ID: 1180184355

View in Genome Browser
Species Human (GRCh38)
Location 21:46132074-46132096
Sequence GGCGGCTGACGCTGGCCCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180184348_1180184355 4 Left 1180184348 21:46132047-46132069 CCCGGCGCTTCGTGGAGCAGGTG 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1180184355 21:46132074-46132096 GGCGGCTGACGCTGGCCCGGAGG 0: 1
1: 0
2: 2
3: 14
4: 209
1180184349_1180184355 3 Left 1180184349 21:46132048-46132070 CCGGCGCTTCGTGGAGCAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1180184355 21:46132074-46132096 GGCGGCTGACGCTGGCCCGGAGG 0: 1
1: 0
2: 2
3: 14
4: 209
1180184345_1180184355 12 Left 1180184345 21:46132039-46132061 CCACAAGGCCCGGCGCTTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1180184355 21:46132074-46132096 GGCGGCTGACGCTGGCCCGGAGG 0: 1
1: 0
2: 2
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180184355 Original CRISPR GGCGGCTGACGCTGGCCCGG AGG Exonic
900511135 1:3061747-3061769 GGCGGCAGAGCCTGGCCCTGTGG - Intergenic
900703778 1:4063396-4063418 GGCGGCAGCAGCTGGCCCAGTGG - Intergenic
902628718 1:17692095-17692117 GGGGCCTGACCCTGGACCGGAGG + Intronic
903221707 1:21873029-21873051 GGCTGCTGACGCTGCCTTGGGGG + Exonic
903373863 1:22853752-22853774 GGGAGCTGAAGCTGGCCAGGTGG + Intronic
903923408 1:26817396-26817418 GGCGGCGCTCGCTGGCGCGGCGG - Intergenic
905990787 1:42335294-42335316 CGCCGCTGACGCCGGGCCGGCGG - Intronic
906317787 1:44799620-44799642 GGCTGCTGACCCAGGCCCGGGGG + Intergenic
907181386 1:52573298-52573320 GGCGGCTGACCCTGCTCCTGAGG + Intergenic
907296549 1:53459683-53459705 GGCGGCGGCCGCAGCCCCGGAGG - Exonic
907453932 1:54563116-54563138 GGCGGCGCTCGCTGGCGCGGCGG + Intronic
907947211 1:59146921-59146943 GCCGGCGGTCCCTGGCCCGGCGG - Intergenic
908780682 1:67686515-67686537 GGAGACCGACGCTGGCCCCGCGG + Exonic
915937817 1:160099051-160099073 GGAGGCTGACGTTAGCCCTGCGG - Intergenic
917441675 1:175074084-175074106 GGTGCCTGATTCTGGCCCGGAGG - Intronic
918001645 1:180502605-180502627 CGCGGCTGGCGCTGGGCCGTGGG + Exonic
919451158 1:197775015-197775037 GGCGGCCGAGGTTGGCCGGGCGG - Intronic
919817123 1:201448591-201448613 AGCGGCTGACCCTGGCATGGGGG + Intergenic
924527325 1:244863944-244863966 GGCGGCCGACTCGGGCCCGATGG - Exonic
924586757 1:245367223-245367245 GGAGGCTGACCTTGGCCTGGTGG - Exonic
1063123348 10:3120075-3120097 GCCGGCTGACGCTAACCCCGGGG + Intronic
1065214938 10:23439711-23439733 GGCGGCGGAGGCGGGCGCGGCGG - Exonic
1066464403 10:35640340-35640362 GGCGGCGGGCGCGGGCGCGGCGG - Exonic
1067221718 10:44348659-44348681 GGTGGGTGAGGCTGGCCCAGGGG + Intergenic
1067440269 10:46305190-46305212 GGCGGCTGATGCCAGCCTGGAGG + Intronic
1069962651 10:72087746-72087768 AGCGGCTGGGGCAGGCCCGGGGG + Intronic
1072710662 10:97713883-97713905 GGCGGCTGGCGCGGGGGCGGCGG - Exonic
