ID: 1180186112

View in Genome Browser
Species Human (GRCh38)
Location 21:46140162-46140184
Sequence GTGAGCAATGTGAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 1, 2: 12, 3: 29, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180186112_1180186123 30 Left 1180186112 21:46140162-46140184 CCGTCCACCTTCACATTGCTCAC 0: 1
1: 1
2: 12
3: 29
4: 300
Right 1180186123 21:46140215-46140237 TCCACCTTCACGTGCCTCACAGG 0: 1
1: 6
2: 1
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180186112 Original CRISPR GTGAGCAATGTGAAGGTGGA CGG (reversed) Intronic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
900861293 1:5234276-5234298 GTGAATAGTCTGAAGGTGGAGGG - Intergenic
902658363 1:17884934-17884956 GTTAGTAATGGGCAGGTGGAAGG + Intergenic
904465861 1:30707221-30707243 GAGAGTGATGTGAAGGTGGGTGG - Intergenic
905131304 1:35760580-35760602 GTGAGGAATGTCAGGTTGGAGGG - Exonic
907062906 1:51449426-51449448 GGGGCCAATGTGAGGGTGGAGGG + Intronic
907396407 1:54193415-54193437 GTGAGCCATGTGGAGATGGAGGG + Intronic
907775468 1:57510148-57510170 GTTAAAAATGTGAATGTGGAAGG - Intronic
908511706 1:64854802-64854824 GGAAGGAAGGTGAAGGTGGAAGG - Intronic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
912230620 1:107788340-107788362 GTGGGCAGAGTGAGGGTGGAAGG - Intronic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
914975791 1:152360107-152360129 GATAACAATGTGAAGGAGGAAGG - Intergenic
915553363 1:156647640-156647662 ATGAGCAATGTGATGCTGGCTGG + Exonic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
917105864 1:171491275-171491297 GTGAACAATCTGAAGGTACAGGG + Intronic
918957666 1:191231121-191231143 GTAAACAATCTGAAGGTTGAAGG + Intergenic
920016178 1:202911285-202911307 GTGGGCAATGGGAAGCAGGAAGG - Intronic
920938534 1:210458630-210458652 GTGAGCAAAGAGAAAGTGAAGGG + Intronic
921095620 1:211884945-211884967 ATGAGCATTCAGAAGGTGGAGGG - Intergenic
921296044 1:213704989-213705011 CTGAACAATCTGAAGCTGGAGGG + Intergenic
921585038 1:216936152-216936174 GTCAGGAATGTGAAGGTTGGGGG + Intronic
921608160 1:217179104-217179126 GTGGGGAATGTGAAACTGGAAGG - Intergenic
921991678 1:221373391-221373413 GTGAGAAATGTGTTGGAGGAAGG + Intergenic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923049519 1:230381031-230381053 GTAAGCACTGTGCACGTGGATGG - Intronic
923281460 1:232446810-232446832 GTGGGCAATGTGACTATGGAGGG - Intronic
923760912 1:236843260-236843282 GTGAGCCATGTGAAAATGTAGGG + Intronic
924835831 1:247646234-247646256 GGGAGCAATGTCAAGGTGCATGG + Intergenic
1064539650 10:16392424-16392446 GTAAGCTCTGTGAAGGTGGGGGG - Intergenic
1064818391 10:19293743-19293765 GTGACCTATTTGAGGGTGGAGGG + Intronic
1065750156 10:28878663-28878685 GTGAGCACTGTGTTGGGGGAGGG + Intronic
1065805529 10:29390494-29390516 GGGAGCAATGTCAAGGTTGGAGG + Intergenic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1067430585 10:46240915-46240937 GTAAGCAGTGTCAAGGTGGGTGG - Intergenic
1069054815 10:63833590-63833612 GAGATCAGTGTGAGGGTGGAGGG - Intergenic
1070771837 10:79087104-79087126 ACAAGCAATGGGAAGGTGGAGGG - Intronic
1070973160 10:80584250-80584272 GTGTGCCATTTGTAGGTGGATGG + Intronic
1071058366 10:81538541-81538563 GTGAGCAAAATGATGGAGGAAGG - Intergenic
