ID: 1180186191

View in Genome Browser
Species Human (GRCh38)
Location 21:46140558-46140580
Sequence ACTCCCCGTCCACCTTCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 4, 1: 1, 2: 0, 3: 7, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180186179_1180186191 28 Left 1180186179 21:46140507-46140529 CCCTCCCCGTCCACCTTCGCATT 0: 2
1: 0
2: 0
3: 11
4: 208
Right 1180186191 21:46140558-46140580 ACTCCCCGTCCACCTTCACGTGG 0: 4
1: 1
2: 0
3: 7
4: 87
1180186182_1180186191 23 Left 1180186182 21:46140512-46140534 CCCGTCCACCTTCGCATTGCTCA 0: 2
1: 1
2: 2
3: 16
4: 99
Right 1180186191 21:46140558-46140580 ACTCCCCGTCCACCTTCACGTGG 0: 4
1: 1
2: 0
3: 7
4: 87
1180186180_1180186191 27 Left 1180186180 21:46140508-46140530 CCTCCCCGTCCACCTTCGCATTG 0: 2
1: 0
2: 0
3: 3
4: 88
Right 1180186191 21:46140558-46140580 ACTCCCCGTCCACCTTCACGTGG 0: 4
1: 1
2: 0
3: 7
4: 87
1180186185_1180186191 18 Left 1180186185 21:46140517-46140539 CCACCTTCGCATTGCTCAGAGGG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 1180186191 21:46140558-46140580 ACTCCCCGTCCACCTTCACGTGG 0: 4
1: 1
2: 0
3: 7
4: 87
1180186181_1180186191 24 Left 1180186181 21:46140511-46140533 CCCCGTCCACCTTCGCATTGCTC 0: 2
1: 1
2: 3
3: 14
4: 137
Right 1180186191 21:46140558-46140580 ACTCCCCGTCCACCTTCACGTGG 0: 4
1: 1
2: 0
3: 7
4: 87
1180186187_1180186191 15 Left 1180186187 21:46140520-46140542 CCTTCGCATTGCTCAGAGGGAGT 0: 2
1: 0
2: 2
3: 11
4: 77
Right 1180186191 21:46140558-46140580 ACTCCCCGTCCACCTTCACGTGG 0: 4
1: 1
2: 0
3: 7
4: 87
1180186183_1180186191 22 Left 1180186183 21:46140513-46140535 CCGTCCACCTTCGCATTGCTCAG 0: 2
1: 0
2: 1
3: 16
4: 179
Right 1180186191 21:46140558-46140580 ACTCCCCGTCCACCTTCACGTGG 0: 4
1: 1
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180186191 Original CRISPR ACTCCCCGTCCACCTTCACG TGG Intronic
900619438 1:3580209-3580231 ACTCCCTGCCCACCTTCCCCAGG - Intronic
900807825 1:4779417-4779439 GCTCCGCCTCCACCTTCACACGG + Intronic
902045867 1:13523941-13523963 AATTCCCTTCCACCTTCCCGTGG - Intergenic
902399212 1:16148702-16148724 CCTCCACGTTCAGCTTCACGTGG + Exonic
904317651 1:29676221-29676243 TCTCCCCCTTCACCTTCCCGAGG + Intergenic
910244494 1:85124006-85124028 ACTCCCCGACCCCATTCATGGGG + Intronic
911567076 1:99474824-99474846 ACTCCCTGTCCACCTTATAGGGG - Intergenic
916144388 1:161726554-161726576 GCTCCCCTTCCCCCTCCACGTGG + Intronic
917096534 1:171404194-171404216 ACTCCCCTGCCACCTTCACTGGG + Intergenic
922781578 1:228256901-228256923 GCTCTCCTTCCACCTGCACGTGG + Exonic
1072929906 10:99653126-99653148 ACTCCTAGTCCACATTCAAGGGG - Intergenic
1074037329 10:109753563-109753585 ACTCCCCTGCCACCTCCACTGGG - Intergenic
1075659500 10:124183548-124183570 ACTCCATGTCCTCCCTCACGTGG - Intergenic
1076184454 10:128435319-128435341 ACTCCGCCTCCATCTTCACAAGG - Intergenic
1076753639 10:132556362-132556384 CCTCTCCGTGCACCTCCACGGGG + Intronic
1083711272 11:64550487-64550509 ACTCACCCTCCACCCTCAAGTGG + Intergenic