1073180509 10:101580272-101580294 GGCGGCTGAAGATACCCCGGTGG + Exonic
1073249803 10:102114595-102114617 CGCGGCGGCCGCTGTCCCGGGGG + Intronic
1075768761 10:124916606-124916628 GCCGGCTGACGGCGGCCTGGAGG - Intergenic
1075802050 10:125160095-125160117 GGGGGTGGACGCTGGCTCGGGGG - Intronic
1076362021 10:129896420-129896442 GGTGGCTGACGGTGGCCGCGTGG - Intronic
1076949161 10:133668903-133668925 GGCGGGCGACGGTGGCGCGGGGG - Intronic
1076950145 10:133672202-133672224 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076953108 10:133682121-133682143 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076954092 10:133685420-133685442 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076955076 10:133741772-133741794 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076957055 10:133748392-133748414 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076959027 10:133755000-133755022 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076960016 10:133758310-133758332 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1076961000 10:133761609-133761631 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
1077367707 11:2167805-2167827 GCAGGCTGACGCTGGACCTGGGG - Intronic
1080620918 11:33986386-33986408 GGCGGCTGGCCCGGGCCGGGGGG - Intergenic
1081177313 11:39945238-39945260 GGCTGCTGAAGTTGGCCCAGTGG + Intergenic
1083329274 11:61890073-61890095 GGCGCCAGACGCTGGCCCGAGGG - Intronic
1087761883 11:102110885-102110907 GGCGGCTGCCCTTGGCCCTGGGG - Exonic
1090344905 11:126062401-126062423 GGATGCTGATGCTTGCCCGGCGG - Intronic
1091571512 12:1691032-1691054 GGCGGCGGTCGCTGTCGCGGCGG + Exonic
1094807667 12:34108007-34108029 GGCGGCTGTCGCAGGCCATGGGG - Intergenic
1097284184 12:57865207-57865229 GGCGGCAGACGCAGGCCCGAGGG - Intergenic
1102475407 12:113185427-113185449 GGCGGCCGACAAGGGCCCGGCGG - Exonic
1103972625 12:124681691-124681713 GGCGGATGCTGCTGGCCTGGGGG - Intergenic
1106119865 13:26851248-26851270 GGCGTCTGAGGCTCACCCGGAGG - Intergenic
1108648815 13:52455668-52455690 GGTGGCGGGCGCGGGCCCGGCGG + Intronic
1112364355 13:98743916-98743938 GGGAGCTGATGCTGTCCCGGAGG - Intronic
1117545871 14:56794643-56794665 GGTGGTTAGCGCTGGCCCGGTGG - Intergenic
1119539254 14:75428079-75428101 GGCGGCGGACGCTGCAGCGGCGG + Intronic
1121353357 14:93192491-93192513 GGCGGCTCACACTGGCATGGCGG + Intronic
1122388555 14:101365072-101365094 GGGGGCTGCTGCTGGCCGGGTGG + Intergenic
1123047637 14:105526597-105526619 GGCGGCAGAGGCTGGGCGGGCGG + Exonic
1125531244 15:40414952-40414974 AGCGGCTGGTGCTGGCCGGGGGG + Exonic
1125626896 15:41116178-41116200 GGCTGCGGGCGCTGGGCCGGCGG + Exonic
1125903626 15:43370937-43370959 AGTGGGTGAGGCTGGCCCGGAGG - Intronic
1127306074 15:57706815-57706837 GCGGGCTGAGGCTGGCGCGGCGG - Exonic
1128343999 15:66842469-66842491 GGTGGATGACACAGGCCCGGCGG + Intergenic
