGCAGGG - Intergenic
935472751 2:103479620-103479642 CCAAACTCCTGTCCTCTGGATGG + Intergenic
936515692 2:113180085-113180107 CCCCACGCCTTTTTTCTGGAGGG - Intronic
936544898 2:113382900-113382922 CCCCATGGCTGTTCTCTGCTAGG + Intergenic
938137869 2:128774104-128774126 CCCAAAGCCTGTTCTCTGCCAGG - Intergenic
938757593 2:134395077-134395099 CTACCAGCCTGTTTTCTGCATGG + Intronic
944306270 2:198183491-198183513 CCACACGGCTGTGCTGTGCCTGG - Intronic
944395872 2:199265400-199265422 ACCCACCCCTGTTCTCTGCATGG + Intergenic
944786102 2:203071949-203071971 CCCCACCCCAGGTCTCTGCAAGG + Intronic
945959451 2:216117043-216117065 TCACTTCCCTGTTCTCTGCATGG + Intronic
946202718 2:218080320-218080342 CCCCCAGCCTGTGCTCTGCACGG - Intronic
1170515796 20:17129213-17129235 CCACAGGCCTGCGCTCTGCAAGG + Intergenic
1172633806 20:36395794-36395816 CCACACCCCTGCTCTGAGCATGG - Intronic
1175627962 20:60504712-60504734 ACACACACCTGTTCTTTACAGGG + Intergenic
1175757122 20:61536888-61536910 CCACCGGCCTCTTCTCTGGAGGG - Intronic
1180181299 21:46119767-46119789 CCACACGCCTGTTCTCTGCAGGG + Exonic
1180208788 21:46280719-46280741 CCACACGTCTGCTAACTGCATGG + Intronic
1180766965 22:18351070-18351092 CCTGCCGCCTGTTCTGTGCAAGG - Intergenic
1180779348 22:18511309-18511331 CCTGCCGCCTGTTCTGTGCAAGG + Intergenic
1180812065 22:18768629-18768651 CCTGCCGCCTGTTCTGTGCAAGG + Intergenic
1181198220 22:21202873-21202895 CCTGCCGCCTGTTCTGTGCAAGG + Intergenic
1181703485 22:24634028-24634050 CCTGCCGCCTGTTCTGTGCAAGG - Intergenic
1185281253 22:49971074-49971096 CCACCCGCCTGTCCTGTCCAAGG + Intergenic
1203228587 22_KI270731v1_random:91964-91986 CCTGCCGCCTGTTCTGTGCAAGG - Intergenic
950614496 3:14148147-14148169 CCACAGGCCTGCCTTCTGCACGG - Intronic
954590533 3:51778200-51778222 CCACAGGCCTGTGCTTGGCAAGG - Intergenic
954976243 3:54697615-54697637 CCACACTCCTGTGGTCTGGAAGG + Intronic
957478996 3:80767143-80767165 CAACAGGCCTTTTATCTGCAAGG + Intergenic
959509077 3:107189405-107189427 CCCCATGGCTGTTCTCTGCCTGG + Intergenic
960377640 3:116923144-116923166 CCACATGCCTGTGTTCTGAATGG + Intronic
961424679 3:126835576-126835598 CATCACTCCTGTTCTCTGCAAGG + Intronic
963251957 3:143111840-143111862 AAACAAGCCTGTTCTCTCCATGG - Intergenic
964492341 3:157250145-157250167 CTACATGCCTTTTCTCTCCAAGG + Intergenic
965562708 3:170077013-170077035 CCACAAGCCTGTTTTCCTCATGG + Intronic
968471558 4:784876-784898 CCCCGCGCATGTTCTCTCCACGG - Intergenic
968897932 4:3415681-3415703 CCACACACCTGGTCTTGGCAAGG - Intronic
969129875 4:4983471-4983493 CCACAAGCCTATTCTCTGTCTGG - Intergenic
969377294 4:6771374-6771396 CCACAGGCCTGAGCTCTGCAGGG + Intergenic
970431706 4:15994863-15994885 CAACCCGCTTGTTCTCTGGAGGG - Intronic
978905214 4:113997188-113997210 CCAGAAGCCTTTTCTCTGGATGG - Intergenic
981857701 4:149313862-149313884 CCACACAACTGATCTCTGCAGGG + Intergenic
985649901 5:1102606-1102628 CCACCCGCCACTGCTCTGCAGGG - Intronic
987810571 5:22829611-22829633 TCACATGTCTGTTCTCTTCAAGG - Intronic
989105801 5:37861966-37861988 CCCCAGGCCTTTTCTCTCCACGG - Intergenic
992384157 5:76267764-76267786 CCTCACCCCTGTTGTCTGCCTGG - Intronic
992441769 5:76803345-76803367 CCTCACTCCTCTCCTCTGCAGGG - Intergenic
999614179 5:153404763-153404785 CCAGAAGCCTGATCTCAGCAAGG + Intergenic
