ID: 1180186131

View in Genome Browser
Species Human (GRCh38)
Location 21:46140262-46140284
Sequence GTGAACAATGTGAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180186131_1180186143 30 Left 1180186131 21:46140262-46140284 CCGTCCACCTTCACATTGTTCAC 0: 1
1: 1
2: 2
3: 34
4: 268
Right 1180186143 21:46140315-46140337 TCCACCTTCGCATTGCTCAGAGG 0: 2
1: 0
2: 2
3: 11
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180186131 Original CRISPR GTGAACAATGTGAAGGTGGA CGG (reversed) Intronic
900861293 1:5234276-5234298 GTGAATAGTCTGAAGGTGGAGGG - Intergenic
903767668 1:25745075-25745097 CAGAAAACTGTGAAGGTGGAGGG - Intronic
904346670 1:29876904-29876926 GTGAACAGTTTGAAGGGCGATGG - Intergenic
904465297 1:30704114-30704136 GTCAACATTGTGCAGGGGGAGGG - Intergenic
905386430 1:37607363-37607385 GTGAACAGTGATAAGGTGGGAGG - Intergenic
907062906 1:51449426-51449448 GGGGCCAATGTGAGGGTGGAGGG + Intronic
907396407 1:54193415-54193437 GTGAGCCATGTGGAGATGGAGGG + Intronic
907775468 1:57510148-57510170 GTTAAAAATGTGAATGTGGAAGG - Intronic
908494943 1:64685430-64685452 TTGTACACTGTGGAGGTGGAGGG + Intronic
909689025 1:78384811-78384833 GTGAAAAATGTCATTGTGGATGG - Intronic
910297481 1:85664609-85664631 AGGAACTAGGTGAAGGTGGAGGG + Intronic
911985292 1:104615352-104615374 TTGAACAACGTGAAGGTGAGAGG + Intergenic
912522896 1:110258623-110258645 GTGAATGATTTGAAGGAGGATGG - Intronic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912843456 1:113059389-113059411 GTGAACAGAGTGAGGCTGGAGGG + Intergenic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
914975791 1:152360107-152360129 GATAACAATGTGAAGGAGGAAGG - Intergenic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
915476787 1:156157510-156157532 GGGAACAATGTGAGGAAGGAAGG + Intronic
916126216 1:161573752-161573774 CTCTAGAATGTGAAGGTGGAAGG - Intergenic
916136134 1:161655592-161655614 CTCTAGAATGTGAAGGTGGAAGG - Intronic
916711088 1:167409721-167409743 GTGAATGATTTGAAGGTGGCTGG + Intronic
917105864 1:171491275-171491297 GTGAACAATCTGAAGGTACAGGG + Intronic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
918239428 1:182609003-182609025 GTGGAAAATGTGAATGGGGAGGG - Intergenic
918633931 1:186752203-186752225 GTGAACAAAATGATGATGGATGG - Intergenic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
918957666 1:191231121-191231143 GTAAACAATCTGAAGGTTGAAGG + Intergenic
921296044 1:213704989-213705011 CTGAACAATCTGAAGCTGGAGGG + Intergenic
923046689 1:230361178-230361200 ATGAGCACTGTGGAGGTGGAGGG - Intronic
923524085 1:234759075-234759097 ATGAAGGATGTGAAGATGGAGGG - Intergenic
924835831 1:247646234-247646256 GGGAGCAATGTCAAGGTGCATGG + Intergenic
1064818391 10:19293743-19293765 GTGACCTATTTGAGGGTGGAGGG + Intronic
1064954375 10:20891516-20891538 GTGAAGAATGTGAATGTGATGGG - Intronic
1067080562 10:43210096-43210118 GTGAATCATGTGCAGGTGAATGG + Intronic
1067179185 10:43972128-43972150 ATCCAAAATGTGAAGGTGGAAGG - Intergenic