1128635363 15:69299121-69299143 GGCGGCTGGGGCTGCCGCGGAGG - Intronic
1129082519 15:73052809-73052831 AGCGGCGGGCGCGGGCCCGGGGG + Intronic
1129385794 15:75195663-75195685 GGCGGCTGGGTCTGGCCAGGTGG - Intronic
1129767059 15:78176817-78176839 AGAGGCTGAGGCTGGACCGGAGG + Intronic
1132464820 16:72559-72581 GGCTGCCGCCGCTGGCCGGGAGG + Exonic
1132519797 16:381880-381902 GGCGGCAGAGGCTGCCCGGGCGG - Exonic
1132750989 16:1457631-1457653 GGCGGCCCTCGCGGGCCCGGCGG + Intronic
1132895919 16:2229347-2229369 CGGCGCTGACCCTGGCCCGGGGG + Intronic
1137013182 16:35344530-35344552 TGCGGATGCCGCTGGCCGGGTGG - Intergenic
1137061986 16:35799157-35799179 GGCGGCTGTTGCTGGCTGGGTGG - Intergenic
1137475939 16:48810589-48810611 GAGGGCTGACGCTGGGCTGGGGG + Intergenic
1139866436 16:70065783-70065805 GGCGGCCGGTGGTGGCCCGGCGG + Intergenic
1142302885 16:89268898-89268920 TGGGGCTCACCCTGGCCCGGGGG + Intronic
1142476322 17:192036-192058 GGCGACTGTCGCGGGGCCGGGGG - Intergenic
1142476352 17:192115-192137 GGCGACTGTCGCGGGGCCGGGGG - Intergenic
1142476392 17:192223-192245 GGCGACTGTCGCGGGGCCGGGGG - Intergenic
1142476402 17:192250-192272 GGCGACTGTCGCAGGGCCGGGGG - Intergenic
1142476449 17:192381-192403 GGCGACTGTCGCGGGGCCGGGGG - Intergenic
1143640704 17:8195431-8195453 GGAGGCTGAGGCGGGCCAGGTGG - Intergenic
1146079127 17:29761357-29761379 GGCGGCGGAGGCGGGCCCGCCGG + Intronic
1147971177 17:44219747-44219769 GGCGGCTGAGGCTGCGGCGGCGG - Intronic
1151478706 17:74357586-74357608 GGCGGGAGGCGCGGGCCCGGCGG - Exonic
1152091905 17:78251906-78251928 GGTCCCTGACGCTGGCCCAGAGG + Intergenic
1152611406 17:81316572-81316594 GGCCGCTGACCCTGGCCAGGTGG + Intronic
1153290677 18:3499010-3499032 GGGGGCTGAGGGGGGCCCGGGGG + Exonic
1154501160 18:14998678-14998700 GGCGGCTGTCGGTGGCCAGCCGG + Intergenic
1160100502 18:75916249-75916271 GGCGCTGGACGCGGGCCCGGCGG - Intergenic
1160525197 18:79531715-79531737 CGCGGCTGACAATGGCCAGGAGG - Intergenic
1160811393 19:1014503-1014525 GTCGGCTGCAGCTGGCCCTGGGG - Intronic
1160935481 19:1592653-1592675 GGCGGCGGCGGCGGGCCCGGCGG - Exonic
1161450716 19:4343881-4343903 GGGGGCTGCGGCGGGCCCGGGGG + Exonic
1161959551 19:7516202-7516224 GGCGGCCGGCGCGGGCGCGGCGG + Exonic
1162013168 19:7830248-7830270 GGCGGCGGCCGCGGTCCCGGGGG + Intronic
1162733732 19:12734354-12734376 GGCCGCCGCCGCTGGCCCCGGGG - Exonic
1162767747 19:12930291-12930313 GGCGGCTCCAGCTGGTCCGGGGG - Exonic
1163322412 19:16582495-16582517 GGCTTCTGACCCTGGCCCTGGGG + Intronic
1163426889 19:17245183-17245205 GGCGGCTGGGGCGGCCCCGGCGG - Exonic
1163991496 19:21002903-21002925 GGCAGCTGAGGCTTGCCCTGTGG + Intergenic
1164763054 19:30742696-30742718 GCTGGCTGAGGCTGGCCCTGTGG + Intergenic
1164877286 19:31700484-31700506 GGCTGCTTACGCTGGACTGGAGG + Intergenic
1165437959 19:35806928-35806950 GGCGGCTGAGGGAGGCCCGGAGG + Intronic
