ID: 1180186226

View in Genome Browser
Species Human (GRCh38)
Location 21:46140714-46140736
Sequence GTGAGCAATGTGAAGGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 2, 1: 1, 2: 3, 3: 31, 4: 321}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180186226_1180186233 22 Left 1180186226 21:46140714-46140736 CCGTCTGCCTTCACATTGCTCAC 0: 2
1: 1
2: 3
3: 31
4: 321
Right 1180186233 21:46140759-46140781 ACTCCCCGTCCACCTTCACGTGG 0: 4
1: 1
2: 0
3: 7
4: 87
1180186226_1180186237 30 Left 1180186226 21:46140714-46140736 CCGTCTGCCTTCACATTGCTCAC 0: 2
1: 1
2: 3
3: 31
4: 321
Right 1180186237 21:46140767-46140789 TCCACCTTCACGTGGCTCACAGG 0: 6
1: 2
2: 2
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180186226 Original CRISPR GTGAGCAATGTGAAGGCAGA CGG (reversed) Intronic
901283326 1:8056835-8056857 GTGAACAATGAGAAGACACAGGG + Intergenic
901858542 1:12059595-12059617 GTGAGGAAGGTGAATGCAGTAGG - Intergenic
903912069 1:26734898-26734920 GAGAGCAATGTGAAATCTGAGGG - Intronic
904484175 1:30814051-30814073 GTAAGCAATGTGCAGGAAGCAGG - Intergenic
904535964 1:31199572-31199594 GTGAGCAAACTGACAGCAGAGGG + Intronic
906812439 1:48842178-48842200 GTGAGGAAAGTGCAGGCTGATGG - Intronic
907609084 1:55849791-55849813 GAGAGACATGAGAAGGCAGAAGG + Intergenic
908859760 1:68470881-68470903 CTGAGCAATCAGAAGACAGATGG + Intergenic
909883856 1:80915269-80915291 GTGAGCAAAATGGAGGAAGAAGG - Intergenic
910081599 1:83348335-83348357 GTGAGCAACATGGAGGCAAATGG + Intergenic
911117890 1:94265257-94265279 GTCAGCAATGCCAAGGCAGAAGG - Intronic
911328531 1:96498310-96498332 GGGATCCATCTGAAGGCAGAGGG - Intergenic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
914755773 1:150560966-150560988 CTCAGCAGTGTGAAGGCAGAAGG + Intergenic
915986385 1:160469552-160469574 CTGAGCCATCTGAAGGCTGAAGG - Intergenic
916186751 1:162140443-162140465 TGAAGCAATGTGAATGCAGATGG - Intronic
917023840 1:170619810-170619832 GTGAGCATGCTGGAGGCAGAAGG - Intergenic
917105864 1:171491275-171491297 GTGAACAATCTGAAGGTACAGGG + Intronic
917245843 1:172999328-172999350 GGGAGCTGTGTGAAGCCAGAGGG + Intergenic
918626024 1:186656683-186656705 CTGAGCAAGGTGAATGCAGTTGG - Intergenic
919934800 1:202244560-202244582 GAAAGCTACGTGAAGGCAGAAGG - Intronic
920846710 1:209599420-209599442 CATAGCAATGAGAAGGCAGATGG - Intronic
922170546 1:223150775-223150797 GGGAGGCATGTGATGGCAGAGGG + Intergenic
922953522 1:229579407-229579429 GTGAACAATGAGAGGACAGAAGG - Intergenic
923063160 1:230495498-230495520 GTGGGGAATGTGTGGGCAGAGGG + Intergenic
1062978634 10:1703412-1703434 GTGAGCAGTGAGGAGGCTGAGGG + Intronic
1064898737 10:20270225-20270247 AGGAGCCATGTGAAGGAAGAGGG + Intronic
1065259563 10:23910639-23910661 GTGATGAATGTCAAGGAAGATGG + Intronic
