ID: 1180186194

View in Genome Browser
Species Human (GRCh38)
Location 21:46140563-46140585
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 6, 1: 2, 2: 1, 3: 13, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180186194_1180186201 23 Left 1180186194 21:46140563-46140585 CCGTCCACCTTCACGTGGCTCAC 0: 6
1: 2
2: 1
3: 13
4: 189
Right 1180186201 21:46140609-46140631 CTCCCCCGTCCACCTTCACGTGG 0: 2
1: 0
2: 0
3: 12
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180186194 Original CRISPR GTGAGCCACGTGAAGGTGGA CGG (reversed) Intronic
900358965 1:2278846-2278868 GTGAGCCAGGTGGTGGTGGGGGG + Intronic
902045865 1:13523936-13523958 TGTAGCCACGGGAAGGTGGAAGG + Intergenic
902298897 1:15487390-15487412 GAGACCCGCGTGAAGATGGAGGG - Exonic
903910755 1:26723245-26723267 GTGAGCCACGTGCAGCTGGCAGG + Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
905805384 1:40873316-40873338 GTGGCCCTCTTGAAGGTGGAGGG + Intergenic
907396407 1:54193415-54193437 GTGAGCCATGTGGAGATGGAGGG + Intronic
909658938 1:78061294-78061316 GGAAGCCAATTGAAGGTGGACGG + Intronic
912458623 1:109816710-109816732 GTGAGCCACCTGCCTGTGGATGG + Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
921835921 1:219778612-219778634 GTTAGCCACTTGGAGCTGGAGGG + Intronic
923760912 1:236843260-236843282 GTGAGCCATGTGAAAATGTAGGG + Intronic
1070723111 10:78770318-78770340 GAAAGCCACGAGAAGATGGAGGG - Intergenic
1070735341 10:78860219-78860241 GTGAGACACCTCAAGGTGGTGGG - Intergenic
1070973160 10:80584250-80584272 GTGTGCCATTTGTAGGTGGATGG + Intronic
1071238790 10:83680815-83680837 GTGAGCCTTGTGAAGGTGCTTGG + Intergenic
1073048154 10:100652080-100652102 GTGAGACTGGTGAAGGTGGTGGG - Intergenic
1074497371 10:113991914-113991936 GTGAGCCAGGTGGAGGAGGGAGG + Intergenic
1074803673 10:117027006-117027028 CTGAGCCACCTGGAGCTGGAGGG - Intronic
1076065522 10:127444853-127444875 GGGAGCCACCAGAAGCTGGAGGG - Intronic
1076719775 10:132388007-132388029 GTGAGAAACGTGAATGTGGTTGG + Intergenic
1076934101 10:133555958-133555980 GTGAGACCAGGGAAGGTGGATGG - Intronic
1077366562 11:2163636-2163658 GGGAGCCACGTGACAGTGGGAGG - Intergenic
1077694953 11:4385501-4385523 TGGAGGCACCTGAAGGTGGAGGG + Exonic
1078437870 11:11340326-11340348 TTGAGCCACGTGTATGGGGATGG - Intronic
1080476382 11:32595791-32595813 GTGAGCCATGTGAAAGCAGATGG + Intronic
1080824281 11:35834865-35834887 GTGAGCAGGGGGAAGGTGGAGGG - Intergenic
1087512778 11:99119297-99119319 GTGGCCTACTTGAAGGTGGAGGG - Intronic
1087686504 11:101271886-101271908 GAGAGCCAAGTGAAGGTCCACGG + Intergenic
1088051238 11:105517851-105517873 GTTTGCCAGGTGAAGGGGGAAGG + Intergenic
1088329626 11:108637429-108637451 GTCAGCCACGTGAAGATCGGGGG + Intergenic
1089597378 11:119589368-119589390 GTGACCCACCTGAAGGCAGAAGG - Intergenic
1090118526 11:124000442-124000464 GGGAGGCACGTGGAGGTGAAGGG + Intergenic
