ID: 1180183995

View in Genome Browser
Species Human (GRCh38)
Location 21:46130527-46130549
Sequence GATGAAGGATCCTCCACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180183987_1180183995 1 Left 1180183987 21:46130503-46130525 CCAGGCTGGTCTTCCCACTGTGG 0: 1
1: 0
2: 2
3: 29
4: 311
Right 1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
1180183980_1180183995 25 Left 1180183980 21:46130479-46130501 CCCACACCCACTGCACAGGGCAG 0: 1
1: 0
2: 4
3: 32
4: 364
Right 1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
1180183979_1180183995 26 Left 1180183979 21:46130478-46130500 CCCCACACCCACTGCACAGGGCA 0: 1
1: 0
2: 6
3: 35
4: 414
Right 1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
1180183981_1180183995 24 Left 1180183981 21:46130480-46130502 CCACACCCACTGCACAGGGCAGG 0: 1
1: 0
2: 8
3: 54
4: 460
Right 1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
1180183983_1180183995 19 Left 1180183983 21:46130485-46130507 CCCACTGCACAGGGCAGGCCAGG 0: 1
1: 0
2: 7
3: 36
4: 390
Right 1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 123
1180183985_1180183995 18 Left 1180183985 21:46130486-46130508 CCACTGCACAGGGCAGGCCAGGC 0: 1
1: 0
2: 5
3: 56
4: 473
Right 1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180183995 Original CRISPR GATGAAGGATCCTCCACAGG AGG Intronic
900630517 1:3632731-3632753 GATGATGGTTCTTCCACAGCCGG - Intronic
906782510 1:48585272-48585294 GATGAGGGTCCCTCCAGAGGAGG - Intronic
912272652 1:108226846-108226868 GATGAAGAACCCTCCCCAGCTGG - Exonic
912295568 1:108467476-108467498 GATGAAGAACCCTCCCCAGCTGG + Exonic
913813404 1:122929140-122929162 GTTGAAGGATCCTTTACAGAGGG + Intergenic
916023479 1:160814419-160814441 GATCCAGGAGCCTCCAGAGGAGG + Exonic
920161977 1:204005570-204005592 GAAGCAGGCTCCTTCACAGGAGG - Intergenic
922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG + Intronic
1066100233 10:32111028-32111050 GATGCCTCATCCTCCACAGGCGG - Intergenic
1067944254 10:50680337-50680359 GATGGTGGAGCCTGCACAGGGGG + Intergenic
1071160735 10:82742645-82742667 GATGCCGGCTCCTCCACAGAAGG - Intronic
1072057388 10:91773704-91773726 GATGAAGGAATCTCCAGAGAGGG + Intergenic
1075545676 10:123352553-123352575 GATGATAGAACCTCCACACGAGG + Intergenic
1076915207 10:133419981-133420003 GAGGAAGGAGCCTTCACAGCAGG - Intronic
1079108024 11:17586400-17586422 GAGGCAGGGTCCTCCACAGATGG + Intronic
1084448001 11:69215209-69215231 GATGAGAGTTCCTCCACAGGGGG + Intergenic
1089005557 11:115087849-115087871 AAAGAAGGGTCCTCCAGAGGTGG + Intergenic
1089009447 11:115120711-115120733 GAATAAGCATCATCCACAGGTGG - Intergenic
1096517457 12:52165036-52165058 GATGAAGGAAACTCCAGAGAGGG + Intergenic
1099362420 12:81721200-81721222 CATGAAAGATTCTCCACAGTTGG - Intronic
1100396453 12:94190039-94190061 GAAGAAGGATCTTCCAGAAGAGG + Intronic
1103877872 12:124142666-124142688 GATGAGGGAACTTGCACAGGGGG + Intronic
1104377291 12:128275890-128275912 AAGGAAGGATCCTCCCCTGGGGG - Intronic
1106543070 13:30707232-30707254 GAGAAAAGATCCTCCACAAGAGG + Intergenic
1109397722 13:61782462-61782484 CCTGTAGCATCCTCCACAGGGGG + Intergenic
1110307691 13:74009037-74009059 GCTGAAGGATTCTCCAAAGCTGG + Intronic
1115502841 14:34064633-34064655 AAGGAAGGATCCTCCCCTGGAGG + Intronic
1118109758 14:62704556-62704578 GATGCTGTATCCTCGACAGGTGG - Exonic