1065525192 10:26613072-26613094 ATGAGCAATCTGATGGAAGAAGG + Intergenic
1067974671 10:51010982-51011004 GTGAGAGATTTGAAGGCACAGGG + Intronic
1069597752 10:69683461-69683483 GTGAGCAAAGGCAAGGAAGAGGG + Intergenic
1071166646 10:82815709-82815731 GTGAGCAATACTTAGGCAGAAGG - Intronic
1072430023 10:95362659-95362681 GTGAGCAATGATAAGGCGGGAGG - Intronic
1074676799 10:115860346-115860368 GTGAGCAAAGGGAAGGCAGATGG - Intronic
1074869547 10:117565993-117566015 GTGAGAAATCTGAAGGCCGGGGG - Intergenic
1076310739 10:129505858-129505880 GAGAGCAGTGTGAAGCCTGAGGG + Intronic
1076618455 10:131771860-131771882 GTGAGCACTGAGGAGGCAGCAGG - Intergenic
1080476382 11:32595791-32595813 GTGAGCCATGTGAAAGCAGATGG + Intronic
1081999164 11:47383561-47383583 GAGAGCAGGGCGAAGGCAGATGG + Intergenic
1083968880 11:66060160-66060182 GCTGGCAAAGTGAAGGCAGAGGG - Intronic
1084062485 11:66685473-66685495 GTGAGGAACCAGAAGGCAGAAGG + Exonic
1084102196 11:66957181-66957203 GGGAGCAATAGGGAGGCAGATGG + Intronic
1084511392 11:69606593-69606615 CAGAGCACTGTGAACGCAGAAGG + Intergenic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085270180 11:75265607-75265629 GGGAGGAGGGTGAAGGCAGAAGG + Exonic
1086052212 11:82606575-82606597 GTGAGCTCTGGGAAGGCAGAGGG + Intergenic
1088328688 11:108628369-108628391 GTGAGCAATACTCAGGCAGAAGG - Intergenic
1089597378 11:119589368-119589390 GTGACCCACCTGAAGGCAGAAGG - Intergenic
1090490598 11:127157338-127157360 GTCAGCCAGGAGAAGGCAGAAGG + Intergenic
1090537272 11:127657164-127657186 GTGTGCTATGTGAAGACAGTAGG + Intergenic
1090954337 11:131501252-131501274 GTGAAGAATGTAAAGGCAGGAGG + Intronic
1090963714 11:131580137-131580159 GTTAGCAAAATGAAGACAGATGG - Intronic
1091166469 11:133480464-133480486 GCGAGCAAGTGGAAGGCAGAAGG - Intronic
1092048314 12:5449152-5449174 GTAAGCAATTTGAAGGGATAGGG + Intronic
1095353771 12:41245965-41245987 GTTTGCAATGTGGAGGCATATGG + Intronic
1096773160 12:53949362-53949384 GTGAGCAATGTGGGGACAGTAGG + Intergenic
1097183346 12:57183511-57183533 GTGAGCCATTTGGTGGCAGAGGG + Intronic
1097637778 12:62143575-62143597 GTGATCTATGTGAAGGTAGCTGG + Intronic
1097931528 12:65192441-65192463 GTGCACAATGGGAAGGAAGACGG - Intronic
1098053941 12:66483812-66483834 GTGAGCAATGTAAAGGAGTAGGG - Intronic
1098172489 12:67760842-67760864 GTGAGTAGGGTGAAGGGAGATGG + Intergenic
1099993600 12:89753037-89753059 GGGAGCAACATCAAGGCAGAGGG - Intergenic
1101532585 12:105587462-105587484 GTGAGAAATGTGAAGGGACTTGG - Intergenic
1102026820 12:109718400-109718422 GTGAGGGATGGGAAGGCAGAGGG - Intronic
1102329908 12:112020129-112020151 GGGTGGAATGTGAAGGAAGAGGG - Intronic
1102704694 12:114870828-114870850 CTGAGCAATGGGAAGACAGGAGG - Intergenic
1104855691 12:131901539-131901561 GTGAAGAATGAGAAAGCAGAGGG - Intronic