1071119222 10:82258762-82258784 ATGAGGAATGTGAAGGTTGGAGG + Intronic
1071238790 10:83680815-83680837 GTGAGCCTTGTGAAGGTGCTTGG + Intergenic
1071297432 10:84232486-84232508 GTGAGGTCTGTGAAGGTGGTGGG - Exonic
1072430023 10:95362659-95362681 GTGAGCAATGATAAGGCGGGAGG - Intronic
1072726396 10:97816668-97816690 GTGAGAAATGGGATGGTGGCTGG + Intergenic
1074676799 10:115860346-115860368 GTGAGCAAAGGGAAGGCAGATGG - Intronic
1076719775 10:132388007-132388029 GTGAGAAACGTGAATGTGGTTGG + Intergenic
1079464967 11:20721416-20721438 GTGAAAAATGTGAAGGAGAAAGG - Intronic
1080476382 11:32595791-32595813 GTGAGCCATGTGAAAGCAGATGG + Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1084295501 11:68211245-68211267 GTGGGGAAGGTGGAGGTGGATGG - Intronic
1085655419 11:78310144-78310166 CTGAGAAATGTGGGGGTGGAGGG + Intronic
1086184211 11:83994309-83994331 GTTACCACTTTGAAGGTGGAGGG + Intronic
1087586033 11:100122596-100122618 GTGAGCAATGTGAATGTCTGGGG + Intronic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1089989448 11:122845282-122845304 TTGAGCAATGTGAAGGTCTTTGG + Intronic
1090900824 11:131029410-131029432 GTGAGGAGTGTGTAGGTTGATGG + Intergenic
1091229182 11:133976871-133976893 GTAAGTTATGTGAAAGTGGAAGG + Intergenic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1094487491 12:30936643-30936665 GTGAGCACTGCATAGGTGGATGG + Intronic
1096779038 12:53981814-53981836 GTGAGCAATGCAGAGGAGGAGGG - Intergenic
1097464787 12:59908703-59908725 GAGACCCATGTGGAGGTGGAAGG + Intergenic
1097637778 12:62143575-62143597 GTGATCTATGTGAAGGTAGCTGG + Intronic
1097829973 12:64214045-64214067 GTGTGCAATGGGATGGTGAAGGG - Intronic
1097905534 12:64915389-64915411 GTTAGCCAGGTGAAGGAGGAGGG + Intergenic
1098053941 12:66483812-66483834 GTGAGCAATGTAAAGGAGTAGGG - Intronic
1100514577 12:95314705-95314727 GTGATCTATGTGAGGGAGGATGG + Intergenic
1100678789 12:96896743-96896765 GTCAGCTATGTGAAGGTGGGAGG + Intergenic
1100755831 12:97750076-97750098 AAAGGCAATGTGAAGGTGGAGGG - Intergenic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1102683967 12:114709920-114709942 ATGAGCAATCTGGGGGTGGAGGG + Intergenic
1106255579 13:28019607-28019629 GTGGGCAAAGTGCAGGTAGATGG - Intronic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1107384767 13:39896065-39896087 GGAAGGAATGTGAAGGTGTAAGG + Intergenic
1108211717 13:48146059-48146081 GGGAGCAGGGTGGAGGTGGAGGG - Intergenic
1108304119 13:49113638-49113660 ATGAGGAATGTAAAGGGGGAAGG - Intronic
1108505491 13:51108920-51108942 TTGAGCTATCTGAAGATGGAGGG - Intergenic
1108963066 13:56261393-56261415 GTGATGAGTGAGAAGGTGGATGG - Intergenic
1110045606 13:70825951-70825973 ATGAGCAATTTAAAAGTGGATGG - Intergenic
1111689636 13:91546975-91546997 TTTAGCAATGAGAAGGTAGATGG + Intronic
1112572559 13:100607185-100607207 TTAAGGAATGCGAAGGTGGATGG - Intronic
1113934096 13:113984335-113984357 GTGAGTGATGGGTAGGTGGACGG - Intronic
1114312819 14:21483432-21483454 GTGAGCATTTTTAAGGTAGAAGG - Intronic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1116360644 14:43992172-43992194 GGGACCTATGGGAAGGTGGAGGG + Intergenic
1118435721 14:65769492-65769514 GTAACCAATGAGAAAGTGGATGG + Intergenic