1090771201 11:129921122-129921144 GTGAGCTCCCTGAAGTTGGAAGG + Intronic
1097464787 12:59908703-59908725 GAGACCCATGTGGAGGTGGAAGG + Intergenic
1097905534 12:64915389-64915411 GTTAGCCAGGTGAAGGAGGAGGG + Intergenic
1100678789 12:96896743-96896765 GTCAGCTATGTGAAGGTGGGAGG + Intergenic
1100838982 12:98593387-98593409 GAGAGACACCTGAAGGTGAAGGG + Intergenic
1101701058 12:107174399-107174421 GTGAACCACGTGAAATTGGTTGG - Intergenic
1104917696 12:132274362-132274384 GTGAGCCTCTTGAAGGGTGAGGG - Intronic
1105046017 12:133003824-133003846 GTGAACCACGTGGAGGTGCCTGG + Intronic
1108076650 13:46686850-46686872 GTGAGCCAAGTGCTGGTGAATGG - Intronic
1111030646 13:82592772-82592794 GTAAGCCACCTGAAGGTCCAAGG + Intergenic
1111426589 13:88092697-88092719 CTGAGCCACCTGAAGCTGGGGGG + Intergenic
1113035184 13:106040342-106040364 CTTAGCCACGTGAAGTTGGAGGG + Intergenic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1122068745 14:99191629-99191651 CCGAGCCTCGTGAAGGGGGAAGG + Intronic
1122407487 14:101509015-101509037 GTGACCCAGGCCAAGGTGGAGGG - Intergenic
1124113116 15:26811489-26811511 GGGACCTACCTGAAGGTGGAGGG + Intronic
1128517846 15:68354481-68354503 GTGAGCCATGTAAAGATGGTGGG - Intronic
1128647409 15:69387722-69387744 GTGAGGCCCGTGATGGAGGAAGG - Intronic
1129336011 15:74852646-74852668 GGGAGACACGTGAAGGCAGATGG + Intronic
1130603877 15:85297578-85297600 GTTAGCCAAGTTAAGGAGGATGG - Intergenic
1130809795 15:87364914-87364936 GTGAGCAATGTGAGGGTTGAGGG + Intergenic
1133898182 16:9949096-9949118 GGGAGCACCGTGGAGGTGGAGGG - Intronic
1135266503 16:21031175-21031197 GTGAGCCACGAGTGGATGGATGG - Exonic
1136485855 16:30571389-30571411 GTGAACCCGGTGAAGGAGGAGGG + Intronic
1138507234 16:57484462-57484484 GTGAGTCCCATCAAGGTGGATGG + Intronic
1143538398 17:7555507-7555529 GTGAGCCATCGGAAGGAGGAAGG + Intronic
1144686914 17:17232174-17232196 GTGAGCCAGGTGACGGTGTGTGG - Intronic
1144700147 17:17332277-17332299 GTGAGCCACGCGGAGCAGGAAGG + Intronic
1146522877 17:33539905-33539927 GTTAGCCAGGTGAAGGGGCAGGG + Intronic
1147634937 17:41958145-41958167 GTTAGCCAGGTGAAGGAGGTGGG - Intronic
1147854577 17:43469384-43469406 ATGAGTCACGTGAAGTTGAAGGG + Intergenic
1148360865 17:47010862-47010884 CTGAGCCTCGGGAAGGAGGAAGG - Intronic
1151589953 17:75036621-75036643 CTGAGCCCCGTGAAGGTGTTGGG - Intronic
1152315185 17:79576088-79576110 ATGAGCCTCCAGAAGGTGGATGG + Intergenic
1156572572 18:38275007-38275029 TGGAGCCATTTGAAGGTGGAGGG + Intergenic
1158866878 18:61646491-61646513 GCTAGCCCAGTGAAGGTGGAGGG + Intergenic
1158927189 18:62279696-62279718 GTGCGCCACGGGAAGAAGGAAGG - Intronic
1161362640 19:3859609-3859631 GTGAGCCACACCCAGGTGGAGGG + Intronic
1162067725 19:8136365-8136387 GTGAGCCGCGGCCAGGTGGAAGG - Intronic
1164698297 19:30263085-30263107 GTGAGCCCCGAGAAGGAGGTGGG + Intronic
1165793564 19:38506188-38506210 TTGAGCCAGGGGAGGGTGGAGGG + Intronic
