ID: 1180183762

View in Genome Browser
Species Human (GRCh38)
Location 21:46129540-46129562
Sequence TTCCCAGGGCTGCCCCCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 174}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180183750_1180183762 15 Left 1180183750 21:46129502-46129524 CCCGCCCAGCCGGGCTGGGCCCT 0: 1
1: 0
2: 6
3: 73
4: 479
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183752_1180183762 11 Left 1180183752 21:46129506-46129528 CCCAGCCGGGCTGGGCCCTCCCT 0: 1
1: 0
2: 1
3: 33
4: 409
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183756_1180183762 -5 Left 1180183756 21:46129522-46129544 CCTCCCTGCCACACTAGCTTCCC 0: 1
1: 0
2: 2
3: 31
4: 444
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183755_1180183762 -4 Left 1180183755 21:46129521-46129543 CCCTCCCTGCCACACTAGCTTCC 0: 1
1: 2
2: 5
3: 48
4: 595
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183757_1180183762 -8 Left 1180183757 21:46129525-46129547 CCCTGCCACACTAGCTTCCCAGG 0: 1
1: 1
2: 10
3: 44
4: 273
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183747_1180183762 22 Left 1180183747 21:46129495-46129517 CCGGGCACCCGCCCAGCCGGGCT 0: 1
1: 0
2: 1
3: 30
4: 330
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183754_1180183762 6 Left 1180183754 21:46129511-46129533 CCGGGCTGGGCCCTCCCTGCCAC 0: 1
1: 0
2: 9
3: 92
4: 689
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183751_1180183762 14 Left 1180183751 21:46129503-46129525 CCGCCCAGCCGGGCTGGGCCCTC 0: 1
1: 1
2: 7
3: 27
4: 404
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183746_1180183762 23 Left 1180183746 21:46129494-46129516 CCCGGGCACCCGCCCAGCCGGGC 0: 1
1: 1
2: 4
3: 39
4: 391
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183759_1180183762 -9 Left 1180183759 21:46129526-46129548 CCTGCCACACTAGCTTCCCAGGG 0: 1
1: 0
2: 2
3: 17
4: 300
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174
1180183753_1180183762 10 Left 1180183753 21:46129507-46129529 CCAGCCGGGCTGGGCCCTCCCTG 0: 1
1: 0
2: 2
3: 41
4: 468
Right 1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG 0: 1
1: 0
2: 5
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180183762 Original CRISPR TTCCCAGGGCTGCCCCCGAC AGG Intronic
900100492 1:960225-960247 TTCCCCGGGAAGCCCCCCACAGG - Intergenic
901069404 1:6509675-6509697 TTCTGAGGGCAGCCCCCGGCAGG + Intronic
901973885 1:12929510-12929532 TTCCAAGATCTGCCCCCCACAGG + Intronic
901977401 1:13005943-13005965 TCCCCAGTGCTGCCCCCTGCTGG - Intronic
902004684 1:13222991-13223013 TCCCCAGTGCTGCCCCCTGCTGG + Intergenic
902011293 1:13272258-13272280 TTCCAAGATCTGCCCCCCACAGG - Intergenic
902023903 1:13368726-13368748 TCCCCAGTGCTGCCCCCTGCTGG + Intergenic