1119246346 14:73112469-73112491 GTGAGGAGTCTGAAGTTGGATGG - Intronic
1119660788 14:76450306-76450328 GTGAGCAAAGGCAAAGTGGAAGG + Intronic
1121005009 14:90484511-90484533 GGTAGGAATGGGAAGGTGGATGG - Intergenic
1121901629 14:97698162-97698184 GAGAGCACTGTGAAGGTGACTGG - Intergenic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1124706667 15:31972249-31972271 GTGAGCACTTTGAAGCTGCACGG - Intergenic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1127329389 15:57923718-57923740 ATGAACGATGTGAAGGTGGTGGG - Intergenic
1128517846 15:68354481-68354503 GTGAGCCATGTAAAGATGGTGGG - Intronic
1128742050 15:70090519-70090541 GTGACCACGGTGAAGGTGCAAGG - Intronic
1130809795 15:87364914-87364936 GTGAGCAATGTGAGGGTTGAGGG + Intergenic
1131439286 15:92446872-92446894 GTGAGCAAGGAGAAAGGGGAAGG + Intronic
1131692438 15:94841735-94841757 GTGAGCAATGAGCAAGTGGAAGG - Intergenic
1132301138 15:100776368-100776390 GTGAGCAATTTGAAAGTTTAAGG + Intergenic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG + Intronic
1133795148 16:9040256-9040278 GAGAGCAAGATGAAGCTGGAAGG + Intergenic
1133898182 16:9949096-9949118 GGGAGCACCGTGGAGGTGGAGGG - Intronic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1141051305 16:80767066-80767088 GTGAGCAATGTGCAGGTTCTGGG - Intronic
1141926341 16:87172755-87172777 GTGAGGAATCTGAGGGTAGAAGG - Intronic
1142199748 16:88755468-88755490 GGGAGGAATGTGCAGGTGGCTGG - Intronic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1143538398 17:7555507-7555529 GTGAGCCATCGGAAGGAGGAAGG + Intronic
1143579746 17:7818583-7818605 ATGAGGAAGGTGAAGGTCGAAGG + Intronic
1143974721 17:10821305-10821327 GAGAGCTGTGTGGAGGTGGAGGG + Intergenic
1146110484 17:30084690-30084712 GAGAGAAATGTGAATCTGGAGGG - Intronic
1147904890 17:43816339-43816361 GTGAGCAGTGTGAATAGGGAGGG + Intronic
1148360210 17:47005557-47005579 GTGGGCATTGTAAATGTGGAGGG - Intronic
1151262296 17:72925784-72925806 ATGTGCAATGTCATGGTGGAGGG - Intronic
1152496148 17:80673412-80673434 GTTATCACTGTGGAGGTGGAGGG + Intronic
1154437250 18:14356482-14356504 GTGAGCAAGGTGTAGGAGAAGGG + Intergenic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1156572572 18:38275007-38275029 TGGAGCCATTTGAAGGTGGAGGG + Intergenic
1157221373 18:45830427-45830449 GTGACCAATCTAAAGGAGGAAGG - Intronic
1157689400 18:49668811-49668833 GTGAGCTATGTGCAAGTGGCAGG + Intergenic
1159598497 18:70406224-70406246 GTGAGAAATGGGGAGATGGAGGG + Intergenic
1159751492 18:72307625-72307647 GTGGGCTATGTGTATGTGGAGGG + Intergenic
1162393212 19:10402274-10402296 GTGAGCACTGAGAGGGTGGTGGG + Intronic
1165449553 19:35874230-35874252 CTGACCAATGTTAAGGTGAAAGG - Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
1166934083 19:46320620-46320642 GTGAGCCATGTTAAGGTGCTTGG - Intronic
925525055 2:4790688-4790710 GTGAGCAATGCGAAGGAGATGGG - Intergenic
928417040 2:31103862-31103884 GTCAACAAAGTGAAGATGGAGGG - Intronic
928913722 2:36449252-36449274 GGGAGCATTGTGGAGCTGGAAGG + Intronic
932078947 2:68693896-68693918 GGGAGCAGTGAGATGGTGGAGGG - Intronic
932308924 2:70724473-70724495 GGGAGCAGTGTGAGGGTGGGCGG - Intronic
933835264 2:86240710-86240732 GTGAGCAGTGTGAAGGAGGCAGG + Intronic