1104955928 12:132465817-132465839 ATGTGCAGGGTGAAGGCAGACGG + Intergenic
1106184441 13:27396677-27396699 GTAAGCATGGTGAAGGCAAAGGG + Intergenic
1106255579 13:28019607-28019629 GTGGGCAAAGTGCAGGTAGATGG - Intronic
1107962949 13:45575234-45575256 GTAAGGAATGCGCAGGCAGAAGG + Intronic
1108249744 13:48552085-48552107 GTGAGCAATACTCAGGCAGAAGG + Intergenic
1108673396 13:52714284-52714306 GTAAGCAATGTGGAGGCAGGTGG - Intronic
1109535657 13:63714862-63714884 GAGAGCAATGTGGAAGGAGAAGG + Intergenic
1111598524 13:90441998-90442020 GTGAGAAGTGTGAAAGGAGAAGG - Intergenic
1111689636 13:91546975-91546997 TTTAGCAATGAGAAGGTAGATGG + Intronic
1113000948 13:105636043-105636065 GTCAGCAGTGTGCAGCCAGAAGG + Intergenic
1114312819 14:21483432-21483454 GTGAGCATTTTTAAGGTAGAAGG - Intronic
1115139624 14:30155418-30155440 GTGAGAAGTGTGTAAGCAGAGGG - Intronic
1116342452 14:43741664-43741686 ATGAGCAAGGTTAAGGCAGAAGG - Intergenic
1117154320 14:52922806-52922828 GTGAGCCATAAAAAGGCAGAAGG - Intronic
1118056049 14:62080945-62080967 GTGACCATTGTGAGGGCACAGGG + Exonic
1118681174 14:68243172-68243194 ATGAGCAATCTGAAGGCAACGGG - Intronic
1118713022 14:68538225-68538247 GTGAGCAACATTAAGCCAGAGGG + Intronic
1118770002 14:68936409-68936431 GAGAGAAATGGGAAGGCAGGGGG + Intronic
1118926436 14:70194192-70194214 TTGAACAATGAGAAGGCATAGGG - Intergenic
1119214952 14:72862308-72862330 GTGAGGACTGTGAGGGCAGCAGG - Intronic
1119499033 14:75107144-75107166 GTGAGCAAGGAGAAGACAGGTGG - Intronic
1121779691 14:96614290-96614312 GTGAGCAATTTTAAGGCTAATGG + Intergenic
1121956638 14:98219436-98219458 GTGACCAAACTTAAGGCAGAAGG - Intergenic
1122309789 14:100787310-100787332 GTGATAAATGAGAAGTCAGATGG - Intergenic
1122564694 14:102644532-102644554 GGGAGCGATGTGATGGGAGAGGG - Intronic
1124800954 15:32832475-32832497 GTGAGTATTTTCAAGGCAGAGGG + Intronic
1124956183 15:34362108-34362130 GGGAGAAATGAGAAGGAAGAAGG - Intronic
1125546199 15:40507358-40507380 GTGAGCAATGGGAAGCCAGGGGG + Intergenic
1126545320 15:49866771-49866793 GTGAGAAATATGAAAGCACAAGG + Intronic
1126935950 15:53708019-53708041 ATGTGGAAGGTGAAGGCAGAGGG - Intronic
1129336011 15:74852646-74852668 GGGAGACACGTGAAGGCAGATGG + Intronic
1130546169 15:84858556-84858578 GTGAGCAGTGGGGAGGGAGAGGG + Intronic
1130652469 15:85769864-85769886 GTGAGCCCTGAGAGGGCAGATGG - Intronic
1130808858 15:87355589-87355611 TTGAGCACTGTGATGTCAGAAGG - Intergenic
1130809795 15:87364914-87364936 GTGAGCAATGTGAGGGTTGAGGG + Intergenic
1130938594 15:88489859-88489881 GTGGGCACTGTGAAGGGAGCTGG - Intergenic
1131840060 15:96427667-96427689 ATGGGCCATGTGAAGGCAGAGGG + Intergenic
1132084861 15:98899881-98899903 GTGACCAGTGAGACGGCAGACGG + Intronic