1091280088 11:134376759-134376781 TCCCCCAGCCCACCTTCACGGGG - Intronic
1101583604 12:106065915-106065937 TCTCCCTGTCCACCCTCAAGAGG + Exonic
1103567687 12:121825058-121825080 ACTCCCATGCCACCTCCACGTGG - Intronic
1103907536 12:124335257-124335279 CCTCCCCGCCAAGCTTCACGGGG + Exonic
1104444630 12:128823464-128823486 GCTCACCGGCCACCTTCGCGGGG - Exonic
1104580317 12:130006743-130006765 TCTCCCCCTCCACCCTCAAGGGG - Intergenic
1106517034 13:30464981-30465003 ACTCCCCGTCTCCCTCCGCGCGG + Intronic
1118599897 14:67464619-67464641 ACTCTCCCTGCACCTTCACAGGG + Intronic
1122804730 14:104250603-104250625 CCTCCCCCTCCACCTTTACCAGG - Intergenic
1124155919 15:27225332-27225354 CCTCCCCGCCCCCCTCCACGTGG + Intronic
1126703189 15:51385481-51385503 CCCCCTCCTCCACCTTCACGAGG + Intronic
1128876169 15:71203144-71203166 TCTCCCTGCCCACCTTCACCTGG - Intronic
1130965796 15:88696546-88696568 CCTCTCCATCCACCTTCAGGAGG + Intergenic
1131022194 15:89108340-89108362 TCTCCACTTCCATCTTCACGTGG + Intronic
1131324843 15:91432240-91432262 ACTCCCCACCCACCTTCTCCAGG - Intergenic
1136146213 16:28317973-28317995 ACTCTCCATCCACCTTCCTGGGG - Intronic
1139275393 16:65723188-65723210 ACTCTCCCTCCACCCTCAAGTGG + Intergenic
1142848615 17:2693845-2693867 ACTCCCCATCCCCCAACACGAGG + Intronic
1147742971 17:42679199-42679221 ACACCCCCTCCACCGTCACCTGG - Exonic
1152375067 17:79914694-79914716 GCTCCCCGGCCAGCTGCACGGGG + Intergenic
1156466759 18:37352751-37352773 ATTCCCCATCCACCTCCAAGTGG - Intronic
1158866881 18:61646496-61646518 CTTCCCCCTCCACCTTCACTGGG - Intergenic
1160017762 18:75157552-75157574 TCTTCCCCTCCATCTTCACGTGG - Intergenic
1160030184 18:75250488-75250510 CCGCCCCGTCCACGTCCACGCGG - Intronic
1160673137 19:375754-375776 CCTCCCCGGCCACCTCCTCGGGG + Exonic
1161068877 19:2250767-2250789 GCTCCCCGTCCCTCTCCACGCGG - Intronic
1163790047 19:19301303-19301325 TCTCCCCGTCCCCATTCACTGGG + Intronic
1164504088 19:28843826-28843848 ACTCACAGTCCACCCTCACTTGG - Intergenic
1166960684 19:46494286-46494308 CCGCCTCTTCCACCTTCACGCGG + Exonic
1167674368 19:50875306-50875328 GCTCCCCACCCACCCTCACGGGG - Intronic
1168414749 19:56160820-56160842 CCTCCCCAACCAGCTTCACGGGG - Exonic
932347708 2:71006466-71006488 ACTCTCCATGCACCTTCAGGGGG + Intergenic
933051007 2:77602403-77602425 ACTCCCCATCCTCCTTCACAAGG + Intergenic
938969927 2:136422746-136422768 CCTCCCCTTCCACCTTCTCCAGG - Intergenic
946881292 2:224179713-224179735 AGTCCCCTTCCCCCTTCACTGGG - Intergenic
948614538 2:239190151-239190173 ACACACTGGCCACCTTCACGGGG + Intronic
1169339174 20:4783058-4783080 CCTCCCCATGCACCTTCACCAGG + Exonic
1172424984 20:34849955-34849977 ACTCACTGTCCACCTGCAGGAGG + Exonic
1176519017 21:7811245-7811267 CCTCCACCTCCATCTTCACGTGG - Intergenic
1178653045 21:34441258-34441280 CCTCCACCTCCATCTTCACGTGG - Intergenic
1180186150 21:46140358-46140380 CTCCCCCGTCCACCTTCACGTGG + Intronic