934765619 2:96878553-96878575 GTGGGGAGTGTGCAGGTGGAGGG - Intronic
935040124 2:99418283-99418305 GTGAGAAAGGTTAAGATGGAAGG + Intronic
935096833 2:99952808-99952830 GTCAGGAATGTGAGTGTGGAGGG + Intronic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
936524287 2:113232420-113232442 GTGAGCACTTTGAAGGTTGCTGG - Intronic
936705033 2:115062525-115062547 GGGAGCAGTGTGCAGGGGGAAGG - Intronic
936715909 2:115187507-115187529 GTGAAAATTGTGAAAGTGGATGG + Intronic
936928008 2:117757818-117757840 GTCTGCAATGAGAAGGTTGAAGG + Intergenic
937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG + Intergenic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
938811213 2:134854578-134854600 GTGAGCAATGTGAGGAAGTAGGG - Intronic
939921665 2:148122998-148123020 GTGAGCAATGAAGAGGTGGGTGG + Intronic
942996137 2:182263054-182263076 ATGAGCAATGTTAAACTGGATGG - Intronic
947293437 2:228603280-228603302 GTGAGCATTGGGAAGTTGGGGGG + Intergenic
948080318 2:235200318-235200340 GTGACCCATGTGAAGGAGGTAGG + Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948478804 2:238238127-238238149 GTGAGCAGTGTGATGGTGGTGGG - Intergenic
1169115973 20:3066155-3066177 TTGAGCAATGGGAAGGATGAAGG - Intergenic
1170383014 20:15782623-15782645 TTGACCAATTTGAAGGTGAAAGG - Intronic
1170930568 20:20766602-20766624 GTGAGCACTGGGTAGGTGGGTGG + Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1171073262 20:22096377-22096399 GAGATCAATGTGAAGCTGCAAGG - Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172068489 20:32238879-32238901 GTGAGGAATGCGGAGGTGAAGGG - Intergenic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1174677589 20:52373298-52373320 GAGAGCAATGTGAAGGAGACAGG - Intergenic
1176047134 20:63098567-63098589 GTGAGCAATGGACAGATGGATGG + Intergenic
1179506226 21:41843609-41843631 GTGAGCAATGTGAGGCTGCAGGG + Intronic
1179614266 21:42571664-42571686 GTGGGCAATGTCGGGGTGGAAGG - Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186226 21:46140714-46140736 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186245 21:46140814-46140836 GTGAGCAATGTGAAGGCTGACGG - Intronic
1180186253 21:46140864-46140886 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1181741447 22:24924758-24924780 GTCAGTAATGTCGAGGTGGAGGG - Exonic
1182009456 22:26988295-26988317 GTGAGGACTGTCCAGGTGGATGG + Intergenic
1182656623 22:31895423-31895445 GTGAGCACTGCGATGGGGGATGG - Intronic
1182656746 22:31896751-31896773 GAGAGAAATGTGATGGAGGAGGG - Intronic
1183133073 22:35858505-35858527 GTGAGAAATAGGAAGATGGATGG - Intronic
1183900278 22:41000414-41000436 GTGAGCCATGTGAATATGGGTGG - Intergenic
1184014616 22:41776583-41776605 GTGAGAAATCTGGAGGAGGATGG + Intronic
1185094842 22:48800581-48800603 GTCTGCAAAGTGAAGGTGCAGGG - Intronic
950667344 3:14505583-14505605 GGGAGCACCGTGAAGGAGGAGGG - Intronic
951088397 3:18542209-18542231 GTGAGCCATGTGCATATGGAGGG + Intergenic
951843573 3:27061459-27061481 AAGACCAATGTAAAGGTGGAGGG - Intergenic
952494090 3:33900876-33900898 GTGAGGTATGTGAGGGAGGAAGG + Intergenic
953105069 3:39869901-39869923 ATGAGATATGTCAAGGTGGAGGG + Intronic
953923678 3:46969268-46969290 GGGAGCAATGCCAAGGTAGAAGG - Intronic