1165437978 19:35806993-35807015 GGCGGCAGAGGGAGGCCCGGAGG + Intronic
1165437997 19:35807058-35807080 GGCGGCTGAGGGAGGCCCGGAGG + Exonic
1167288659 19:48612951-48612973 GGCGGCTGACCCTCTCCAGGAGG + Exonic
927652551 2:24920786-24920808 GGCGGGTGGCGGTGGCCCGGTGG + Intergenic
929604290 2:43224992-43225014 GGGGGCTGATGGTGGCCCGACGG + Exonic
929775676 2:44929381-44929403 GGCCGCTGACGCAGCCCCGAGGG + Intergenic
929777424 2:44937916-44937938 GGAGGCGGAGGCTGGCCGGGTGG - Intergenic
930688744 2:54337109-54337131 GGAGGCTGACACTGGCACAGTGG - Intronic
934992556 2:98931788-98931810 GGTGGCTGACGCTGCTCAGGAGG + Intronic
938451525 2:131425228-131425250 GGAGGCGGGCGCTGGCTCGGGGG + Intergenic
941666169 2:168246556-168246578 GGCGGCGCACCCTGGCACGGAGG + Intronic
941891453 2:170585952-170585974 GGAGGCTGAGGCAGGCCAGGGGG + Intronic
944221685 2:197310294-197310316 TGCGGCGGCCGCGGGCCCGGCGG - Intronic
946322100 2:218960197-218960219 GGCGGCAGCCGCGGGCACGGTGG - Exonic
948645304 2:239400646-239400668 GGCGGCGGACAATGGCCCGCGGG + Exonic
948824980 2:240569664-240569686 GGTGGCTGAGGCTGGCGCTGTGG + Intronic
949026842 2:241770333-241770355 GGTGGCTGCTGCTGGCCCAGGGG + Intergenic
1168904597 20:1393002-1393024 GGCGGCGGACGCTGAGCGGGCGG + Exonic
1169073738 20:2749526-2749548 GGCGGCCGGGGCTGGGCCGGGGG - Intronic
1171439123 20:25147162-25147184 AGCGGCTGAGTCTGCCCCGGTGG - Intergenic
1175911467 20:62407208-62407230 GGCGGGTGGCGGGGGCCCGGCGG + Exonic
1176056520 20:63151812-63151834 GGCGGCTGCAGCTGTTCCGGTGG - Intergenic
1177136687 21:17311719-17311741 GGAGGCTGAGGCAGGCCAGGAGG + Intergenic
1180150177 21:45943325-45943347 GGTGGCTGAGGCAGGCCAGGTGG - Intergenic
1180184355 21:46132074-46132096 GGCGGCTGACGCTGGCCCGGAGG + Exonic
1180971995 22:19820612-19820634 GGCTGCAGACGCTGCCCCAGGGG - Exonic
1180979543 22:19872182-19872204 GGCCACTGATGCTGGCCCGCTGG + Intergenic
1181527756 22:23499934-23499956 GGCTGCTGATGCTGTCCCTGTGG + Intergenic
1181551303 22:23640373-23640395 GGCGCCAGATGCTGGCCCTGGGG - Intergenic
1181745327 22:24952274-24952296 GGCTGCTGGTGCCGGCCCGGGGG - Intergenic
1182549567 22:31093531-31093553 GGTGGCTGAAGCAGGCCGGGTGG + Intronic
1184089132 22:42283366-42283388 GGCGGCTGGATCTGGACCGGAGG + Intronic
1184391828 22:44207367-44207389 GGCGGGTGAGGCTGGCGGGGAGG + Exonic
1184738459 22:46412687-46412709 GGCGTCTGAGGCTGGCTGGGTGG - Intronic
1184768807 22:46586387-46586409 GCCGGGTGATGCTGGCTCGGAGG + Intronic
950681545 3:14588597-14588619 GGCAGCTGGCTCTGGGCCGGCGG - Intergenic
951264832 3:20552927-20552949 GGCGGCTGAAGCTGCACCAGGGG + Intergenic
963870550 3:150409778-150409800 GGCTGCAGTCACTGGCCCGGCGG - Exonic
964474748 3:157088691-157088713 GGCAGCGGACTCTGGCCGGGAGG - Intergenic
966390821 3:179451175-179451197 GGCGGCCGACGCTGCCCGGGAGG - Intronic
