ID: 1180182949

View in Genome Browser
Species Human (GRCh38)
Location 21:46126059-46126081
Sequence CGACCGCGACGTCACAGTGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 11}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180182944_1180182949 13 Left 1180182944 21:46126023-46126045 CCCTCGGGACGATGACCTCAACT 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1180182949 21:46126059-46126081 CGACCGCGACGTCACAGTGACGG 0: 1
1: 0
2: 1
3: 0
4: 11
1180182948_1180182949 -2 Left 1180182948 21:46126038-46126060 CCTCAACTTGCGGGCGCTGTGCG 0: 1
1: 0
2: 0
3: 2
4: 13
Right 1180182949 21:46126059-46126081 CGACCGCGACGTCACAGTGACGG 0: 1
1: 0
2: 1
3: 0
4: 11
1180182943_1180182949 19 Left 1180182943 21:46126017-46126039 CCACGACCCTCGGGACGATGACC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1180182949 21:46126059-46126081 CGACCGCGACGTCACAGTGACGG 0: 1
1: 0
2: 1
3: 0
4: 11
1180182945_1180182949 12 Left 1180182945 21:46126024-46126046 CCTCGGGACGATGACCTCAACTT 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1180182949 21:46126059-46126081 CGACCGCGACGTCACAGTGACGG 0: 1
1: 0
2: 1
3: 0
4: 11

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180182949 Original CRISPR CGACCGCGACGTCACAGTGA CGG Exonic
923487151 1:234444523-234444545 CGATCGTGAATTCACAGTGATGG - Intronic
1065583210 10:27192411-27192433 CCACAGTGACATCACAGTGATGG - Intergenic
1124478896 15:30060475-30060497 CCACCCCGAGGTCACAGGGAGGG + Intergenic
1166518258 19:43463129-43463151 CGACGGCAACGTCACCTTGACGG - Exonic
1180182949 21:46126059-46126081 CGACCGCGACGTCACAGTGACGG + Exonic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
1007050446 6:38823013-38823035 GGACCGCGATGTGAAAGTGAAGG + Exonic
1025981846 7:66413476-66413498 CTTCCGCGACGTCACAGTGACGG - Intronic
1026038220 7:66845032-66845054 CTTCCGCGTCGTCAGAGTGACGG + Intergenic
1035321336 7:158031235-158031257 CGACCTCGATCTCACCGTGATGG + Intronic
1060480054 9:124012447-124012469 CGACCGCGGCGACACCGAGACGG + Exonic
1062370352 9:136235607-136235629 CCACCACGACGTCTGAGTGAAGG + Intronic
1198658123 X:138936832-138936854 GGACCGCAAGGCCACAGTGAGGG + Intronic