1000554906 5:162714606-162714628 CCACTCCTCTGTTCTCTACAGGG + Intergenic
1001760161 5:174201039-174201061 CCATACGCTTGTTGGCTGCATGG + Intronic
1002307117 5:178290417-178290439 CCCCTCGCCTGTCCTCAGCACGG + Intronic
1002661714 5:180795851-180795873 TCACACACCTGCTCTCTGCCAGG + Intronic
1003665537 6:8108080-8108102 CCACAGGCATGTTTTCTGGAAGG - Intergenic
1004341204 6:14808984-14809006 ACACACGCGTCTTCTCTGTAGGG + Intergenic
1004522703 6:16377347-16377369 GCACACTCTTGTTCTCTGCCTGG + Intronic
1005058725 6:21756462-21756484 ACACGTGCCTTTTCTCTGCAAGG + Intergenic
1017526218 6:155243357-155243379 CCAGACGCCCTTCCTCTGCAGGG + Intronic
1023809879 7:43903840-43903862 CCCAACACATGTTCTCTGCATGG - Intronic
1025163539 7:56688557-56688579 CAACTCGCCTCTTGTCTGCAGGG - Intergenic
1026353866 7:69540581-69540603 CCACACCCCCCTTTTCTGCAAGG - Intergenic
1028603885 7:92633495-92633517 CCACAGACCTGATTTCTGCATGG + Intronic
1029306064 7:99620992-99621014 TCACTGGCCTGTTCACTGCAGGG + Intronic
1029634184 7:101772955-101772977 CCACTCCCCTGTTCACTCCAGGG - Intergenic
1029941007 7:104480741-104480763 CCAAATGCCTGTTTTATGCACGG - Intronic
1032386650 7:131530048-131530070 CCACAAGCCTCTTCTTTCCAGGG + Intronic
1033243515 7:139700249-139700271 CAACACGCCTGCTTTCTGCAAGG + Intronic
1033472339 7:141661369-141661391 CCACCTGCCTGTTCTCTGGTTGG - Exonic
1034925180 7:155115469-155115491 ACCCACGCCTGGGCTCTGCAAGG - Intergenic
1034995067 7:155571827-155571849 CCACCAGCCTGTGCCCTGCAGGG - Intergenic
1036918358 8:12827410-12827432 CCAAACACCTAATCTCTGCATGG - Intergenic
1038155247 8:24983212-24983234 CCACTCTCCTGCTCTCTGGAAGG - Intergenic
1039433680 8:37545304-37545326 CCCCACTCTCGTTCTCTGCAAGG - Intergenic
1039901677 8:41757370-41757392 CCACACACCTGTTCCCTTCCTGG + Intronic
1040470812 8:47734529-47734551 CCACACTCCTCCTCTGTGCAAGG - Intronic
1044437734 8:92185685-92185707 CCACATGCCTGTTTTCTTCTAGG + Intergenic
1045253823 8:100502919-100502941 CCACACACCTGGCCCCTGCAGGG - Intergenic
1048442725 8:134471833-134471855 CCACACTCCTCTGCTCTTCAGGG + Intergenic
1049242380 8:141544547-141544569 CTACACAGCTGCTCTCTGCAGGG - Intergenic
1052285650 9:26782036-26782058 CTACCTCCCTGTTCTCTGCATGG - Intergenic
1052988214 9:34503040-34503062 CCACACCCCCCTTCTCTGCTCGG - Intronic
1056051963 9:82778220-82778242 CGCCAGGCCAGTTCTCTGCATGG - Intergenic
1058478795 9:105369810-105369832 ACACAGGCCTGTTCCATGCATGG + Intronic
1060652584 9:125341829-125341851 CCAAAGGCCTCTTCTCAGCACGG + Intronic
1060655128 9:125366875-125366897 CCACAGGCCTGAGCTCAGCAAGG + Intronic
1061331525 9:129897304-129897326 CCACCCCCCAGTTTTCTGCAAGG + Intronic
1061658835 9:132114297-132114319 CCACCCGCCTGCGCTCTGCTGGG - Intergenic
1186331280 X:8536780-8536802 CCACAAGCCTGTTGGCTGCCTGG - Exonic
1186423668 X:9446025-9446047 GCACACGCCTGTTCCCTGGCAGG - Intergenic
1190133864 X:47776449-47776471 CCACACTCCTCTGCCCTGCATGG - Intergenic
1191870274 X:65739791-65739813 CCAGTCGCATGTTCTCAGCATGG - Exonic
1192549548 X:72042982-72043004 CCACACATCTGTTCTGTGCCAGG + Intergenic
1200231695 X:154446994-154447016 CCACACACCTGTGCTGTGCCTGG + Intronic
1201277284 Y:12311155-12311177 CCTGACCCCTGCTCTCTGCAGGG + Intergenic
1201431330 Y:13905820-13905842 CCACAAGCCTGTTGGCTGCCTGG + Intergenic