954619242 3:51986268-51986290 GTGAGGAGGCTGAAGGTGGAGGG + Exonic
954689006 3:52385990-52386012 GTGAGCACTCAGGAGGTGGAAGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
956716360 3:72083673-72083695 GTGAGCAAAGAGAATTTGGAGGG - Intergenic
956784212 3:72628784-72628806 ATGAGCAATGTGAACTTTGATGG - Intergenic
957141797 3:76369049-76369071 GTGAGAAGTTTGAAGGTGAATGG - Intronic
957356545 3:79095061-79095083 GTGAGCCCTATGAAGGTTGAGGG - Intronic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
958167061 3:89889679-89889701 GTGGGTGATGTGAAGGTTGAGGG - Intergenic
960544018 3:118891341-118891363 ATCAGCACTGTGAAGTTGGAGGG + Intergenic
960570665 3:119182256-119182278 GTGAACAGAGGGAAGGTGGAAGG + Intronic
960620509 3:119632410-119632432 GTGAGCAAAGTGGGTGTGGAAGG - Intergenic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
962682728 3:137816417-137816439 GTGAGCAATGAGAAAATGAAAGG + Intergenic
962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG + Intronic
963124677 3:141804173-141804195 GTGTGCAAGCTGAAGGTGCAAGG - Intronic
964858756 3:161176629-161176651 GTGAGAACAGTGATGGTGGATGG + Intronic
965114820 3:164476328-164476350 TTGAGCAGTGTGATGTTGGAGGG - Intergenic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
967340600 3:188392974-188392996 GGGTACAATGTAAAGGTGGAAGG - Intronic
967670781 3:192232704-192232726 GGGACCTATTTGAAGGTGGAGGG - Intronic
968192240 3:196677115-196677137 GGGAGCAATGTGGAGGTGTTTGG + Intronic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
970043447 4:11822728-11822750 GTGTGCAAGGTGGAGGTGGTTGG + Intergenic
970554824 4:17220685-17220707 GGTAGCAATGTGAAGATGGAAGG + Intergenic
975650761 4:76590338-76590360 GTGAGCCGTCTGAAGGTGGCTGG + Intronic
979063390 4:116097079-116097101 CTGGGCAGTGTGAAGATGGAGGG - Intergenic
979719486 4:123882288-123882310 GAGAGAAATGTGAGGATGGATGG + Intergenic
979762672 4:124426324-124426346 GAGAGCAGTGTGATGCTGGAAGG - Intergenic
981130693 4:141155484-141155506 GTGGGCACTTTGAAGGAGGAAGG + Intronic
981602754 4:146509100-146509122 GTGAGATATGTGAAAGTGGTTGG - Intronic
982396081 4:154917427-154917449 GTGAGCAAGCTGCAGGTGGTAGG - Intergenic
982933398 4:161437766-161437788 GTGAGAAGTGAGATGGTGGATGG + Intronic
984604269 4:181766529-181766551 GTGAGCAGAGTGGAGGTGGCAGG + Intergenic
989738899 5:44745387-44745409 GTCAGCAATGTGATGGTGTTTGG - Intergenic
990410475 5:55535719-55535741 GTGAGGGAGGTGACGGTGGATGG - Intergenic
991153032 5:63394633-63394655 GAAAACAATGTGAAGGTGGTAGG + Intergenic
991620930 5:68544893-68544915 GGGAGCAAGGTGGAGGGGGAAGG + Intergenic
991919575 5:71642279-71642301 GGGAGGAATGAGAAGGTGGGAGG + Intronic
991966423 5:72096025-72096047 GAGAGAGATGTGAAGATGGAAGG - Intergenic
992626218 5:78637938-78637960 GTGAACAGTGTGAGGGAGGAAGG - Intronic
992769411 5:80033576-80033598 GAGAGCAATAAGAAGGTAGAAGG - Intronic
992966142 5:82002631-82002653 GGGTTCTATGTGAAGGTGGAGGG + Intronic
993336471 5:86665712-86665734 GTGAGCCATTAGAAGGTAGAAGG - Intergenic
994709441 5:103248764-103248786 GGGGGCTATTTGAAGGTGGAGGG + Intergenic
995214157 5:109575415-109575437 GTGAGCAAAGAGAAAGTAGATGG - Intergenic
998254414 5:140573801-140573823 GTGAGCAAGGTGAAGCCTGAGGG - Intronic