1166348736 19:42183670-42183692 GGGAGCCAAGAGGAGGTGGATGG + Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
1166934083 19:46320620-46320642 GTGAGCCATGTTAAGGTGCTTGG - Intronic
1167472948 19:49685590-49685612 GTGAGCCGGGTGAAGCTGGGTGG + Intronic
1167716955 19:51148340-51148362 GGGGCCCACTTGAAGGTGGAGGG - Intronic
1167923724 19:52806281-52806303 GAGAGCCACTTGAATCTGGAAGG - Intronic
1167940084 19:52939741-52939763 GAGAATCACTTGAAGGTGGAAGG - Intronic
1168648511 19:58077374-58077396 GAAAACCACCTGAAGGTGGAGGG + Intronic
924995188 2:354197-354219 TTGATCCACGTCATGGTGGAGGG + Intergenic
925589853 2:5498662-5498684 GAGAGCCACGTCATGGTGGCAGG - Intergenic
926706882 2:15843459-15843481 GTGAGGCACGTGACCGAGGAAGG + Intergenic
929316489 2:40485164-40485186 GTCTGCGGCGTGAAGGTGGAGGG - Intronic
937315519 2:120929823-120929845 CTCAGCCACCTGCAGGTGGAGGG - Intronic
937417923 2:121731745-121731767 GTGAGCCAGGTGAAGGGGACAGG - Intronic
937926324 2:127170454-127170476 GTGAGCCAGGTGAAGGGGACAGG + Intergenic
938128297 2:128690285-128690307 GTGAGCCACCGGAAGTAGGAGGG - Intergenic
942159099 2:173163279-173163301 GGGATCTACTTGAAGGTGGAGGG - Intronic
943604528 2:189961275-189961297 GAGGGCCAGGAGAAGGTGGAGGG + Intronic
948080318 2:235200318-235200340 GTGACCCATGTGAAGGAGGTAGG + Intergenic
948904333 2:240971130-240971152 GTGAGGCACGTGGAGATGGGGGG - Intronic
1168845397 20:941090-941112 GTGAGCCACGTGAAGATCTGGGG + Intergenic
1169515288 20:6310356-6310378 GTGAGCCACGTGAAGATCTTGGG + Intergenic
1170666996 20:18394978-18395000 GGCAGCCACGTGAGGGTGCAGGG - Intronic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1173999285 20:47362600-47362622 GTGAGCCACAGGAGGGTGGAGGG - Intergenic
1175282354 20:57812465-57812487 GGGACCCACTTGAGGGTGGAGGG - Intergenic
1175924983 20:62467131-62467153 GAGAGCCACGGGAAGGAGGGAGG - Intronic
1176305024 21:5118767-5118789 GTGGGCCACGAGCAGGAGGAAGG - Exonic
1176375852 21:6086608-6086630 GTGGGCCACGTGTAGCTGGGAGG - Intergenic
1179747622 21:43451636-43451658 GTGGGCCACGTGTAGCTGGGAGG + Intergenic
1179852031 21:44143263-44143285 GTGGGCCACGAGCAGGAGGAAGG + Exonic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186226 21:46140714-46140736 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186245 21:46140814-46140836 GTGAGCAATGTGAAGGCTGACGG - Intronic
1180186253 21:46140864-46140886 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1182774223 22:32819038-32819060 GTGAGCCAGAGGAAAGTGGAGGG + Intronic
1183900278 22:41000414-41000436 GTGAGCCATGTGAATATGGGTGG - Intergenic
950464388 3:13144683-13144705 GGGAGCCACGTGATGGAGGAGGG - Intergenic
950667344 3:14505583-14505605 GGGAGCACCGTGAAGGAGGAGGG - Intronic
951088397 3:18542209-18542231 GTGAGCCATGTGCATATGGAGGG + Intergenic
951219568 3:20055029-20055051 GTGAGCCAGGGGGAGGTGAAAGG + Intronic