1067354257 10:45510833-45510855 GTGGACTATGTGGAAGTGGAAGG + Intronic
1069054815 10:63833590-63833612 GAGATCAGTGTGAGGGTGGAGGG - Intergenic
1069465555 10:68635664-68635686 GTGAAGAATGAGAAGGTAGTAGG + Intronic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1071690133 10:87809469-87809491 GTAAAAGAGGTGAAGGTGGAAGG + Intronic
1073580558 10:104661851-104661873 GAGAAGTATGTGTAGGTGGAAGG + Intronic
1074931512 10:118131354-118131376 GAGCAGAATGTGAAGGTGGTTGG + Intergenic
1075354814 10:121762029-121762051 GTGAACAGAGTGAAGGTGACTGG - Intronic
1076199180 10:128544848-128544870 TTTCACAATGTGGAGGTGGAGGG + Intergenic
1077264892 11:1643573-1643595 GGTGACAATGTGAAGGTGGTTGG - Intergenic
1078406983 11:11079045-11079067 GTGAACAGTGGGATAGTGGAAGG + Intergenic
1079464967 11:20721416-20721438 GTGAAAAATGTGAAGGAGAAAGG - Intronic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1080709026 11:34728139-34728161 GTGGACCATGAGAGGGTGGAGGG - Intergenic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1083450680 11:62742939-62742961 GGCAACATTGTGAAGGTGGTGGG - Intergenic
1083730908 11:64652034-64652056 GTGGACAACGTGACTGTGGAGGG - Exonic
1083991852 11:66251103-66251125 GAGGACATTGTAAAGGTGGAAGG + Intergenic
1084565973 11:69929253-69929275 GGGAACACTGAGAAGGAGGATGG - Intergenic
1086184211 11:83994309-83994331 GTTACCACTTTGAAGGTGGAGGG + Intronic
1086513691 11:87588376-87588398 GTTAACAAGGTAAAGCTGGAAGG + Intergenic
1086872214 11:92051788-92051810 TTGAACAATGTGAAGGTTAGGGG + Intergenic
1087429785 11:98038365-98038387 GTGCACAAGGGGAAGGGGGAAGG + Intergenic
1089166404 11:116480626-116480648 ATGAACAGTGGGAAGATGGATGG + Intergenic
1089283946 11:117393841-117393863 GTGAACAATGGGTGGGTAGAGGG + Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1091558084 12:1590899-1590921 GGGGAGGATGTGAAGGTGGAAGG - Intronic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1096214680 12:49792595-49792617 AGGAACAAAGGGAAGGTGGATGG + Intronic
1097464787 12:59908703-59908725 GAGACCCATGTGGAGGTGGAAGG + Intergenic
1097637778 12:62143575-62143597 GTGATCTATGTGAAGGTAGCTGG + Intronic
1097931528 12:65192441-65192463 GTGCACAATGGGAAGGAAGACGG - Intronic
1098053941 12:66483812-66483834 GTGAGCAATGTAAAGGAGTAGGG - Intronic
1099452949 12:82829813-82829835 GTCAACTAGGTGAAGGTGGGTGG + Intronic
1100282279 12:93129104-93129126 TTGAAAAATGTGAAGCAGGAAGG + Intergenic
1100514577 12:95314705-95314727 GTGATCTATGTGAGGGAGGATGG + Intergenic
1100678789 12:96896743-96896765 GTCAGCTATGTGAAGGTGGGAGG + Intergenic
1102311986 12:111852625-111852647 TTGAACAACGTGAAGGTTAAGGG - Intronic
1108305443 13:49127557-49127579 GTGAAGCATGTCAAGGAGGAAGG - Intronic
1108776730 13:53774097-53774119 GAGAACAATGTGAGGGTCTAAGG + Intergenic
1108963066 13:56261393-56261415 GTGATGAGTGAGAAGGTGGATGG - Intergenic
1109161465 13:58980473-58980495 GTGCACAGGGTGAAGGTGGGAGG - Intergenic