999588316 5:153116086-153116108 GAGAGGAAAGTGAAGGTGAAAGG - Intergenic
999977938 5:156930347-156930369 TTGAGCAATGTGATGGAGGTTGG + Intronic
1000445507 5:161314024-161314046 GGTAGCAATGTGAAGCTGAAAGG + Intronic
1001383236 5:171317646-171317668 GGGATCAATGGGATGGTGGAAGG - Intergenic
1001690155 5:173626862-173626884 GAGGTCAATGTGAAGCTGGAAGG + Intergenic
1002819324 6:710259-710281 GTTAGGAATATGAAGGTTGACGG - Intergenic
1002823072 6:746850-746872 TTGAACATTGTGTAGGTGGAGGG - Intergenic
1004702332 6:18091045-18091067 GTGAGCAATGGCAAGGAGGGAGG - Intergenic
1005058828 6:21757400-21757422 GTGACCATTGTGAATGAGGATGG + Intergenic
1005897622 6:30191540-30191562 GAGAGCAGAGTGAAGGGGGATGG + Intronic
1006152669 6:31997720-31997742 AAGATCAATGTGAAGGTGGGAGG + Exonic
1006158977 6:32030457-32030479 AAGATCAATGTGAAGGTGGGAGG + Exonic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006927074 6:37662676-37662698 GTGAGGAATGAGAAGATGCAAGG + Intronic
1007041506 6:38726621-38726643 GTGAGCAAAGCCATGGTGGAGGG + Intronic
1007182245 6:39937773-39937795 GTGGGCAAGGTTAAGGTGGGCGG - Intergenic
1007494034 6:42246986-42247008 GTGAGCATCTTGAGGGTGGAGGG - Intronic
1007954279 6:45902195-45902217 TTGAGCTATGAGAAAGTGGATGG - Exonic
1008102196 6:47404011-47404033 GTGAGATATGAGGAGGTGGATGG - Intergenic
1011861896 6:91768353-91768375 GTCAGCAATGTGATGGAAGAAGG + Intergenic
1013843081 6:114421246-114421268 GAAATGAATGTGAAGGTGGAGGG + Intergenic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1016154504 6:140786976-140786998 GTGAGCATTGGGGATGTGGATGG - Intergenic
1016276518 6:142359499-142359521 GTGAGCCAAGTAAAGGAGGAAGG - Intronic
1019137781 6:169922114-169922136 GAGAGCCCTGTGAAGGAGGAAGG + Intergenic
1020384939 7:7590797-7590819 GTGAGAAATGTGAAGTATGAGGG - Intronic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1021706001 7:23368512-23368534 CTGAGGAAAGTGAAAGTGGAGGG + Intronic
1022668480 7:32432730-32432752 GTGAGAAATGAGAATGGGGAGGG - Intergenic
1023578115 7:41651887-41651909 GAGAGCAAAATGAAGGTGGTGGG - Intergenic
1024022633 7:45385828-45385850 GTAGGGAATGGGAAGGTGGAAGG + Intergenic
1024527866 7:50363836-50363858 GACAGCAAGGTGGAGGTGGATGG - Intronic
1024541952 7:50482107-50482129 GTGAGCTATGTTAAGGTTGGAGG + Intronic
1026099569 7:67373299-67373321 GGGATCTATGTGAGGGTGGAGGG - Intergenic
1026401789 7:70021401-70021423 TTGAGAAGTGTGAAGCTGGATGG + Intronic
1028838537 7:95400681-95400703 TTGAGAAATGTTTAGGTGGAGGG + Intergenic
1029107338 7:98189191-98189213 GTGAGCAGTGTGAGGATGTAGGG + Intronic
1029954703 7:104625692-104625714 GTTTGCAATTTGGAGGTGGAGGG - Intronic
1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG + Intergenic
1033718933 7:144036206-144036228 GAGAGCAAGGTAAAGATGGAGGG - Intergenic
1036168463 8:6459831-6459853 CTGAGTAATGTGAAGGTGCCAGG + Intronic
1036208940 8:6826637-6826659 GTGAGGAATGTGAGGATGGGTGG + Intronic
1036921788 8:12863032-12863054 GTGTGCAGTGTGAAGAAGGAAGG - Intergenic
1037415012 8:18640518-18640540 GAGAGCCAAGTGAAGGTGAAGGG - Intronic
1037449589 8:19003422-19003444 GTGAGAAGTGTGAAGTTGGGAGG - Intronic
1037547965 8:19941642-19941664 GTGAGTAGAGTGAAAGTGGAGGG - Intronic
