ID: 1180182752

View in Genome Browser
Species Human (GRCh38)
Location 21:46125179-46125201
Sequence TGTCCCGGGACCCCCAGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 1, 2: 1, 3: 34, 4: 309}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180182747_1180182752 -3 Left 1180182747 21:46125159-46125181 CCTCCACACGTGGGCTGGAATGT 0: 1
1: 0
2: 2
3: 41
4: 367
Right 1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG 0: 1
1: 1
2: 1
3: 34
4: 309
1180182740_1180182752 13 Left 1180182740 21:46125143-46125165 CCTCCCCGCATGGCTGCCTCCAC 0: 1
1: 0
2: 1
3: 29
4: 381
Right 1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG 0: 1
1: 1
2: 1
3: 34
4: 309
1180182741_1180182752 10 Left 1180182741 21:46125146-46125168 CCCCGCATGGCTGCCTCCACACG 0: 1
1: 0
2: 0
3: 12
4: 127
Right 1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG 0: 1
1: 1
2: 1
3: 34
4: 309
1180182739_1180182752 17 Left 1180182739 21:46125139-46125161 CCAGCCTCCCCGCATGGCTGCCT 0: 1
1: 0
2: 2
3: 64
4: 1379
Right 1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG 0: 1
1: 1
2: 1
3: 34
4: 309
1180182742_1180182752 9 Left 1180182742 21:46125147-46125169 CCCGCATGGCTGCCTCCACACGT 0: 1
1: 0
2: 0
3: 19
4: 157
Right 1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG 0: 1
1: 1
2: 1
3: 34
4: 309
1180182737_1180182752 21 Left 1180182737 21:46125135-46125157 CCCGCCAGCCTCCCCGCATGGCT 0: 1
1: 0
2: 2
3: 29
4: 314
Right 1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG 0: 1
1: 1
2: 1
3: 34
4: 309
1180182743_1180182752 8 Left 1180182743 21:46125148-46125170 CCGCATGGCTGCCTCCACACGTG 0: 1
1: 0
2: 0
3: 18
4: 229
Right 1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG 0: 1
1: 1
2: 1
3: 34
4: 309
1180182738_1180182752 20 Left 1180182738 21:46125136-46125158 CCGCCAGCCTCCCCGCATGGCTG 0: 1
1: 0
2: 1
3: 35
4: 364
Right 1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG 0: 1
1: 1
2: 1
3: 34
4: 309
1180182748_1180182752 -6 Left 1180182748 21:46125162-46125184 CCACACGTGGGCTGGAATGTCCC 0: 1
1: 0
2: 0
3: 17
4: 78
Right 1180182752 21:46125179-46125201 TGTCCCGGGACCCCCAGGCCAGG 0: 1
1: 1
2: 1
3: 34
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180182752 Original CRISPR TGTCCCGGGACCCCCAGGCC AGG Intronic