902116352 1:14124880-14124902 TCCCCAGTGCTGCCCCCGACAGG - Intergenic
902230672 1:15025471-15025493 TTGCCAGCTCTGCCCCTGACAGG - Intronic
902451923 1:16501655-16501677 TCCCCAGTGCTGCCGCCCACCGG + Intergenic
902501032 1:16912009-16912031 TCCCCAGTGCTGCCACCCACCGG - Intronic
902618012 1:17634541-17634563 TTCCCAGGCCTGCCAACCACAGG + Exonic
902874746 1:19334042-19334064 TCCCCAGGGCTGTCCCAGGCTGG - Intergenic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
903879175 1:26497131-26497153 TCCCCAGGGCGGCCCCCATCAGG + Intergenic
908518433 1:64917080-64917102 TTCCCAGGAATGCCCCAAACAGG - Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
912384244 1:109263430-109263452 TGCCCAGGCCTGCCTCTGACTGG - Intronic
912583058 1:110737423-110737445 TTCCCAGTGCTGGCCCAGCCAGG - Intergenic
915333912 1:155129686-155129708 ATCCCAGGGCTGCTGCCCACTGG - Intronic
920100782 1:203515775-203515797 TTCCCAGGCCTGTCCCTGGCAGG - Intergenic
920250662 1:204620203-204620225 CTTCCAGGGCTGCCCCTGATGGG - Exonic
920674459 1:208029536-208029558 TTCCCAGGGCTGGCCTGGCCTGG + Intronic
923013797 1:230110015-230110037 CTCCCAGTGCTACCCCAGACGGG - Intronic
924932732 1:248745191-248745213 TTTCCAGGGCTTCCCATGACAGG + Exonic
1067160541 10:43821491-43821513 TTCCCAGGACTCCACCCCACTGG + Intergenic
1069838542 10:71324964-71324986 TTTCCACGGCTGCCCCAGGCTGG + Intronic
1070688133 10:78504965-78504987 GTCCCAGGTCTGCACCCGACAGG + Intergenic
1073057826 10:100713570-100713592 ATCCCAGGGCTGGCAGCGACAGG + Intergenic
1075684339 10:124353420-124353442 CTCCCAGGGCAGCCCATGACAGG + Intergenic
1076299989 10:129418648-129418670 TTCCAAGAGCTTCCACCGACTGG - Intergenic
1076336099 10:129707339-129707361 GGCACAGGGCTGCCCCCGAGAGG + Intronic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1077040420 11:518750-518772 GGCCCCGGGCTGCCCACGACGGG + Intergenic
1077250089 11:1557093-1557115 GGCCCAGCGCGGCCCCCGACGGG + Exonic
1077297069 11:1831382-1831404 TGCCCAGGGCAGCCCCCGCCCGG + Intronic
1077410869 11:2403345-2403367 TTCCCAAGGCCGCCCCTGCCTGG - Exonic
1077464166 11:2725691-2725713 TTCCCCAGGCTGCCCTCGGCTGG - Intronic
1077507157 11:2935122-2935144 CTGCCAGGGCTCCCCCAGACCGG - Intergenic
1077514797 11:2995036-2995058 TTCCCAGCGCTGCCTCTGCCAGG + Intergenic
1080557498 11:33430742-33430764 CTCCCAGGGCTGCTTCTGACAGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1084121565 11:67071900-67071922 CTCCCAGGGCTGCACCTGCCAGG + Exonic
1085018806 11:73192303-73192325 TTCTGAGGGCTGCCCTTGACTGG + Intergenic
1085219004 11:74857010-74857032 GTCCCAGGGCTGCCTAAGACTGG + Intronic
1085227817 11:74938308-74938330 TTCCCAGGGCTGCCCCCATCTGG + Intronic
1089629833 11:119777678-119777700 TTCCGAGGGCTGTCCCTCACTGG - Intergenic