1180186161 21:46140408-46140430 ACTCCCCGTCCACCTTCGCGTGG + Intronic
1180186191 21:46140558-46140580 ACTCCCCGTCCACCTTCACGTGG + Intronic
1180186201 21:46140609-46140631 CTCCCCCGTCCACCTTCACGTGG + Intronic
1180186214 21:46140659-46140681 ACTCCCCGTCCACCTTCACGTGG + Intronic
1180186233 21:46140759-46140781 ACTCCCCGTCCACCTTCACGTGG + Intronic
1180186259 21:46140909-46140931 ACTCCCCGTCCACCTTCACGTGG + Intronic
1184065468 22:42116860-42116882 ACTCCCCTCCCACCTCCACCAGG - Intergenic
1184979279 22:48084676-48084698 ACTCCCCTTCTCCCTTCACAAGG + Intergenic
954213149 3:49109427-49109449 ACTCCCCTCCCACCTCCATGCGG - Intronic
961448301 3:126991335-126991357 ACTCCCCGGGCACCTTCTCCCGG - Intronic
963171192 3:142252686-142252708 ACTCCCCTGCCACCTCCACCAGG + Intergenic
966898729 3:184465192-184465214 AATCCCAGTCCTTCTTCACGTGG + Intronic
968503334 4:961099-961121 GCTCCCCGTCCACCTGCACCGGG + Exonic
986289169 5:6385076-6385098 TCTCCACCTCCAGCTTCACGCGG + Intergenic
986802513 5:11276815-11276837 TCTCCACCTCCATCTTCACGTGG - Intronic
990496595 5:56354194-56354216 ACTCCCCCTGCACCTCCAGGAGG + Intergenic
991543228 5:67752438-67752460 ACTTCCCTGCCACCTTCACCAGG + Intergenic
996694871 5:126383084-126383106 ACTCCCCGGCTACCTCCACTGGG - Intronic
997469867 5:134111404-134111426 ACTCCCCGGTCACCTCCAGGGGG + Intergenic
1000233267 5:159335038-159335060 ACTCCCCGCCCACCACCACTAGG + Intergenic
1002079165 5:176727484-176727506 ACTCCCCACTCCCCTTCACGAGG + Intergenic
1009810906 6:68665030-68665052 TCTCCCCTCCCACCTTCACCAGG + Intronic
1018367076 6:163131407-163131429 TCTCTGCGTCCATCTTCACGGGG - Intronic
1020375809 7:7484968-7484990 TCTCACCCTCCACCTTCAAGTGG - Intronic
1020468376 7:8506999-8507021 ACTCCCCTTTCATCTTCCCGGGG - Intronic
1033634960 7:143203812-143203834 AATCACCTTCCACCTTTACGTGG + Intergenic
1034467360 7:151237953-151237975 GCTCCACGGCCACCTTCTCGTGG - Exonic
1035367924 7:158360874-158360896 ACCCCGCGTCCACCCTCACCCGG + Intronic
1035367990 7:158361119-158361141 ACCCCGCGTCCACCCTCACCCGG + Intronic
1035368019 7:158361213-158361235 ACCCCGCGTCCACCCTCACCTGG + Intronic
1038145040 8:24887577-24887599 ACTCCCCAGCAACCTTCAAGTGG + Intergenic
1039884669 8:41648174-41648196 ACACCCGGCCCACCTTCACGGGG - Intronic
1039976290 8:42368255-42368277 ACTCAACTTCCACCTTCAAGTGG - Intronic
1059269022 9:113060808-113060830 ACTCCCCGCTCCCCTTCCCGGGG + Intergenic
1059270158 9:113066257-113066279 ACTCCCCGCTCCCCTTCCCGGGG + Intergenic
1059271294 9:113071707-113071729 ACTCCCCGCTCCCCTTCCCGGGG + Intergenic
1059272425 9:113077151-113077173 ACTCCCCGCTCCCCTTCCCGGGG + Intergenic
1059273560 9:113082593-113082615 ACTCCCCGCTCCCCTTCCCGGGG + Intergenic
1059274696 9:113088039-113088061 ACTCCCCGCTCCCCTTCCCGGGG + Intergenic
1061693681 9:132355200-132355222 TCTCCCCGTCCACCCTGACGGGG - Intergenic
1190431033 X:50378169-50378191 CCTCCCCATCCACCTGCACTGGG + Exonic
1196150718 X:112370299-112370321 ACTCCCAGTCCTCTTTCAGGAGG - Intergenic