952441824 3:33338320-33338342 GAGAACCACTTGAAGGTGGGAGG + Intronic
952832350 3:37575728-37575750 GTGACCCACGTGAAAAAGGATGG + Intronic
953695333 3:45153801-45153823 GTGAGGCACATGTAGGTGAAAGG - Intergenic
953884778 3:46709020-46709042 GTGAGACACATGTGGGTGGATGG + Intronic
954715289 3:52523807-52523829 GTGAGCCCGGGGAAGGTGGTGGG + Intronic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
955903066 3:63777816-63777838 GTCAGCCACGTGTAGGTGGGAGG + Intergenic
957356545 3:79095061-79095083 GTGAGCCCTATGAAGGTTGAGGG - Intronic
960516723 3:118610054-118610076 GTGAGTCTCTTGAAGGTGGCAGG - Intergenic
962921853 3:139957535-139957557 ATGAGCTATGTGAAGGTGCAGGG + Intronic
964200281 3:154111456-154111478 CTGAGCCAGGTGAAGCTGAAAGG + Intergenic
965678152 3:171221380-171221402 GTTAGCCAAGTGAAGGGGTAGGG - Intronic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
966219497 3:177536220-177536242 GAGAGTCAAGTGAAGGTGGGAGG + Intergenic
967248899 3:187516986-187517008 GTGACCCACGTGAAGGGAGAGGG - Intergenic
968516129 4:1016358-1016380 GGGGGCCACGTGAAGCTGGGTGG + Intronic
970300142 4:14672574-14672596 AGGAGCCAAGTGATGGTGGAAGG - Intergenic
972142817 4:35982533-35982555 GAGAGGCAGGTGTAGGTGGATGG - Intronic
975286187 4:72623773-72623795 GGGACCTACTTGAAGGTGGAGGG - Intergenic
975650761 4:76590338-76590360 GTGAGCCGTCTGAAGGTGGCTGG + Intronic
976028299 4:80719130-80719152 GGGACCCACTTGAACGTGGAGGG + Intronic
981400794 4:144311877-144311899 GTGAGTCTCCTGAAGGTGGCAGG + Intergenic
984337152 4:178407578-178407600 GGGGCCCACTTGAAGGTGGAGGG + Intergenic
985511043 5:314065-314087 GCGAGCCACTGGAGGGTGGAGGG + Intronic
985684335 5:1273836-1273858 TTGTGCCACGTGACTGTGGATGG - Intronic
990410475 5:55535719-55535741 GTGAGGGAGGTGACGGTGGATGG - Intergenic
992847843 5:80771706-80771728 GTGAGCCACGTGATGGTATGTGG + Intronic
993336471 5:86665712-86665734 GTGAGCCATTAGAAGGTAGAAGG - Intergenic
996338284 5:122408470-122408492 GTGAGCCAGTGGAAGGTGCAAGG - Intronic
997030049 5:130117060-130117082 GTCACCCAGGTGAAGTTGGATGG + Intronic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
999054066 5:148554801-148554823 GGGACCTACGTGAGGGTGGAAGG - Intronic
999620438 5:153467338-153467360 GTGATCCAATTGAAGGGGGAGGG - Intergenic
1002175001 5:177396738-177396760 GTGACCCAGGTGAAGGGGGCAGG - Exonic
1002533563 5:179863812-179863834 GAGAGCCAGGTGGTGGTGGAGGG - Exonic
1004031469 6:11874231-11874253 GTGAGCCAGGTAAATGTGAAGGG + Intergenic
1004210108 6:13631758-13631780 GTGTACCAGTTGAAGGTGGAGGG - Intronic
1007494034 6:42246986-42247008 GTGAGCATCTTGAGGGTGGAGGG - Intronic
1011373280 6:86663628-86663650 GTGAGTCTCTTGAAGGTGGCAGG + Intergenic
1015286847 6:131495267-131495289 GTGATCCAAGGGAAAGTGGATGG - Intergenic
1015624442 6:135165810-135165832 GGGACCTACCTGAAGGTGGAGGG - Intergenic
1016276518 6:142359499-142359521 GTGAGCCAAGTAAAGGAGGAAGG - Intronic