1110763722 13:79258628-79258650 TTGCACAATGTCAAGCTGGATGG - Intergenic
1114775065 14:25472700-25472722 TTGAACAATGTGAGGGTTGCAGG - Intergenic
1115318046 14:32046941-32046963 CAGAAAAATGTGAAGGAGGAAGG + Intergenic
1115864682 14:37732004-37732026 TTGAACAATGTGAGGGTTGGGGG + Intronic
1115971325 14:38947961-38947983 TTGAACAATGTGGAGGTGAGGGG + Intergenic
1116360644 14:43992172-43992194 GGGACCTATGGGAAGGTGGAGGG + Intergenic
1118435721 14:65769492-65769514 GTAACCAATGAGAAAGTGGATGG + Intergenic
1119931225 14:78549345-78549367 GTGAACAAAGAGAAGGAGAAGGG - Intronic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1127329389 15:57923718-57923740 ATGAACGATGTGAAGGTGGTGGG - Intergenic
1128178497 15:65579228-65579250 GAGAAGGATGTGAAGGTGGTTGG - Exonic
1128742050 15:70090519-70090541 GTGACCACGGTGAAGGTGCAAGG - Intronic
1130809795 15:87364914-87364936 GTGAGCAATGTGAGGGTTGAGGG + Intergenic
1131692438 15:94841735-94841757 GTGAGCAATGAGCAAGTGGAAGG - Intergenic
1133286188 16:4691953-4691975 TTGAAGACTGTGAGGGTGGAGGG + Intergenic
1134301502 16:12995620-12995642 CTTAACAGTGGGAAGGTGGAAGG - Intronic
1134395576 16:13859900-13859922 GTGAACAATGTGTCTTTGGAAGG - Intergenic
1134898629 16:17913822-17913844 GGGAAGTATGTGAAGGTGGGAGG + Intergenic
1136485855 16:30571389-30571411 GTGAACCCGGTGAAGGAGGAGGG + Intronic
1140559410 16:75960589-75960611 GGGAACAATGTCAAGGAGAAGGG - Intergenic
1141045980 16:80716478-80716500 ATGAACAATGGGTGGGTGGATGG + Intronic
1141236679 16:82224763-82224785 ATGAACAAAGTGATGGAGGAAGG - Intergenic
1141641809 16:85346057-85346079 ATGAACAATGGATAGGTGGATGG + Intergenic
1143191293 17:5042034-5042056 GTGAAAAATTGGAAGTTGGACGG - Intronic
1143871298 17:9958968-9958990 GTGAACAAGTGGAAGGAGGATGG - Intronic
1147141447 17:38462890-38462912 GTCAAGAATGTGAAGGAAGACGG + Exonic
1147589116 17:41669929-41669951 ATGAACAATGGGAAGGTTGTGGG + Intergenic
1147621593 17:41871726-41871748 GTGAACAAGATGAAGAAGGAAGG - Exonic
1148033668 17:44641411-44641433 CAGAACAATTTGAAGTTGGAAGG + Intergenic
1148353514 17:46958237-46958259 CTGTAAAATGTGAAGGTTGACGG - Intronic
1152496148 17:80673412-80673434 GTTATCACTGTGGAGGTGGAGGG + Intronic
1154261887 18:12842261-12842283 CTAAACAAATTGAAGGTGGAGGG + Intronic
1155994923 18:32321067-32321089 GTGAATAATGTGATAATGGAAGG - Intronic
1156708641 18:39914427-39914449 GATCACAAAGTGAAGGTGGATGG - Intergenic
1156985302 18:43343937-43343959 GTGAAAAATGAGTAGGTAGAAGG - Intergenic
1157221373 18:45830427-45830449 GTGACCAATCTAAAGGAGGAAGG - Intronic
1157371209 18:47113927-47113949 GTGGACAATGAGACGGTGGGGGG + Intronic
1157575102 18:48738451-48738473 GTGCAGAGTGTGAAGGGGGAGGG - Intronic
1159920995 18:74227330-74227352 GTTCACACTGTGCAGGTGGATGG - Intergenic
1160094966 18:75862740-75862762 GTGGACAATGGGAAGATGAACGG + Intergenic
1162727699 19:12700017-12700039 GGGAACATGGTCAAGGTGGAAGG - Exonic
1165449553 19:35874230-35874252 CTGACCAATGTTAAGGTGAAAGG - Intronic