1039044790 8:33439985-33440007 GGAAGCAGTTTGAAGGTGGAAGG - Intronic
1040893053 8:52337600-52337622 ATGAGCAGTGTGAAGGTGTGGGG + Intronic
1040954642 8:52967396-52967418 GGGACCTATGTGAAGGTGGAGGG - Intergenic
1041963456 8:63647184-63647206 GTAAGCAACGTGGAGGTGCAGGG + Intergenic
1042876080 8:73441017-73441039 GTGAGCCATGTGAACTGGGAGGG - Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1046714910 8:117557005-117557027 GAGATCAATGTGAAGGAGGCAGG + Intergenic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1048802363 8:138206217-138206239 GAGAGCTGTGTGTAGGTGGAGGG - Intronic
1049994844 9:1025139-1025161 GTGAGCATTGTGGAGGAGGCAGG + Intergenic
1051261958 9:15273456-15273478 GGGAGGAATGTGGAGGAGGAGGG - Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1052989768 9:34512358-34512380 GTCATCAAGCTGAAGGTGGAAGG + Exonic
1053670931 9:40360200-40360222 GTGAGCAAGGTGTAGGAGAAGGG - Intergenic
1053920735 9:42986573-42986595 GTGAGCAAGGTGTAGGAGAAGGG - Intergenic
1054382049 9:64500262-64500284 GTGAGCAAGGTGTAGGAGAAGGG - Intergenic
1054513682 9:66016101-66016123 GTGAGCAAGGTGTAGGAGAAGGG + Intergenic
1054824000 9:69552853-69552875 ATGAGCAAGGTGAGGGTAGAAGG - Intronic
1055986858 9:82061872-82061894 GTGAGGACTGTGGGGGTGGAGGG - Intergenic
1056685684 9:88757412-88757434 GTGAGTAATGTACAGCTGGATGG + Intergenic
1057731685 9:97614639-97614661 ATGCGCCATGTGAAGGTGCAGGG + Intronic
1057731939 9:97617204-97617226 ATGCGCCATGTGAAGGTGCAGGG + Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058875575 9:109241911-109241933 ATGAGCCATGTGAATGGGGATGG + Intronic
1060038343 9:120278347-120278369 GTGGGCAATGGGAAGCTAGAAGG + Intergenic
1186782968 X:12931610-12931632 GTGGGCAATGGGAACATGGAAGG - Intergenic
1187943189 X:24401554-24401576 GTTAGAAATGTCAAGGTGGAAGG - Intergenic
1188727693 X:33606497-33606519 GTGAGCAATGTGGTGGGGGGGGG + Intergenic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1191111188 X:56804050-56804072 GGGGGCAATGTGAAGGGGTATGG + Intergenic
1194603345 X:95950693-95950715 GTTAGCAATGTGAAGATTAAGGG - Intergenic
1195455516 X:105064820-105064842 TTGAAGGATGTGAAGGTGGAAGG + Intronic
1196439194 X:115703045-115703067 GTGAGCAATGAGGAGCTGCAGGG + Intergenic
1197033602 X:121848501-121848523 GAAAGCAATGGGAAGATGGAGGG + Intergenic
1197048497 X:122029372-122029394 GAGAGCAACAGGAAGGTGGAGGG + Intergenic
1197462698 X:126762122-126762144 GTGAGCAATGTGAATGATGTGGG + Intergenic
1197701344 X:129602431-129602453 ATGAGAAATGTGATTGTGGAGGG - Intergenic
1198303621 X:135356562-135356584 TTGAGCAATGTGGAGGTTAAGGG + Intronic
1198561895 X:137859303-137859325 GGGAGCTCTGTGAAGTTGGAAGG + Intergenic
1199418404 X:147614301-147614323 TTGAGCAATGTGAAGGTTAGGGG - Intergenic
1199601851 X:149545743-149545765 GTGAGCAATGTGGACGGCGATGG - Exonic
1199648533 X:149933740-149933762 GTGAGCAATGTGGACGGCGATGG + Exonic
1201901247 Y:19047335-19047357 GTGACCAATGGGTGGGTGGATGG + Intergenic
1202163850 Y:21965999-21966021 GTGAGAAATTTGATGATGGAAGG + Intergenic
1202227506 Y:22620365-22620387 GTGAGAAATTTGATGATGGAAGG - Intergenic
1202315618 Y:23575289-23575311 GTGAGAAATTTGATGATGGAAGG + Intergenic
1202555150 Y:26094785-26094807 GTGAGAAATTTGATGATGGAAGG - Intergenic