ID: 1180185033

View in Genome Browser
Species Human (GRCh38)
Location 21:46135273-46135295
Sequence GGATGCTGGTGTGGTGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180185033_1180185041 12 Left 1180185033 21:46135273-46135295 CCAATTACACCACACCAGCATCC No data
Right 1180185041 21:46135308-46135330 CCCTCACAAATGTCCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180185033 Original CRISPR GGATGCTGGTGTGGTGTAAT TGG (reversed) Intergenic
No off target data available for this crispr