1121004159 14:90477544-90477566 GAAGAAGCATCCTCAACATGAGG - Intergenic
1122501378 14:102202260-102202282 GAGGAAGGAGCTGCCACAGGAGG - Intronic
1122600309 14:102918045-102918067 GAGGAAGGAGCCGCCACTGGGGG - Intergenic
1127267108 15:57371320-57371342 GATGAAGGAACCTTGACAGCAGG + Intergenic
1129691060 15:77713867-77713889 GGAGAAGGAACCTTCACAGGAGG - Intronic
1131921731 15:97335327-97335349 GGTGAAGAATAATCCACAGGTGG - Intergenic
1132715634 16:1288714-1288736 GATGAGGGAGCCCCCACAGATGG + Intergenic
1133002142 16:2857037-2857059 GCTGAGGGACCCTCCTCAGGGGG - Intronic
1145100765 17:20074860-20074882 GAGGAATGATACTTCACAGGTGG - Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148129683 17:45255368-45255390 GATGAAAGCTCCACCCCAGGAGG - Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150684416 17:67309118-67309140 AAGGAAGGATCCTCCCCTGGAGG + Intergenic
1155429038 18:25736445-25736467 AATGAATGACCCTCCACGGGTGG + Intergenic
1160290776 18:77591052-77591074 GATGAAGGAAACTGCACAGAGGG + Intergenic
1162840818 19:13355281-13355303 AAAGAAGGATCCTCCCCCGGAGG + Intronic
1164156117 19:22598374-22598396 GAGGAAGGAGAATCCACAGGAGG - Intergenic
1165777379 19:38412801-38412823 GCTGAAGGATCCTCTCCTGGGGG + Exonic
1166345073 19:42160460-42160482 GAGGAGGGTTCCTCCACTGGAGG - Intronic
1167208886 19:48121047-48121069 GAGAACGGATCCTTCACAGGGGG + Intronic
929690741 2:44070660-44070682 GATGAAGAAAGCTCCACAGCTGG - Intergenic
932480613 2:72036890-72036912 GAGGAAGGATGCTCCTTAGGAGG + Intergenic
933333643 2:80926428-80926450 GATGAGGGAACCTGCACAGGGGG - Intergenic
935304700 2:101726005-101726027 AATAAAGGATCCCCGACAGGGGG - Intronic
935727714 2:106038143-106038165 GATGCAGGATGCTCCACTGCTGG + Intergenic
942619672 2:177833889-177833911 GATAAGGGAACCTGCACAGGGGG + Intronic
948668426 2:239551000-239551022 GATGACGCAGCCTCCCCAGGTGG - Intergenic
1169117313 20:3073925-3073947 GATTAAGGACACTCCTCAGGAGG + Intergenic
1172538786 20:35695192-35695214 GGTGAAGGTTCCTCCAAAGGTGG - Intronic
1175817403 20:61890505-61890527 GATGATGGATGCTGGACAGGTGG + Intronic
1179305754 21:40152723-40152745 GATGATGCATCTGCCACAGGCGG - Intronic
1180183995 21:46130527-46130549 GATGAAGGATCCTCCACAGGAGG + Intronic
1180631652 22:17234160-17234182 GAGGAAGGAGACTCCAGAGGAGG + Intergenic
1182096752 22:27630833-27630855 GATGAAGGATGCTCCAGTTGGGG - Intergenic
1183465724 22:37979558-37979580 GATATAGGATCCCCCACAGGAGG - Intronic
1185039139 22:48495539-48495561 GATGGAGGAGCCTCCCCAGATGG - Intronic
950456064 3:13093434-13093456 TAGGAAGCTTCCTCCACAGGAGG + Intergenic
950463983 3:13142449-13142471 GATGTTGGATCCCGCACAGGTGG + Intergenic
950691952 3:14666166-14666188 GATGAGAGACCATCCACAGGAGG + Intronic
952624989 3:35392960-35392982 GCTAAAGGAACCTGCACAGGGGG + Intergenic
962944398 3:140154163-140154185 GATGGAGGATCCTTCAGATGGGG + Intronic
965064510 3:163829330-163829352 CATGAAGGTTCCTCCACCAGTGG + Intergenic
970284598 4:14495992-14496014 GAAGAATGAACCTGCACAGGAGG + Intergenic
971255071 4:25007090-25007112 GTTGAAGAATCATCCACATGAGG - Intronic
971673969 4:29600188-29600210 GATCAAGGATCCTCATCTGGTGG - Intergenic
975106800 4:70576815-70576837 GATGAAGGATCTTCCACCTTAGG + Intergenic
975162006 4:71134943-71134965 GATGAAGCTTCCTCCTGAGGGGG + Intergenic