966911507 3:184562524-184562546 GGAGGCTGGAGCTGGCTCGGAGG + Intronic
968437430 4:601297-601319 GGAGGCTGACGCAGGACTGGGGG - Intergenic
969344882 4:6564105-6564127 GGCGGCTGCCGCTGGACCGGTGG - Intergenic
969413377 4:7043537-7043559 GGCGGCTGCGGCGGGCCGGGCGG + Exonic
969610883 4:8227316-8227338 GGCGCCTGGCACAGGCCCGGGGG + Exonic
974904528 4:68038516-68038538 GCGGGCTGAGGCTGGCGCGGCGG - Intergenic
975166948 4:71187460-71187482 GGAGGCGGGCGCGGGCCCGGGGG + Intronic
977043942 4:92045978-92046000 GGCGGCTGAGGCCTGCCCTGTGG - Intergenic
980595859 4:134953045-134953067 GGCGGATGACGCCGGTGCGGGGG - Intergenic
982712191 4:158768901-158768923 GGCGGCGGCCATTGGCCCGGCGG - Intergenic
985451631 4:190066403-190066425 GGCGGGCGACGGTGGCCCGGGGG - Intergenic
985452616 4:190069693-190069715 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985453603 4:190072990-190073012 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985454593 4:190076283-190076305 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985455581 4:190079576-190079598 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985456565 4:190082870-190082892 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985457553 4:190086170-190086192 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985458540 4:190089463-190089485 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985459529 4:190092763-190092785 GGCGGGCGACGGTGGCGCGGGGG - Intergenic
985463780 4:190175532-190175554 GGCGGGCGACGGTGGCGCGGGGG - Intronic
985516202 5:346015-346037 CCAGGCTGACGCTGGCCCAGCGG + Intronic
985649406 5:1100364-1100386 GGCGGCTGCGGGTGGCCCAGGGG - Intronic
985749672 5:1667147-1667169 GGCGGCAGGCGGTGGCCCCGGGG + Intergenic
990909932 5:60843499-60843521 GGTGGCTGCTGCTGGCCGGGAGG - Intronic
993945304 5:94111405-94111427 GGCGGTGGTCGCTGGCCCTGGGG - Intronic
994253016 5:97559089-97559111 GGAGGCTGAGACTGGCCAGGTGG + Intergenic
996862828 5:128084269-128084291 GGCGGCTGGTGCTGGGGCGGGGG + Exonic
997485284 5:134225974-134225996 TGAGGCTGGCGCTGGCCCGCTGG + Exonic
999401220 5:151265702-151265724 GGAGGCTGAAGCTGACCAGGAGG - Intronic
1000014737 5:157266636-157266658 GGCGGCTCTCGCTGGCCCTGGGG - Intronic
1002343991 5:178535577-178535599 GGCTTCTGACCCTGGCCTGGAGG - Intronic
1002522127 5:179797887-179797909 GGGGTCCGCCGCTGGCCCGGAGG - Exonic
1002524162 5:179806418-179806440 GGCGGCGGGAGCGGGCCCGGCGG - Intronic
1002785067 6:393706-393728 GGCGGCAGACGGGAGCCCGGAGG - Intronic
1006136041 6:31897158-31897180 GGGGGTTGATGCGGGCCCGGGGG - Intronic
1007557814 6:42782011-42782033 GGCGGCGGGCGCGGGGCCGGGGG - Exonic
1007680314 6:43629113-43629135 GGCGGCTGCTGCCGGCCCGGAGG - Exonic
1007832095 6:44646533-44646555 GGAGTCTGAAGCTGCCCCGGGGG + Intergenic
1011633920 6:89352897-89352919 GGCGGGTGACGCAAGCCGGGCGG - Intergenic