1132102939 15:99039928-99039950 CTTACCGATGTGAAGGCAGATGG + Intergenic
1132213190 15:100041566-100041588 GTTAGCAAGGTGAAGGCTGCTGG + Intronic
1132868160 16:2104011-2104033 GAGAGCGAGGTGCAGGCAGAAGG + Intronic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1134523614 16:14929113-14929135 GAGAGCGAGGTGCAGGCAGAAGG - Intronic
1134711206 16:16327598-16327620 GAGAGCGAGGTGCAGGCAGAAGG - Intergenic
1134719060 16:16370900-16370922 GAGAGCGAGGTGCAGGCAGAAGG - Intergenic
1134948368 16:18340985-18341007 GAGAGCGAGGTGCAGGCAGAAGG + Intergenic
1134955623 16:18381095-18381117 GAGAGCGAGGTGCAGGCAGAAGG + Intergenic
1135947176 16:26875415-26875437 GTGAGCATTGCCAAGGAAGAAGG - Intergenic
1137241514 16:46658834-46658856 GCTAGCAATGGGAGGGCAGATGG + Exonic
1138774269 16:59702674-59702696 ATGAGAAATGTCAAAGCAGATGG + Intergenic
1139353446 16:66352472-66352494 GTAAGTAATGTGTAGGAAGAGGG - Intergenic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1141926341 16:87172755-87172777 GTGAGGAATCTGAGGGTAGAAGG - Intronic
1142694581 17:1626811-1626833 GGGATCAAGGAGAAGGCAGAGGG + Intronic
1143594661 17:7907141-7907163 GTGAGAAAGGAGAAGGCATAAGG + Exonic
1144291665 17:13832577-13832599 GTAAGAAATGGGAAGGAAGAAGG + Intergenic
1146974351 17:37098213-37098235 GTCACAAGTGTGAAGGCAGATGG + Intronic
1147141447 17:38462890-38462912 GTCAAGAATGTGAAGGAAGACGG + Exonic
1149384653 17:56130077-56130099 ATTAGCAATGTGAAGTGAGAAGG - Intronic
1150201355 17:63361248-63361270 GTGAGCAATACTCAGGCAGAAGG - Intronic
1154487563 18:14886777-14886799 GTGAGCATATTGAGGGCAGAGGG - Intergenic
1155592040 18:27438506-27438528 GTGAGCATGGAGGAGGCAGAAGG + Intergenic
1155936720 18:31762393-31762415 TTTAGAAATGTGAAGGCAGATGG - Intergenic
1155944011 18:31827321-31827343 GTGAACCTTTTGAAGGCAGAGGG + Intergenic
1157479242 18:48042586-48042608 GTGGGCACTGGGAAGGCAGCAGG + Intronic
1157526783 18:48389331-48389353 GAGAACAGGGTGAAGGCAGAGGG + Intronic
1157877722 18:51289256-51289278 GTGAGCAATAGGAAGAGAGAGGG - Intergenic
1158807536 18:60992593-60992615 ATGAGTAATGTCAAGGGAGAAGG - Intergenic
1159161195 18:64645827-64645849 GTGAGCAATACTCAGGCAGAAGG - Intergenic
1159793279 18:72811119-72811141 GTGAGTACTGTGAAGCCTGAGGG - Intronic
1159837666 18:73358792-73358814 CTGACCAAGGAGAAGGCAGAAGG - Intergenic
1160116475 18:76084122-76084144 GTGAGCAATACTCAGGCAGAAGG - Intergenic
1164041528 19:21496949-21496971 TTGAGCAAGGTTCAGGCAGAAGG - Intronic
1164180174 19:22811420-22811442 GTGAGCAGGGTGAAGGCAGCAGG - Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1165170756 19:33890091-33890113 GTGGGCAATGTGTGTGCAGAGGG + Intergenic
1167782322 19:51606985-51607007 GTGAGGAATGAGATGGCAGGGGG - Intergenic
1168682569 19:58326798-58326820 GAGGGAAATGTGAAGGCTGAGGG - Intergenic