1165898953 19:39159718-39159740 GATAACAAGGTGAAGGTTGAGGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166267938 19:41696537-41696559 CTGAACCCTGTGAAGGAGGAAGG - Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
925296348 2:2780024-2780046 GTGAACTCTGGGAAGGTGCAGGG - Intergenic
925296530 2:2780904-2780926 GTGAACTCTGGGAAGGTGCAGGG - Intergenic
925651483 2:6094144-6094166 GTGAACAAGGTAAAGGGTGAAGG - Intergenic
926404496 2:12537141-12537163 GTGAAGAATGGGAAGGGAGAGGG + Intergenic
928417040 2:31103862-31103884 GTCAACAAAGTGAAGATGGAGGG - Intronic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
932403991 2:71501510-71501532 GAGAACATTTTGGAGGTGGACGG - Intronic
933541027 2:83643027-83643049 GTGAACATTTTGAATGTGTATGG + Intergenic
933835264 2:86240710-86240732 GTGAGCAGTGTGAAGGAGGCAGG + Intronic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
935415828 2:102817527-102817549 GTGTACAATTTGAGGGTTGATGG + Exonic
936715909 2:115187507-115187529 GTGAAAATTGTGAAAGTGGATGG + Intronic
940071036 2:149688127-149688149 CTGAACAGTGGCAAGGTGGATGG - Intergenic
944317951 2:198303496-198303518 CTGGACCATGTGAAGCTGGAAGG - Intronic
947154343 2:227146380-227146402 GTGAAAGAAGTGAAGGTGGTGGG - Intronic
948080318 2:235200318-235200340 GTGACCCATGTGAAGGAGGTAGG + Intergenic
948405521 2:237715542-237715564 GTGTAGAATGTGAAGCTAGAAGG + Intronic
948478804 2:238238127-238238149 GTGAGCAGTGTGATGGTGGTGGG - Intergenic
948966310 2:241383410-241383432 GAGAACAGTGTTCAGGTGGATGG + Intronic
1170383014 20:15782623-15782645 TTGACCAATTTGAAGGTGAAAGG - Intronic
1170389719 20:15858898-15858920 TTGAACAATGTGAGGGTGAGTGG + Intronic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1171073262 20:22096377-22096399 GAGATCAATGTGAAGCTGCAAGG - Intergenic
1171154955 20:22863389-22863411 ATGAAGAATGTGAGGGTGGAAGG - Intergenic
1172035752 20:32009974-32009996 GTGAGAAATGAAAAGGTGGATGG - Intergenic
1172586631 20:36089893-36089915 GGGAACAAAGAGAAGGAGGAAGG - Intergenic
1179498100 21:41787505-41787527 AAGAACAATGAGAACGTGGATGG - Intergenic
1179506226 21:41843609-41843631 GTGAGCAATGTGAGGCTGCAGGG + Intronic
1180086148 21:45508841-45508863 GTGGACAGGGTGCAGGTGGATGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186226 21:46140714-46140736 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186245 21:46140814-46140836 GTGAGCAATGTGAAGGCTGACGG - Intronic
1180186253 21:46140864-46140886 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
949628720 3:5898269-5898291 GTGAAAAATATGGAGGGGGAAGG + Intergenic
950896100 3:16452392-16452414 ATCAACATTGTGAAGATGGAGGG - Intronic
951843573 3:27061459-27061481 AAGACCAATGTAAAGGTGGAGGG - Intergenic
953058146 3:39404791-39404813 GTGAACACTCAGAGGGTGGAGGG + Intergenic
953223651 3:40997711-40997733 GTAGACAATGTGAAGGCAGAGGG - Intergenic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
959392709 3:105796051-105796073 GTGAAGAATGTCATTGTGGAAGG - Intronic