1091097782 11:132840348-132840370 TTCCCAGGGCAGCAGCTGACGGG + Intronic
1100390621 12:94143417-94143439 TTCCCAGGGCTTCCCCAGGATGG + Intergenic
1104897501 12:132171523-132171545 TTCCCAGGGCTGCACCTGGGAGG - Intergenic
1120659495 14:87235204-87235226 TTCTCAGGGCTGCTTCCGGCAGG + Intergenic
1120675012 14:87411552-87411574 TTCCCAGGGCAGCCCACATCTGG - Intergenic
1121731794 14:96192570-96192592 TGCCCAGAGCTGCCCCCGGGAGG - Intergenic
1122114488 14:99520865-99520887 TTCCCAAGGCTGCCTCCTCCAGG + Intronic
1122768729 14:104087596-104087618 CTGCCAGAGCTGCCCCCGAGTGG + Intronic
1123505761 15:20940777-20940799 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1123562995 15:21514483-21514505 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1123599242 15:21951766-21951788 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1123880915 15:24676817-24676839 CTCCCAGAGCTGCCCGCAACAGG + Exonic
1124372202 15:29110311-29110333 TCCCCTGGGCTGCCCCTGCCTGG + Intronic
1124375394 15:29126142-29126164 TTCCCAGTGTGGCCCCAGACAGG + Intronic
1129608069 15:77034468-77034490 ATTGCAGGGCTGCCCCCCACAGG + Intronic
1129694786 15:77734570-77734592 TTCCCTGGCCTGTCCCCCACAGG + Intronic
1130458698 15:84141431-84141453 TTCCTAGGGCTGACTCCTACAGG + Intergenic
1131063130 15:89416691-89416713 TTCCCAGGCCAGGCCCCGCCGGG - Intergenic
1202971347 15_KI270727v1_random:241618-241640 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1132806702 16:1778335-1778357 CTCTCAGGGCTGCCCCAGCCTGG - Intronic
1133239742 16:4407455-4407477 TTCCCAGGGCAGCCCCACTCTGG - Intronic
1134225576 16:12387334-12387356 TTCCCAGGGCTGCAGTCTACTGG + Intronic
1135956887 16:26963285-26963307 GTCCCAGCTCTGCCCCCTACTGG - Intergenic
1136067897 16:27771028-27771050 TTCCCAAGGCTGCCTCCTCCTGG + Intronic
1136249077 16:28991868-28991890 ATCCCAGGGCTGCTCCTCACTGG - Intergenic
1136922896 16:34346299-34346321 TTACCAGGGCTGCCCCAGGAAGG + Intergenic
1136981677 16:35065507-35065529 TTACCAGGGCTGCCCCAGGAAGG - Intergenic
1137056833 16:35750036-35750058 TTGCCAGGGCAGGCCCCCACAGG - Intergenic
1139483824 16:67245424-67245446 TTCCCAGGCTTGCCCCCAGCTGG + Intronic
1141482120 16:84313571-84313593 TTCCCTGGGCTGCCACCAGCTGG + Intronic
1141505940 16:84478751-84478773 TGCCCAGGGCTGCTCCCGAGGGG - Exonic
1142065768 16:88061614-88061636 ATCCCAGTGATGCCCCCAACTGG - Intronic
1142238655 16:88935186-88935208 AACCCAGGACTGCCCCTGACCGG - Intronic
1143582750 17:7836100-7836122 TTCCCAAGGCTTCTCCCGCCCGG + Intergenic
1143736821 17:8916798-8916820 TTCCCAAGGCAGCCCACGATGGG + Intronic
1144678598 17:17177559-17177581 TTCACACGGCTGCCCCAGACAGG + Intronic
1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG + Intronic
1145905610 17:28514597-28514619 CACCCAGGGCTCCACCCGACAGG - Intronic
