ID: 1180186164

View in Genome Browser
Species Human (GRCh38)
Location 21:46140413-46140435
Sequence GTGAGCCACGCGAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 6, 2: 1, 3: 8, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180186164_1180186173 30 Left 1180186164 21:46140413-46140435 CCGTCCACCTTCGCGTGGCTCAC 0: 1
1: 6
2: 1
3: 8
4: 86
Right 1180186173 21:46140466-46140488 TCCACCTTCACATTGTTCGCAGG 0: 1
1: 1
2: 1
3: 3
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180186164 Original CRISPR GTGAGCCACGCGAAGGTGGA CGG (reversed) Intronic
902045865 1:13523936-13523958 TGTAGCCACGGGAAGGTGGAAGG + Intergenic
903450175 1:23448286-23448308 TTGAGCCACGCTTAGGTGGCAGG + Intronic
903910755 1:26723245-26723267 GTGAGCCACGTGCAGCTGGCAGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
906642526 1:47450006-47450028 GTGAGCGAAGCCAGGGTGGAGGG + Intergenic
907396407 1:54193415-54193437 GTGAGCCATGTGGAGATGGAGGG + Intronic
916056864 1:161074008-161074030 CTGAGCCTCACTAAGGTGGAAGG + Intronic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
1070723111 10:78770318-78770340 GAAAGCCACGAGAAGATGGAGGG - Intergenic
1072662591 10:97371805-97371827 GTGAGCCAGGCAAAGGAGCATGG + Intronic
1076065522 10:127444853-127444875 GGGAGCCACCAGAAGCTGGAGGG - Intronic
1076934101 10:133555958-133555980 GTGAGACCAGGGAAGGTGGATGG - Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1087071512 11:94086103-94086125 GTGAGTCCCTCGTAGGTGGATGG - Exonic
1089858844 11:121571233-121571255 GTGAACCAAGCAGAGGTGGAGGG + Intronic
1091237531 11:134032076-134032098 GTGAGCCATGCTTGGGTGGAAGG + Intergenic
1091594786 12:1870157-1870179 GTGAGTCACACAGAGGTGGAGGG - Intronic
1094816117 12:34186491-34186513 CTGAGCCAGTCGAATGTGGAAGG - Intergenic
1096473080 12:51890936-51890958 GGGTGCCCAGCGAAGGTGGATGG - Exonic
1097905534 12:64915389-64915411 GTTAGCCAGGTGAAGGAGGAGGG + Intergenic
1101787750 12:107900487-107900509 GAGAGCCACTCCAAGGTGGGAGG + Intergenic
1105020935 12:132816489-132816511 CTGAGCGACGCGGACGTGGAGGG + Intronic
1113035184 13:106040342-106040364 CTTAGCCACGTGAAGTTGGAGGG + Intergenic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1119685930 14:76631231-76631253 GGGAGCCACCCAAAGCTGGAAGG + Intergenic
1122407487 14:101509015-101509037 GTGACCCAGGCCAAGGTGGAGGG - Intergenic
1132327352 15:100982736-100982758 GTCAGCCTTGCGAAGGGGGAAGG - Intronic
1134183782 16:12067353-12067375 GTAAGCCAAGCAAAGATGGAGGG + Intronic
1135266503 16:21031175-21031197 GTGAGCCACGAGTGGATGGATGG - Exonic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1141514088 16:84531558-84531580 GTGAGCCACACCCAGCTGGAAGG + Intronic
1143538398 17:7555507-7555529 GTGAGCCATCGGAAGGAGGAAGG + Intronic
1144700147 17:17332277-17332299 GTGAGCCACGCGGAGCAGGAAGG + Intronic
1147977565 17:44256539-44256561 GGGAGCCAAGCCAAGGTGGCTGG + Intronic
1148360865 17:47010862-47010884 CTGAGCCTCGGGAAGGAGGAAGG - Intronic
1151327467 17:73388070-73388092 GTGGGCCAGGCCATGGTGGAGGG + Intronic
1152315185 17:79576088-79576110 ATGAGCCTCCAGAAGGTGGATGG + Intergenic
1158927189 18:62279696-62279718 GTGCGCCACGGGAAGAAGGAAGG - Intronic
1161241475 19:3225724-3225746 CTGATCCACGCGGAGGTGGTGGG - Intronic
1161362640 19:3859609-3859631 GTGAGCCACACCCAGGTGGAGGG + Intronic
1162067725 19:8136365-8136387 GTGAGCCGCGGCCAGGTGGAAGG - Intronic