960570665 3:119182256-119182278 GTGAACAGAGGGAAGGTGGAAGG + Intronic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
962255965 3:133870470-133870492 GTGAACAATGCAGAGGTGGTGGG + Intronic
962557307 3:136567063-136567085 GTTAACTATGTGTAGATGGATGG + Intronic
962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG + Intronic
963405218 3:144854568-144854590 GTGGACATTGTGTAGGTAGATGG - Intergenic
964394867 3:156234618-156234640 GTGAAGAATGGGAAGATGAAAGG + Intronic
964792035 3:160461365-160461387 TTGAACAATGTGGAGGTTGGGGG - Intronic
964893325 3:161562847-161562869 GTTAATAAAATGAAGGTGGATGG - Intergenic
966716915 3:183021959-183021981 GTGGACAGTAGGAAGGTGGATGG - Intronic
967340600 3:188392974-188392996 GGGTACAATGTAAAGGTGGAAGG - Intronic
967670781 3:192232704-192232726 GGGACCTATTTGAAGGTGGAGGG - Intronic
968693472 4:2008625-2008647 GTTAACAGTCTGAAGGGGGATGG + Intronic
969633856 4:8353826-8353848 ATGAACAAAGTCAAGGAGGAAGG + Intergenic
969914863 4:10480733-10480755 GTGAACACTGAGAAGCTTGAAGG - Intergenic
970554824 4:17220685-17220707 GGTAGCAATGTGAAGATGGAAGG + Intergenic
972592745 4:40503505-40503527 GTCAAAAAGGTGAAGGTGAAGGG + Intronic
974040444 4:56852714-56852736 GAGAAACATGTGAAGGAGGATGG + Intergenic
974098481 4:57391057-57391079 CTGAAAAATGTGCAGGTGAATGG - Intergenic
974277273 4:59739428-59739450 GTGGACTATTAGAAGGTGGAGGG - Intergenic
974294637 4:59981114-59981136 GTGAACCTTCTGAAGGTGAAGGG + Intergenic
975489238 4:74970366-74970388 GTGGACCATGTGAGGCTGGACGG + Intronic
977911417 4:102541601-102541623 GTGAACAATGGGAGGGTCTATGG + Intronic
978180250 4:105785952-105785974 ATGAACAATCTGAAAGTGAAAGG + Intronic
980478808 4:133357719-133357741 GGGAATATTGTGAAGGTAGATGG - Intergenic
981215352 4:142159273-142159295 GTGAAGAAGGTGAAGGTAAAAGG + Intronic
981398054 4:144277801-144277823 TGGAAGAATGTGGAGGTGGAGGG - Intergenic
985223417 4:187732342-187732364 TTGAACAACGTGAGGGTGAAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986519365 5:8597523-8597545 ATGAACATTGGGAAGGAGGATGG + Intergenic
987101805 5:14597745-14597767 GAGAACCATCTGGAGGTGGATGG - Intronic
987463453 5:18243845-18243867 GTGCACAGTGAGAAGGTGGTAGG - Intergenic
988329876 5:29822425-29822447 CTGAACAATGTAACGCTGGAGGG - Intergenic
988850191 5:35173101-35173123 GTGAACAATGTGGAGGCAAAGGG - Intronic
991153032 5:63394633-63394655 GAAAACAATGTGAAGGTGGTAGG + Intergenic
991607124 5:68413812-68413834 GTAAACAATCGGAAGGAGGAAGG + Intergenic
992626218 5:78637938-78637960 GTGAACAGTGTGAGGGAGGAAGG - Intronic
992966142 5:82002631-82002653 GGGTTCTATGTGAAGGTGGAGGG + Intronic
993534586 5:89066899-89066921 GTGAACAATGGGACAGTAGATGG - Intergenic
993845550 5:92938221-92938243 ATGAATAATGTCCAGGTGGAAGG - Intergenic
994157947 5:96524348-96524370 GTGAAGTATCTGAAAGTGGAAGG + Intergenic
994272569 5:97798268-97798290 GGGAACAATGCAAAGGGGGAGGG + Intergenic
995110105 5:108419317-108419339 GTGAATAATGGGAATGTTGAAGG - Intergenic