1017842447 6:158232499-158232521 GGCGTCTGACCCGGGCCCGGCGG + Intronic
1019278030 7:186403-186425 GGCTGCTGTCGCTGGCCCGCCGG - Intergenic
1019918038 7:4145738-4145760 GGGGGCTGCTGCTGGCCAGGCGG - Exonic
1020616648 7:10466477-10466499 GGCGGCGCTCGCTGGCGCGGCGG + Intergenic
1022101888 7:27173882-27173904 GGCGGCTGCTGCTGGGGCGGCGG + Exonic
1022207573 7:28179712-28179734 GGCCGGGGACGCGGGCCCGGGGG - Intronic
1022475257 7:30705804-30705826 GGAGGCTGAGGCTGCCCTGGAGG + Intronic
1029122930 7:98280871-98280893 GGCGCCTGACGCAGTCCCCGAGG + Intronic
1032525713 7:132577126-132577148 GGCGGCTGGCGCTGCGGCGGCGG + Exonic
1033288653 7:140062895-140062917 GGCGGCGGACGCTGGCTGGCGGG + Exonic
1033366138 7:140673552-140673574 GGCGGCTGGCGCGGGGCCCGCGG + Exonic
1039484290 8:37899184-37899206 GGCGGCGGCCGCGGGTCCGGAGG + Exonic
1039856320 8:41417348-41417370 GGGGGCTTACGCAGGCCAGGTGG + Intergenic
1041244790 8:55879946-55879968 GGCTGCTGGCGCGGGGCCGGGGG - Exonic
1052837771 9:33264550-33264572 GGCGGACCACGCTGGGCCGGGGG + Exonic
1055611752 9:78031479-78031501 GGAGGCGGGCGCTGGCTCGGGGG + Intergenic
1056922334 9:90801806-90801828 GGCGGCTGAGGCCACCCCGGCGG + Exonic
1057113053 9:92492642-92492664 GGCGGCTGATGCTCAACCGGAGG - Intronic
1057257955 9:93566601-93566623 AGGGGCTGGCGCTCGCCCGGGGG + Intergenic
1057328062 9:94084625-94084647 TGCGGCTGCAGCAGGCCCGGCGG + Exonic
1060749297 9:126158302-126158324 GGCGGCTGATGCTGGCGGAGAGG - Intergenic
1061181659 9:129028201-129028223 GGCGGCGGCGGCTGGGCCGGGGG - Exonic
1061669921 9:132182899-132182921 GGCTGCTGAAGCTGGTCTGGGGG - Intronic
1061880747 9:133567730-133567752 TGCTGCTAAGGCTGGCCCGGGGG + Intronic
1061922163 9:133788234-133788256 AGCCGCTGATGCTGGCCGGGTGG - Intronic
1062049436 9:134439452-134439474 GGCGGCTGACACAGGCCCCAGGG - Intronic
1062340328 9:136091209-136091231 GCCGGCTGGGGCTGGCCTGGGGG - Intronic
1062396954 9:136356424-136356446 GGCTGCCCACGCTGGCCCGCTGG - Exonic
1062499379 9:136845722-136845744 GGCGGCTGTCGGTGGCCAGCCGG - Exonic
1062544220 9:137054362-137054384 GGCGGGCGAGGCTGGCTCGGAGG + Intergenic
1062550552 9:137084276-137084298 GGAGGCTGAGGCTGGCCTGGAGG - Exonic
1062579017 9:137221520-137221542 GGCTGCTGAGGCTGGCGAGGGGG + Exonic
1062621159 9:137423168-137423190 GACCGCAGCCGCTGGCCCGGAGG + Exonic
1203794402 EBV:168970-168992 GGGGGCCGTCGCGGGCCCGGTGG + Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1190605526 X:52138946-52138968 GGCTGCTGAGGTTGGCCTGGTGG - Intergenic
1192180350 X:68912225-68912247 GGCGGCTGCCGCCGGGCCTGGGG + Intergenic
1195126468 X:101813712-101813734 GGCAGCTGAGGCTGGCCTGCAGG + Intergenic
1195179111 X:102339634-102339656 GGCAGCTGAGGCTGGCCTGCAGG - Intergenic
1197732570 X:129823795-129823817 GGCGGTGGTCGCTGGCCCTGGGG + Exonic
1197770097 X:130084213-130084235 GGCAGCTGAGGCTGGCCCGGAGG - Intronic