1019137781 6:169922114-169922136 GAGAGCCCTGTGAAGGAGGAAGG + Intergenic
1020074858 7:5251172-5251194 TGGAGCCACGAGAAGCTGGAAGG - Intergenic
1020375807 7:7484963-7484985 GGGGCCCACTTGAAGGTGGAGGG + Intronic
1022809882 7:33858471-33858493 GTGAGCTACCAGAAGCTGGAAGG + Intergenic
1026394814 7:69940746-69940768 GTAATCCAGGTGAAGGAGGATGG + Intronic
1029041847 7:97584340-97584362 GTGATCCACTTGAACCTGGAAGG - Intergenic
1029270601 7:99374818-99374840 GGGAGCCACCTGGAGGTGGGGGG + Intronic
1032586984 7:133156011-133156033 GGGACCTACTTGAAGGTGGAGGG + Intergenic
1037316192 8:17601621-17601643 GGGGCCCACTTGAAGGTGGAGGG - Intronic
1037415012 8:18640518-18640540 GAGAGCCAAGTGAAGGTGAAGGG - Intronic
1040433319 8:47365225-47365247 TTGGACCACGTGAATGTGGAAGG - Intronic
1040954642 8:52967396-52967418 GGGACCTATGTGAAGGTGGAGGG - Intergenic
1041963456 8:63647184-63647206 GTAAGCAACGTGGAGGTGCAGGG + Intergenic
1042876080 8:73441017-73441039 GTGAGCCATGTGAACTGGGAGGG - Intronic
1043230882 8:77799739-77799761 GTGACCTACTTGAGGGTGGAGGG + Intergenic
1043738613 8:83777762-83777784 GTGACCTACTTGAGGGTGGAGGG + Intergenic
1044773957 8:95668341-95668363 GTGAGCCACGTGAATATTTAGGG - Intergenic
1047254838 8:123207149-123207171 CAGAGCCAGGTGAAGCTGGAGGG - Exonic
1051508117 9:17847333-17847355 TTGAACCAGGTGAAGGGGGAGGG - Intergenic
1057007445 9:91573122-91573144 GTGAGACAGGAGAAGGAGGAAGG + Intronic
1057731685 9:97614639-97614661 ATGCGCCATGTGAAGGTGCAGGG + Intronic
1057731939 9:97617204-97617226 ATGCGCCATGTGAAGGTGCAGGG + Intronic
1058481823 9:105403688-105403710 GAGACCCACCTGAAGGTGGGAGG + Intronic
1058875575 9:109241911-109241933 ATGAGCCATGTGAATGGGGATGG + Intronic
1061539051 9:131267693-131267715 GTGAGCCACTTGTAGGAGGTGGG - Intronic
1061611612 9:131750306-131750328 GTGAGCCTCGTGAGGTTGGTGGG - Intergenic
1061785205 9:133023647-133023669 GTGAGCTCCGTGAGGGCGGAGGG + Intergenic
1062096616 9:134707040-134707062 GTGAGCCACGTCAGGGAGGCTGG + Intronic
1186338427 X:8617427-8617449 CAGAGCCACGTGAAGGGGCAAGG + Intronic
1187771574 X:22704443-22704465 TTGAGCCACATGAAGGGGAATGG + Intergenic
1190132901 X:47767865-47767887 GTGAACCACTAGAGGGTGGAGGG - Intergenic
1191983303 X:66950077-66950099 GAGACCTACCTGAAGGTGGATGG + Intergenic
1192347509 X:70323147-70323169 ATGAGCCACATGAAGATAGAGGG - Intronic
1193263974 X:79445766-79445788 GGGACCTACTTGAAGGTGGAGGG + Intergenic
1195113092 X:101666875-101666897 GTGAGCCAAGCAAAGATGGAAGG + Intergenic
1197048497 X:122029372-122029394 GAGAGCAACAGGAAGGTGGAGGG + Intergenic
1198426899 X:136529639-136529661 GGGACCTACTTGAAGGTGGAAGG + Intergenic
1199676867 X:150196534-150196556 GTGAGGCACGTAATGGAGGAGGG - Intergenic
1200341051 X:155395989-155396011 GGGACCCACTTGAAAGTGGAGGG + Intergenic
1202014632 Y:20387725-20387747 GTGGACTACGTGAGGGTGGAGGG + Intergenic