ID: 1180186195

View in Genome Browser
Species Human (GRCh38)
Location 21:46140566-46140588
Sequence TCCACCTTCACGTGGCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 6, 1: 2, 2: 2, 3: 9, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180186187_1180186195 23 Left 1180186187 21:46140520-46140542 CCTTCGCATTGCTCAGAGGGAGT 0: 2
1: 0
2: 2
3: 11
4: 77
Right 1180186195 21:46140566-46140588 TCCACCTTCACGTGGCTCACAGG 0: 6
1: 2
2: 2
3: 9
4: 97
1180186183_1180186195 30 Left 1180186183 21:46140513-46140535 CCGTCCACCTTCGCATTGCTCAG 0: 2
1: 0
2: 1
3: 16
4: 179
Right 1180186195 21:46140566-46140588 TCCACCTTCACGTGGCTCACAGG 0: 6
1: 2
2: 2
3: 9
4: 97
1180186185_1180186195 26 Left 1180186185 21:46140517-46140539 CCACCTTCGCATTGCTCAGAGGG 0: 2
1: 0
2: 1
3: 11
4: 99
Right 1180186195 21:46140566-46140588 TCCACCTTCACGTGGCTCACAGG 0: 6
1: 2
2: 2
3: 9
4: 97
1180186190_1180186195 -10 Left 1180186190 21:46140553-46140575 CCAGCACTCCCCGTCCACCTTCA 0: 6
1: 2
2: 7
3: 19
4: 354
Right 1180186195 21:46140566-46140588 TCCACCTTCACGTGGCTCACAGG 0: 6
1: 2
2: 2
3: 9
4: 97
1180186188_1180186195 -5 Left 1180186188 21:46140548-46140570 CCAACCCAGCACTCCCCGTCCAC 0: 4
1: 4
2: 4
3: 40
4: 380
Right 1180186195 21:46140566-46140588 TCCACCTTCACGTGGCTCACAGG 0: 6
1: 2
2: 2
3: 9
4: 97
1180186189_1180186195 -9 Left 1180186189 21:46140552-46140574 CCCAGCACTCCCCGTCCACCTTC 0: 4
1: 3
2: 1
3: 33
4: 343
Right 1180186195 21:46140566-46140588 TCCACCTTCACGTGGCTCACAGG 0: 6
1: 2
2: 2
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180186195 Original CRISPR TCCACCTTCACGTGGCTCAC AGG Intronic
900358961 1:2278843-2278865 CCCACCACCACCTGGCTCACAGG - Intronic
901035170 1:6331981-6332003 TCCATCTTCCCGTGGCCCCCCGG - Intronic
902230802 1:15026213-15026235 TCCAGCTCCCCGTGGCTCCCAGG - Intronic
903929864 1:26855966-26855988 TCCACCTTCCCCTGCCTCAGGGG + Exonic
915163689 1:153936484-153936506 TCCAGCTGCACAAGGCTCACTGG + Intronic
920329510 1:205195792-205195814 TCCCATTTCACGTGGCTCCCAGG - Intronic
1064423097 10:15207027-15207049 TGCACCTTCACAGAGCTCACTGG + Intergenic
1067552250 10:47244255-47244277 TCCTCCTTCAGGTGTCACACTGG - Intergenic
1067977531 10:51042888-51042910 TGCACCTTCACGTGGCAGAAGGG - Intronic
1068724395 10:60284885-60284907 TGACCCTTCACATGGCTCACAGG - Intronic
1075389840 10:122084245-122084267 TCCACCATCAGGTGGCTCTGGGG - Exonic
1076348732 10:129800045-129800067 ACCACATCCACATGGCTCACAGG - Intergenic
1083242470 11:61399146-61399168 TCCAGTTTCACATGGCCCACTGG - Intergenic
1084579716 11:70015602-70015624 ACCACTTCCACGTGGCTCACTGG + Intergenic
1095977937 12:47952428-47952450 CCCATGTTCACCTGGCTCACAGG - Intergenic
1096231260 12:49898090-49898112 TCCTCCTCCACGTGCCACACAGG - Exonic
1096510500 12:52125348-52125370 GCCACCTTCACGTGGCAGCCGGG + Intergenic
1098162333 12:67657548-67657570 CCCACGATCACGTGGCTTACAGG + Exonic
1098280270 12:68855335-68855357 TCCACCTGGATGTGACTCACAGG - Exonic
1113035182 13:106040339-106040361 TCCAACTTCACGTGGCTAAGTGG - Intergenic
1113607363 13:111619881-111619903 TCGACCTTCCCTTGGCTCTCTGG + Intronic
1120281186 14:82439978-82440000 TCCTCATTCACTTGGCTCAGAGG + Intergenic
1121844362 14:97159976-97159998 TCCACCTTCCCGAGGAACACAGG + Intergenic