978629798 4:110731470-110731492 TATGTAGAATCCTCCACAGTCGG + Intergenic
981328127 4:143476001-143476023 GCTGAAGGATCTGCCTCAGGTGG + Intergenic
982449196 4:155531919-155531941 AAGGAAGGATCCTTCACTGGAGG + Intergenic
985877702 5:2612996-2613018 GTTGAAGGCTCTTCCCCAGGTGG + Intergenic
986266348 5:6194706-6194728 CATGAAGGATCCAACACAGGAGG + Intergenic
986279932 5:6314536-6314558 GAGGAAGGATCCTCCTCTGGAGG + Intergenic
989062782 5:37426124-37426146 GAAGGAAGATCCTGCACAGGTGG + Intronic
993307901 5:86293145-86293167 GATGAAGAACCCTCCCCAGCTGG + Intergenic
995122492 5:108551232-108551254 GATGAAGGTGGCTTCACAGGTGG - Intergenic
997947287 5:138213795-138213817 GAGGAAAAATCCTCCACATGGGG - Intergenic
998031438 5:138873073-138873095 GATGAAGGGTCCTTCATGGGTGG + Exonic
998032241 5:138880553-138880575 GATGAAGCATGCTACACAGAGGG - Intronic
1003533118 6:6954231-6954253 GATGAGGGATACTCAAAAGGAGG - Intergenic
1004900462 6:20188845-20188867 GATAAAGGAACTTGCACAGGGGG - Intronic
1013911871 6:115285177-115285199 GGTGAAAGATCATCCACATGTGG - Intergenic
1014760419 6:125350587-125350609 CATCCAGGATACTCCACAGGAGG - Intergenic
1018840164 6:167510732-167510754 GCAGAGGCATCCTCCACAGGAGG + Intergenic
1018853301 6:167657142-167657164 GAAGAACGAGGCTCCACAGGTGG - Intergenic
1019156689 6:170044002-170044024 TGTGAAGGACCCTCCACACGGGG + Intergenic
1021389694 7:20076770-20076792 GAAAAAGGGTTCTCCACAGGGGG - Intergenic
1022078454 7:26996874-26996896 CAGGAAGCATCCTGCACAGGAGG - Intergenic
1026015076 7:66666181-66666203 GATGAAGGAGCCTCCTCTGCAGG + Intronic
1030007379 7:105132602-105132624 GTGGAAGGATCCTCCTCAGGCGG - Intronic
1032123380 7:129172997-129173019 AAGGAAGGATCCTCCCCTGGAGG - Intergenic
1039031193 8:33311512-33311534 GAGGAAGGATTCTCTACAGTGGG - Intergenic
1042956731 8:74259229-74259251 GATGAAGGATCCTCAACCGCAGG + Intronic
1044423165 8:92022133-92022155 TATTAAGAATCCTCCTCAGGAGG - Intronic
1048139765 8:131782869-131782891 GTTGAGGGATCCTGCACAGATGG - Intergenic
1048387335 8:133924439-133924461 GATCAAGAATCATCCACAGTGGG + Intergenic
1049181567 8:141225764-141225786 GGAGAAGCAGCCTCCACAGGAGG - Intronic
1052725224 9:32221143-32221165 GAAGAAGAATCCTACAGAGGGGG + Intergenic
1053459820 9:38259563-38259585 GATGGTGGCCCCTCCACAGGTGG + Intergenic
1053475935 9:38382105-38382127 CACGAAGGGTCCTTCACAGGAGG - Intergenic
1057317055 9:93976244-93976266 GATGTAGGATCAGACACAGGAGG - Intergenic
1059403492 9:114085504-114085526 GGTGAAGGATCCACCACCGGCGG + Intergenic
1059889449 9:118785215-118785237 GAAGAAGGAGCCCCCACATGGGG - Intergenic
1062054312 9:134463063-134463085 GATGTAGAATCTTCCAGAGGTGG - Intergenic
1062477231 9:136734488-136734510 GATGTCAGGTCCTCCACAGGAGG + Intergenic
1185619676 X:1445961-1445983 GATGTCAGGTCCTCCACAGGAGG - Intronic
1185888211 X:3801858-3801880 CAGGAAGGATCCTCCACCTGAGG + Intergenic
1189349081 X:40263639-40263661 GATGAAGGATTCTCCAAACGTGG + Intergenic
1189831233 X:44975819-44975841 GATAAGGGAACCTGCACAGGGGG + Intronic
1190982283 X:55466877-55466899 AAGGAAGGATCCTCCCCTGGAGG + Intergenic
1190986416 X:55506306-55506328 AAGGAAGGATCCTCCCCTGGAGG - Intergenic
1194476049 X:94361070-94361092 GATAAAGGAATCTGCACAGGAGG - Intergenic
1196989853 X:121316274-121316296 TTTGAAGGGTACTCCACAGGGGG - Intergenic
1198043639 X:132878371-132878393 GATAAGGGAACCTGCACAGGGGG - Intronic