995362708 5:111316564-111316586 TTGAAGAATGTGAAGATGCACGG + Intronic
996922769 5:128788304-128788326 CTGAACAATGTGGAGGTTGGGGG + Intronic
1001383236 5:171317646-171317668 GGGATCAATGGGATGGTGGAAGG - Intergenic
1001690155 5:173626862-173626884 GAGGTCAATGTGAAGCTGGAAGG + Intergenic
1001925367 5:175632265-175632287 TTGAACAATGTGAAGGCTAAGGG + Intergenic
1002823072 6:746850-746872 TTGAACATTGTGTAGGTGGAGGG - Intergenic
1004049364 6:12060058-12060080 GTGAACAATATAAACGTGGTGGG - Intronic
1004210108 6:13631758-13631780 GTGTACCAGTTGAAGGTGGAGGG - Intronic
1004364087 6:14997505-14997527 AGGAATAATGTGAAGGTAGATGG + Intergenic
1005058828 6:21757400-21757422 GTGACCATTGTGAATGAGGATGG + Intergenic
1005675932 6:28154855-28154877 GTGTACAGTGGGGAGGTGGAAGG - Exonic
1006152669 6:31997720-31997742 AAGATCAATGTGAAGGTGGGAGG + Exonic
1006158977 6:32030457-32030479 AAGATCAATGTGAAGGTGGGAGG + Exonic
1006210516 6:32389781-32389803 GTAGAAAACGTGAAGGTGGATGG + Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006989683 6:38203743-38203765 GGGAAGGGTGTGAAGGTGGAAGG + Intronic
1008619637 6:53258943-53258965 GTGAAGGAAGTGAAGGGGGAAGG - Intergenic
1008849832 6:56011749-56011771 AGGAACATTGAGAAGGTGGAAGG + Intergenic
1010697707 6:78997518-78997540 GTGGACAAATTGAAGGTGTACGG - Exonic
1012108206 6:95193153-95193175 GTGAAAAGTGTGAATTTGGATGG - Intergenic
1012744425 6:103066514-103066536 AGATACAATGTGAAGGTGGATGG - Intergenic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1013843081 6:114421246-114421268 GAAATGAATGTGAAGGTGGAGGG + Intergenic
1014354550 6:120389608-120389630 GAGAACAATGTGAAACTGCATGG - Intergenic
1014505811 6:122253600-122253622 ATGAACAATGAGAATGTTGATGG - Intergenic
1015091503 6:129364234-129364256 GTAAACAAAGAGAAGGAGGACGG - Intronic
1015675793 6:135746955-135746977 ATGGAAAATATGAAGGTGGAGGG - Intergenic
1020468418 7:8507287-8507309 ATGAAGAATTTGAAGGTGAAGGG + Intronic
1022061141 7:26796887-26796909 ATGAACAATGTGAGGGTTTAGGG - Intronic
1026099569 7:67373299-67373321 GGGATCTATGTGAGGGTGGAGGG - Intergenic
1026332681 7:69366428-69366450 GAGAACAAATTGAAGGTTGATGG + Intergenic
1026378731 7:69777818-69777840 CTGAACAATGTGAGGTGGGAGGG + Intronic
1027927272 7:84482630-84482652 GGGAAAAATGTGAATGTGGTGGG - Intronic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1028540374 7:91936986-91937008 GCGAAGAAAGTGAAGGAGGAGGG - Intergenic
1028749097 7:94362272-94362294 GTGAACTTTGTGAAGGTGAGAGG + Intergenic
1030379430 7:108795388-108795410 CTGAACACTGTGGAGGTGCATGG + Intergenic
1031141667 7:117949536-117949558 ATGGACAATGTGAAGGGAGATGG + Intergenic
1032159668 7:129501015-129501037 GAGAAGAAAGTGCAGGTGGAGGG + Intergenic
1032491933 7:132330249-132330271 GGGAAGAAGGTGAAGCTGGAGGG + Intronic
1034944364 7:155252445-155252467 GTGAACAGTTTGTAGGAGGAGGG - Intergenic
1035247922 7:157576940-157576962 GTTAACACTGGGAAGGTGGGAGG - Intronic
1036794675 8:11746872-11746894 GTAAACAGTGTGCAGGTGTAAGG - Intronic