1147653937 17:42077915-42077937 TGCCCAGGGCGGCTCCCCACTGG + Intergenic
1148638710 17:49168964-49168986 TTCCAAGGGCTGTACCCGGCTGG + Intronic
1150493150 17:65588083-65588105 ATCCAAGGGCTGCCACTGACTGG + Intronic
1151547008 17:74799380-74799402 GTCCCAGGGCAGCCCACGAAGGG - Intronic
1152809383 17:82374355-82374377 TTCCCTGGGCTGGCCGCCACTGG + Exonic
1157711215 18:49850934-49850956 AGCCCAGGGCTGCTCCAGACTGG + Intronic
1160131114 18:76225729-76225751 CTCCCAGTGCTGCCCCTGCCAGG + Intergenic
1161664382 19:5565948-5565970 TTCCCAGAGCTGCCCCAGGCCGG + Intergenic
1162143104 19:8596397-8596419 TTCCCAGGCCTGGCCCCGGTGGG - Exonic
1162910295 19:13844341-13844363 TCCCCAGGGCTGGGCCCCACGGG - Intergenic
1162955636 19:14096491-14096513 GTCCCAGCTCTGCCACCGACTGG - Intronic
1163115133 19:15184727-15184749 TTCCAAGGGCTGACCCACACAGG + Intronic
1163822912 19:19506323-19506345 TGCTCAGGGCTGCTGCCGACCGG - Exonic
1165822314 19:38684412-38684434 TTCCCAGTGCTGCCCCACCCTGG + Intronic
1166102084 19:40576934-40576956 TTCCCCGGGAGGCCCCCGACTGG - Exonic
1166198345 19:41220656-41220678 TTCCCTGGGTTGCCCACGAAGGG - Exonic
1166795733 19:45424361-45424383 TTCCCAGTGCTGACCCAGAATGG + Intronic
926724421 2:15986460-15986482 TTCCCAGGGCTGGCCCTGACAGG - Intergenic
927865449 2:26584785-26584807 TCCCCAGGGCTCCCCACGGCCGG - Intronic
929598819 2:43192357-43192379 TTCCCCGTGCTGCCTCCTACAGG - Intergenic
932347968 2:71007857-71007879 TACTGAGGGCTGCCCCCGTCTGG + Intergenic
932801446 2:74745816-74745838 TTCCCAGGGCATCCACGGACAGG + Intergenic
934067035 2:88350309-88350331 TTCCCAGTGCTTCACCTGACAGG - Intergenic
935354594 2:102187204-102187226 CCCCCAGGCCGGCCCCCGACCGG + Intronic
937310525 2:120900035-120900057 TTCCCAGTGTGGCCCCCGGCCGG - Intronic
942387223 2:175455289-175455311 ATCCCAGGTCTGCCTCCCACTGG - Intergenic
944743480 2:202634664-202634686 TCCCCAGGGCTCCCCCCGGCGGG + Intergenic
945063100 2:205925572-205925594 TTCCCATAGCTGCCTCCCACGGG + Intergenic
945194592 2:207226467-207226489 TTCCCAGGCCTGGCACCTACAGG - Intergenic
948578056 2:238966679-238966701 TTCCCAGGGCTCCACCCCACTGG + Intergenic
948759692 2:240182992-240183014 TTCCCAGGGCAGCCCCAGATTGG - Intergenic
1171210479 20:23312837-23312859 TTCCCAGGGCTTCACCAGATGGG + Intergenic
1173470694 20:43321176-43321198 TTGCAGGGGCTGCCCCAGACCGG + Intergenic
1174165713 20:48582195-48582217 TGCCCAGGGCTGCTCCCCACAGG + Intergenic
1175221917 20:57422150-57422172 TTCCCAGGGCAGCTCCAGGCAGG - Intergenic
1175645479 20:60667210-60667232 TTAACAGGGCGCCCCCCGACTGG - Intergenic
1175871032 20:62209601-62209623 GTCCCAGGACTGCCGCCCACTGG + Intergenic
1175950772 20:62581968-62581990 TTGCCAGAGCTGCCCCAGGCGGG + Intergenic