1124113114 15:26811486-26811508 TCCACCTTCAGGTAGGTCCCCGG - Intronic
1129268024 15:74404449-74404471 TCCACTTTCACCTGCCCCACTGG + Intergenic
1133557834 16:6922644-6922666 TCCACCCTCACCTGGCTTACAGG - Intronic
1133758239 16:8778348-8778370 TCCACCTTCTCGTGGCTGCCGGG + Intronic
1136035966 16:27540639-27540661 TCTACCTTCAAGGAGCTCACAGG + Intronic
1136454564 16:30372920-30372942 TCCACCTGCACCTGACTCCCTGG + Intronic
1136485853 16:30571386-30571408 TCCTCCTTCACCGGGTTCACAGG - Intronic
1137566511 16:49536271-49536293 TCCACCTTGACCTGGGTCACTGG + Intronic
1138293830 16:55870151-55870173 TCCATCTTCCCGTGGGTCACAGG - Intronic
1138461326 16:57149620-57149642 TTCGCCTTCACGTGGCCCAGTGG - Intergenic
1142505439 17:360626-360648 TCCTCTTTCACCTGGCCCACGGG - Intronic
1144100939 17:11941920-11941942 TTCAGCTTCACATGGCCCACAGG + Intronic
1144700146 17:17332274-17332296 TCCTGCTCCGCGTGGCTCACAGG - Intronic
1146382747 17:32343064-32343086 TCCTCCTTCACGTGGCGCTATGG - Intronic
1150628163 17:66857140-66857162 TCCTCCTCCCCGTGGCTCAAGGG + Intronic
1151589955 17:75036624-75036646 AACACCTTCACGGGGCTCAGCGG + Intronic
1157258213 18:46157002-46157024 TACACCTCCACTTGGCTCACTGG - Intergenic
1161408642 19:4103892-4103914 TCCACCTGGCCCTGGCTCACTGG - Intronic
1166111829 19:40627323-40627345 TCCACCTTCAGGAGGCTCCTCGG - Exonic
929210414 2:39350854-39350876 TCCAACTACACGTGGCCCTCTGG + Intronic
934078446 2:88447918-88447940 CCCGCCCTCACGGGGCTCACAGG + Exonic
935744710 2:106180236-106180258 TTCACCTTCCCGTGGGTTACTGG - Intronic
937897636 2:126990585-126990607 TCCACCTTCACCTGGCACCAAGG - Intergenic
941872022 2:170395836-170395858 TCCCCCTTGGCCTGGCTCACAGG - Intronic
943631538 2:190258191-190258213 TGCATCTTCACGTGGCTGGCAGG - Intronic
1174533108 20:51230295-51230317 TCCAGCTTCTGGTGGCTCCCGGG + Intergenic
1175401375 20:58701514-58701536 GACAGCTTCACGTGGCTCCCTGG + Intronic
1175525189 20:59628928-59628950 TCCACCTTTCCATGGTTCACTGG + Intronic
1180186113 21:46140165-46140187 TCCACCTTCACATTGCTCACAGG + Intronic
1180186123 21:46140215-46140237 TCCACCTTCACGTGCCTCACAGG + Intronic
1180186132 21:46140265-46140287 TCCACCTTCACATTGTTCACAGG + Intronic
1180186143 21:46140315-46140337 TCCACCTTCGCATTGCTCAGAGG + Intronic
1180186155 21:46140366-46140388 TCCACCTTCACGTGGCTCACAGG + Intronic
1180186165 21:46140416-46140438 TCCACCTTCGCGTGGCTCACAGG + Intronic
1180186173 21:46140466-46140488 TCCACCTTCACATTGTTCGCAGG + Intronic
1180186184 21:46140516-46140538 TCCACCTTCGCATTGCTCAGAGG + Intronic
1180186195 21:46140566-46140588 TCCACCTTCACGTGGCTCACAGG + Intronic
1180186206 21:46140617-46140639 TCCACCTTCACGTGGCTCACAGG + Intronic
1180186218 21:46140667-46140689 TCCACCTTCACGTGGCTCACAGG + Intronic
1180186227 21:46140717-46140739 TCTGCCTTCACATTGCTCACAGG + Intronic
1180186237 21:46140767-46140789 TCCACCTTCACGTGGCTCACAGG + Intronic
1180186246 21:46140817-46140839 TCAGCCTTCACATTGCTCACAGG + Intronic
1180186254 21:46140867-46140889 TCTGCCTTCACATTGCTCACAGG + Intronic
1180186263 21:46140917-46140939 TCCACCTTCACGTGGCTCACAGG + Intronic
1181287526 22:21764941-21764963 TCTACCTTCACCCGCCTCACAGG + Intronic
1181508413 22:23377417-23377439 TCCATCTTCCTGTGGGTCACAGG - Intergenic
1185135414 22:49068818-49068840 TCCACCTTCATGAGGCTCACAGG - Intergenic