1040390758 8:46948869-46948891 GGGAAAAATGTGAAAGTTGAGGG - Intergenic
1040468546 8:47717230-47717252 GTGAAGAGAATGAAGGTGGAAGG - Intronic
1040954642 8:52967396-52967418 GGGACCTATGTGAAGGTGGAGGG - Intergenic
1043803562 8:84642953-84642975 GTGAACTATTTCCAGGTGGAGGG + Intronic
1045480840 8:102590923-102590945 GTCAAGACTGTGCAGGTGGAAGG - Intergenic
1046649685 8:116823854-116823876 CTGAAAAATGTGGAGGGGGATGG - Intronic
1046714910 8:117557005-117557027 GAGATCAATGTGAAGGAGGCAGG + Intergenic
1047006048 8:120621451-120621473 GTGAGAAATGGGAAAGTGGAGGG + Intronic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1047154736 8:122304079-122304101 GATAACAATGTTGAGGTGGATGG + Intergenic
1047469763 8:125158712-125158734 GTGAAAATTGTGAGGTTGGAAGG - Intronic
1047679859 8:127243478-127243500 GTGTAAAATGTCAAGCTGGAGGG - Intergenic
1049996747 9:1042311-1042333 GTCAATAATGTCAAGTTGGAAGG + Intergenic
1050444720 9:5707737-5707759 GGAAACAAGTTGAAGGTGGAAGG - Intronic
1050977294 9:11956332-11956354 ATGAACAATGGGAAGGGGCATGG + Intergenic
1051508117 9:17847333-17847355 TTGAACCAGGTGAAGGGGGAGGG - Intergenic
1051833660 9:21310236-21310258 GAGAATGATGTGAAGCTGGAAGG - Intergenic
1052034889 9:23669382-23669404 CTGAACACTGTGTAGGTGCAGGG + Intergenic
1052989768 9:34512358-34512380 GTCATCAAGCTGAAGGTGGAAGG + Exonic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1056060027 9:82875661-82875683 GTGAACAATGTCGGTGTGGAAGG + Intergenic
1056330495 9:85517249-85517271 GTAAACAATTTAGAGGTGGAGGG - Intergenic
1057000925 9:91508653-91508675 GTGCATACAGTGAAGGTGGATGG + Intergenic
1060678569 9:125540193-125540215 GTGAAAAATCAGAAGGTGGTAGG - Intronic
1060861658 9:126959966-126959988 GGGAAGAATGGGAAGGTAGAAGG + Intronic
1060987753 9:127829555-127829577 GTGAATAATGTCAAGATGAAAGG + Intronic
1061623647 9:131827728-131827750 GTGAAGAATGCGGGGGTGGAAGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1187943189 X:24401554-24401576 GTTAGAAATGTCAAGGTGGAAGG - Intergenic
1188058844 X:25575581-25575603 GTAAAGAAAGTGAAGGTTGAGGG + Intergenic
1189110874 X:38287149-38287171 GAGGAAAATGTGAAGGTGCATGG - Exonic
1189334131 X:40160080-40160102 GTCAACCATCTGATGGTGGAGGG - Intronic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1193300259 X:79881060-79881082 GTGAAGAAACTGAGGGTGGATGG + Intergenic
1195455516 X:105064820-105064842 TTGAAGGATGTGAAGGTGGAAGG + Intronic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1196501320 X:116386420-116386442 TTGAACAATGTGGAGGTTGTGGG + Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1198331007 X:135622362-135622384 CTGAACATTGTGCACGTGGAGGG + Intergenic
1198763998 X:140062627-140062649 CTGAAAAATGTAAAGGTTGAAGG - Intergenic
1201601215 Y:15730478-15730500 GAGAACACTGTGCAAGTGGAAGG - Intergenic
1201901247 Y:19047335-19047357 GTGACCAATGGGTGGGTGGATGG + Intergenic
1202014632 Y:20387725-20387747 GTGGACTACGTGAGGGTGGAGGG + Intergenic