1162948520 19:14057504-14057526 GTGAGCCCCGCGGAGGAGGGAGG - Intronic
1164698297 19:30263085-30263107 GTGAGCCCCGAGAAGGAGGTGGG + Intronic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1166348736 19:42183670-42183692 GGGAGCCAAGAGGAGGTGGATGG + Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
938128297 2:128690285-128690307 GTGAGCCACCGGAAGTAGGAGGG - Intergenic
943604528 2:189961275-189961297 GAGGGCCAGGAGAAGGTGGAGGG + Intronic
1173999285 20:47362600-47362622 GTGAGCCACAGGAGGGTGGAGGG - Intergenic
1175924983 20:62467131-62467153 GAGAGCCACGGGAAGGAGGGAGG - Intronic
1176305024 21:5118767-5118789 GTGGGCCACGAGCAGGAGGAAGG - Exonic
1179852031 21:44143263-44143285 GTGGGCCACGAGCAGGAGGAAGG + Exonic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180613749 22:17114267-17114289 GAGAGCCATGCAGAGGTGGAGGG - Exonic
1181430947 22:22881430-22881452 GTGAGCCAGGCCGAGGTGGCTGG - Intronic
1182774223 22:32819038-32819060 GTGAGCCAGAGGAAAGTGGAGGG + Intronic
1184315939 22:43689305-43689327 GTGAGCCACGCGAGGGAGAGTGG + Intronic
950464388 3:13144683-13144705 GGGAGCCACGTGATGGAGGAGGG - Intergenic
951219568 3:20055029-20055051 GTGAGCCAGGGGGAGGTGAAAGG + Intronic
952989669 3:38820862-38820884 GTGAGCCTGTCGGAGGTGGAAGG + Intergenic
954715289 3:52523807-52523829 GTGAGCCCGGGGAAGGTGGTGGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
955903066 3:63777816-63777838 GTCAGCCACGTGTAGGTGGGAGG + Intergenic
965317730 3:167211922-167211944 CTGAGCCAACCGGAGGTGGAAGG + Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
967248899 3:187516986-187517008 GTGACCCACGTGAAGGGAGAGGG - Intergenic
981153726 4:141409364-141409386 GTGAGGCAAGCAAAGGTGAAAGG + Intergenic
985511043 5:314065-314087 GCGAGCCACTGGAGGGTGGAGGG + Intronic
993336471 5:86665712-86665734 GTGAGCCATTAGAAGGTAGAAGG - Intergenic
996338284 5:122408470-122408492 GTGAGCCAGTGGAAGGTGCAAGG - Intronic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997903927 5:137795184-137795206 GTGAGGCAGGCTAAGTTGGATGG + Intergenic
1002574091 5:180161729-180161751 GTCAGCCACGCGCAGGAGGGAGG - Intronic
1005960271 6:30688754-30688776 GTGAGCCAGGCCCAGGTAGAGGG + Exonic
1007041506 6:38726621-38726643 GTGAGCAAAGCCATGGTGGAGGG + Intronic
1015286847 6:131495267-131495289 GTGATCCAAGGGAAAGTGGATGG - Intergenic
1016276518 6:142359499-142359521 GTGAGCCAAGTAAAGGAGGAAGG - Intronic
1018440291 6:163806196-163806218 GTAAGCCAGGCGCAGGTGCATGG + Intergenic
1020074858 7:5251172-5251194 TGGAGCCACGAGAAGCTGGAAGG - Intergenic
1022809882 7:33858471-33858493 GTGAGCTACCAGAAGCTGGAAGG + Intergenic
1026980899 7:74526095-74526117 GTGAGCCAGGCGGAGGTTGGGGG + Intronic
1027717086 7:81686235-81686257 GAGAGCCAAGCAAAGGGGGAAGG + Intergenic
1035642938 8:1197739-1197761 CTGAGCCACGCCAATGTTGAGGG + Intergenic
1037415012 8:18640518-18640540 GAGAGCCAAGTGAAGGTGAAGGG - Intronic
1045477773 8:102568005-102568027 GAGAGCCGTGCGAAGGTGGCAGG + Intergenic
1048502611 8:134992495-134992517 GAGATCCACACGAAGGTGCATGG - Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1059714471 9:116900777-116900799 GAGAACCAAACGAAGGTGGAGGG - Intronic
1190132901 X:47767865-47767887 GTGAACCACTAGAGGGTGGAGGG - Intergenic
1195113092 X:101666875-101666897 GTGAGCCAAGCAAAGATGGAAGG + Intergenic
1197048497 X:122029372-122029394 GAGAGCAACAGGAAGGTGGAGGG + Intergenic