949455361 3:4232435-4232457 GCCTCCTTCTCTTGGCTCACAGG - Intronic
954715287 3:52523804-52523826 ACCACCTTCCCCGGGCTCACAGG - Intronic
957356547 3:79095064-79095086 TCAACCTTCATAGGGCTCACAGG + Intronic
960155401 3:114293037-114293059 TCCACATTCACCTGCCTCGCAGG - Intronic
962978491 3:140466904-140466926 TCCACCTTCACCTGGCTATAAGG - Intronic
963970346 3:151422411-151422433 TCCAGCTTCTGGTGGCTCGCTGG + Intronic
966876910 3:184327609-184327631 GCCGCCTTCAGGGGGCTCACTGG - Exonic
969468474 4:7371722-7371744 CCCGCCTCCACGTGGCTCCCGGG - Intronic
977501649 4:97847453-97847475 TCCATCTTCTCCTGGCACACTGG + Intronic
980184236 4:129441753-129441775 ACCACCTGCACGTTTCTCACTGG + Intergenic
981623478 4:146730639-146730661 TCTTCCTTCACATGGCTTACAGG - Intronic
985701262 5:1374468-1374490 TACACCTTCCAGGGGCTCACAGG - Intergenic
987789894 5:22551464-22551486 CCAACCTTCACATGGCCCACAGG + Intronic
991562030 5:67964063-67964085 GCCACCCTCACATGGCTAACAGG - Intergenic
993091542 5:83432814-83432836 TCCAGCTTCAGGTGGCTCCAAGG - Intergenic
996013714 5:118507973-118507995 TCCACCTTCACATGGCTTCAAGG + Intergenic
999894839 5:156020687-156020709 TCTACCTTCAAGAAGCTCACAGG - Intronic
1000255455 5:159534206-159534228 CCCATGATCACGTGGCTCACTGG - Intergenic
1002175002 5:177396741-177396763 GCCCCCTTCACCTGGGTCACAGG + Exonic
1002530380 5:179841020-179841042 TCCACGATCACATGGCCCACAGG + Intronic
1005945290 6:30590809-30590831 TCCACCTTCATGTGCCTGAATGG - Exonic
1015612999 6:135045757-135045779 TCAACCTCCACTTGGCTCCCAGG - Intronic
1022611506 7:31879077-31879099 TCCACCTTCACGCGGCAGATGGG - Exonic
1034551009 7:151820666-151820688 TCCAACTTCACGTCTCCCACAGG + Intronic
1034775371 7:153822013-153822035 TCCCTCTCCATGTGGCTCACGGG + Intergenic
1037025220 8:14027630-14027652 TCCACCCTTACGTGGCTTAGTGG + Intergenic
1037630791 8:20653775-20653797 GACTCCTTCACGTGGCTCCCCGG - Intergenic
1038513895 8:28167416-28167438 TCGACCTTCACCTGTCTCTCAGG + Intronic
1039881912 8:41630470-41630492 TCCATCTGCACGGGGCCCACTGG - Intergenic
1040954645 8:52967399-52967421 TCCACCTTCACATAGGTCCCGGG + Intergenic
1041061766 8:54041555-54041577 TTCACCATCACGTGTCTCAGTGG + Intergenic
1043862266 8:85333603-85333625 TTTAGCTTCACGTAGCTCACTGG - Exonic
1047254840 8:123207152-123207174 TCCAGCTTCACCTGGCTCTGCGG + Exonic
1048941739 8:139405898-139405920 TCCACCTTCATGGTTCTCACCGG + Intergenic
1051765323 9:20516171-20516193 TCCTCCTTCATGTGGGTCACAGG - Intronic
1055101488 9:72470293-72470315 TCCACCTCCATGTGACTCAGTGG - Intergenic
1059456622 9:114403876-114403898 TCCTCCTCCTCCTGGCTCACCGG + Exonic
1060562956 9:124562034-124562056 TCCACCTTCAGTTGTCTAACTGG - Intronic
1060777021 9:126382251-126382273 TCGACCATCATGTGGCTCTCTGG + Intronic
1062096615 9:134707037-134707059 GCCTCCCTGACGTGGCTCACTGG - Intronic
1189972292 X:46430486-46430508 TCCACCTTCTGGTGGCTCTGAGG - Intergenic
1191958022 X:66667336-66667358 AACACCTTCACTTGGCTCAAGGG + Intergenic
1196789048 X:119447719-119447741 ACCACCTTCACTTGGCTTCCTGG + Intronic
1200145541 X:153924555-153924577 CCCGCCCTCACATGGCTCACGGG - Intronic
1201264791 Y:12195132-12195154 TCCACATCCACGTGGACCACTGG - Intergenic
1202014630 Y:20387722-20387744 TCCACCCTCACGTAGTCCACAGG - Intergenic