1175963338 20:62648054-62648076 TCCCCAGGCCTGCCCCCAGCCGG + Intronic
1176736141 21:10548494-10548516 TCCCCAGGGCTTCCCCTGGCAGG + Intronic
1177940113 21:27399699-27399721 TTCCCAGGGCTCCCCCTCGCAGG - Intergenic
1178351543 21:31875190-31875212 TTCACAGGGCAGCCCCAGGCTGG - Intronic
1178585838 21:33869804-33869826 TTCCCAGCTCTGCCACCGAGAGG - Intronic
1180069845 21:45430801-45430823 TTCCCAGGGCAGCCCCACAAAGG - Intronic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1180214280 21:46314780-46314802 CCCCCAGAGCTGCCCCCCACGGG - Exonic
1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG + Intergenic
1183453226 22:37907573-37907595 TTGCCAGGGCTCCCCCAGCCTGG + Intronic
1183512587 22:38244800-38244822 TGCCCAGGTCTGCCCTAGACAGG - Intronic
1184477648 22:44730092-44730114 CCCCCAGGGCTGCCCCTGGCGGG + Intronic
950223201 3:11212444-11212466 TTTCCAGGCCTGCCCCAGATGGG - Intronic
955053480 3:55434958-55434980 TTCCCAAAGCTGCCCCCTAGTGG - Intergenic
959935701 3:112026223-112026245 TTCCCAGGGCTGCCGCAAATTGG - Intergenic
964891393 3:161540325-161540347 AGCCCAGGGCTGCCCCTGCCTGG - Intergenic
965054834 3:163698827-163698849 TTCCCAGTGCTGACCCACACTGG - Intergenic
968093227 3:195910428-195910450 TGCCCAGGGCTGCCTCCGTTTGG - Intronic
968913345 4:3486577-3486599 CTCCCAGGGCTGCCCCCAACGGG - Intronic
969269404 4:6088930-6088952 TTCCCAGGGCAGTCCCCAATTGG + Intronic
969530213 4:7726265-7726287 TCCCCAGGCCTGCCCCCCACGGG - Intronic
984891610 4:184498868-184498890 CTCCTAGGGCTGCCCCAGCCTGG + Intergenic
985665415 5:1179508-1179530 TTCCCAGGGCTGCTCCTGCAGGG + Intergenic
985965980 5:3339005-3339027 TTCTCAGGGCTGCCTCCCGCCGG - Intergenic
986028385 5:3872176-3872198 TTCCCAGGGCTTCCCACCAGAGG - Intergenic
989400620 5:41004224-41004246 TTCCTTGGCCTGCCCCAGACAGG - Intronic
992400241 5:76404292-76404314 TTCCGAGGGCAGCCCCTGGCTGG - Intronic
992863555 5:80936223-80936245 TTCCCAGGACTGCCTCCTAGAGG - Intergenic
993042038 5:82825154-82825176 TTCTCAAGGCTTCCCCAGACAGG - Intergenic
995794033 5:115923475-115923497 TTCCCAGTGCTTCCCCTGAAGGG + Intergenic
1002094725 5:176824105-176824127 TTGCCAGGGCTTCTCCCGCCTGG + Intronic
1002184834 5:177449500-177449522 TTACCCAGGCTGCCCCCCACAGG + Intronic
1002841922 6:913758-913780 ATCCCGGGGCTCCCCCCAACAGG - Intergenic
1003328341 6:5109593-5109615 ATCCCAGGGCTGCTCCCTTCCGG + Intronic
1008063947 6:47027621-47027643 ATCCCAGCGGTGCCCCTGACTGG - Intronic
1012956209 6:105572846-105572868 TTCCAAGAGCTTCCCCAGACTGG - Intergenic
1013823036 6:114178514-114178536 TTCCCAGAGCTGCCCTAGACAGG + Intronic
1019388498 7:772195-772217 TTCTCAGGGCTGCCTCCCACAGG + Intronic
1019395936 7:817478-817500 TCCCCAGGGCTCCCCAGGACAGG + Intronic
1019485000 7:1285296-1285318 TTCCCAGAGCTGCCGCCGCCAGG - Intergenic
1019701804 7:2477789-2477811 TGCCCAGGGCTGCCCCCTGCAGG - Intergenic
1019746320 7:2702160-2702182 CTCCCAGGGCAGCCCCTGAAGGG - Intronic
1020282238 7:6655528-6655550 TTCCCTGGGCTGCCCCTCTCCGG + Exonic
1021637922 7:22709571-22709593 CTCCCAGGCCTGCCCCCACCCGG + Intergenic
1021846480 7:24768062-24768084 GTCCCAAGGCTGCCCCCAGCTGG + Intergenic
1021898171 7:25257112-25257134 TTCCCAGAGCTGGCCCTGCCTGG - Intergenic
1022813898 7:33895469-33895491 GTCCCAGTGCTGCCACCTACAGG + Intergenic
1024049395 7:45609297-45609319 CTCCCAGGGCTGTGCCCGGCAGG + Intronic
1024220792 7:47284893-47284915 TTCCCAGGGCTGCCTACCCCAGG - Intronic
1025615471 7:63113450-63113472 TCCCCAGGCCTGCCCCCGGCTGG - Intergenic
1025739302 7:64183052-64183074 TCCCCAGGCCTGTCCCCGGCTGG + Intronic
1026000667 7:66557523-66557545 TTCCCAGGTCCGCCCCCAGCTGG + Intergenic
1029339156 7:99929161-99929183 ACCCCAGGGCTGCCCCCTCCAGG + Exonic
1035224444 7:157425630-157425652 TTCCCAGGGCTGCTCCTGTCTGG + Intergenic
1040294489 8:46142175-46142197 CCCCCAGGGCTGCCCCAGATGGG - Intergenic
1040307341 8:46218981-46219003 CCCCCAGGGCTGTCCCAGACTGG - Intergenic
1040314608 8:46254387-46254409 TTCCCAGGGCTGTCCTGGACGGG + Intergenic
1040325833 8:46341067-46341089 CACCCAGGGCTGTCCCCGGCAGG + Intergenic
1040329398 8:46378254-46378276 CTCCCAGGGCTGTCCCAGGCGGG + Intergenic
1040334779 8:46410512-46410534 CTTCCAGGGCTGCCCCAGGCAGG + Intergenic
1040337474 8:46423376-46423398 TTCCCAGGGCTGTCCCGGGCAGG + Intergenic
1040340617 8:46438687-46438709 ATCCCAGGGCTGTCCCGGGCAGG - Intergenic
1040879749 8:52192050-52192072 TTCCCAGGGCTGGCACAGAGGGG + Intronic
1048940034 8:139392584-139392606 TACCCAGGTCAGCCCCCAACAGG + Intergenic
1049235543 8:141510590-141510612 CTCCCAGCGCTCCCCCCGCCAGG - Intergenic
1049604523 8:143523091-143523113 TGCCCAGAGGTGCCCCAGACTGG + Intronic
1049636874 8:143693812-143693834 TTCCCAGAGCTGCTCCAGAAAGG + Exonic
1049750008 8:144278572-144278594 CTCCCAGGGCTGCCCACAAGAGG + Intronic
1050676000 9:8053681-8053703 TGCCCTGGACTGCCCCTGACCGG - Intergenic
1056205564 9:84316386-84316408 TTCCCCGAGCTGCCCCCAACAGG - Intronic
1057090646 9:92255080-92255102 CTCCCAGTGCTGCCCTCGCCAGG + Intronic
1057199983 9:93134629-93134651 TTCCCAGGGCGAACCCCGCCTGG - Intergenic
1061489553 9:130937719-130937741 GCCCCAGGGCTGCCCCAGGCTGG - Intronic
1062200810 9:135301744-135301766 TTCTCAGGGCCGCTCACGACAGG + Intergenic
1062374861 9:136257516-136257538 GTCCGAGGCCTGCCCCCCACCGG - Intergenic
1062434510 9:136540882-136540904 CTCCCAGGGCTGCCTGCGTCTGG - Intronic
1062546125 9:137064481-137064503 TCCCCAGGCCTGCCCCCGGCTGG - Exonic
1062599957 9:137315243-137315265 TTCCCTGGGCACCCCCCGACCGG + Intronic
1196430118 X:115615601-115615623 CTCCCAGTGCTGCACCAGACAGG - Intronic