926404496 2:12537141-12537163 GTGAAGAATGGGAAGGGAGAGGG + Intergenic
928142918 2:28746202-28746224 ATAGGGAATGTGAAGGCAGAAGG - Intergenic
929880907 2:45836711-45836733 GTGAGAAAGGAGGAGGCAGACGG - Intronic
930702596 2:54473999-54474021 TTCTGCAGTGTGAAGGCAGACGG + Intronic
931019188 2:58023577-58023599 GTTAGCAATTTTTAGGCAGAGGG - Intronic
931251705 2:60536807-60536829 GTCAGCAGTGTGCAGGCAGCAGG + Intronic
933283110 2:80354554-80354576 GTGAGGATTGTGAAAGCAAATGG + Intronic
933779015 2:85788608-85788630 GAGAGCACTGTCAAGGCAGAAGG + Intergenic
933835264 2:86240710-86240732 GTGAGCAGTGTGAAGGAGGCAGG + Intronic
934949369 2:98565985-98566007 GAGAGCAGTGTGAGGCCAGAGGG - Intronic
935226089 2:101054371-101054393 GCCAGCAATGGGAAGGCAGGGGG + Intronic
935614647 2:105064579-105064601 GTGAGCGATGTGGAAGCTGAAGG + Intronic
936449842 2:112625838-112625860 GTGTTCAAAGGGAAGGCAGAAGG + Intergenic
937196054 2:120157524-120157546 GTTAGGAAGGTGGAGGCAGACGG + Intronic
937795886 2:126019515-126019537 GTGAGCAATGTGAACCCATTGGG + Intergenic
937950019 2:127377513-127377535 ATGAGCAATGTGGAGGCAGTGGG + Intronic
938763692 2:134446378-134446400 GTTAGCAGTGTGCCGGCAGATGG + Intronic
939497037 2:142936752-142936774 GTGACTAATGTGCATGCAGAGGG + Intronic
940136679 2:150445096-150445118 ATGAGTAATGTGGAAGCAGAAGG - Intergenic
941023392 2:160434420-160434442 GTGAGCAATGTGGGGGGAAAAGG - Intronic
941840214 2:170074521-170074543 TTGAGCAAGGTAATGGCAGAGGG - Intronic
942829193 2:180218932-180218954 GGAAGCAATGTGAATGCAGCTGG + Intergenic
943928356 2:193818783-193818805 GTGAGCAATACACAGGCAGAAGG - Intergenic
943932309 2:193869090-193869112 GTGAGCAATATTCAGGCAGAAGG + Intergenic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947304959 2:228735453-228735475 GTGAGCTATGTGAAACCACAGGG + Intergenic
948355954 2:237377227-237377249 GAGCTCAATGTGAAGCCAGAGGG - Exonic
948825677 2:240572575-240572597 GGGAGCAAGGTGACGGCAGCTGG - Intronic
948958237 2:241311859-241311881 GTTTGCACTGAGAAGGCAGAGGG + Intronic
1169115973 20:3066155-3066177 TTGAGCAATGGGAAGGATGAAGG - Intergenic
1169489967 20:6063096-6063118 GAAGGCAATGTGAAGACAGAAGG + Intergenic
1169511406 20:6268131-6268153 CTTAGCACTGTGAAGGCACAGGG + Intergenic
1170506243 20:17028641-17028663 GGGATTATTGTGAAGGCAGAAGG - Intergenic
1171029236 20:21662557-21662579 GTGAGCCATGTGAAAGAATAGGG + Intergenic
1171111255 20:22484500-22484522 GTGAGCTATGAGAAGGCATGGGG + Intergenic
1171124310 20:22587914-22587936 GTAGGCAAGATGAAGGCAGAGGG + Intergenic
1171570861 20:26250690-26250712 GAGACCAATGTGAAAGGAGATGG - Intergenic
1172782611 20:37446184-37446206 GCGAGCACTGTGCATGCAGAGGG - Intergenic
1173430346 20:42982296-42982318 GTGAGCTCTGTGAGGACAGATGG - Intronic
1173620125 20:44430156-44430178 CTGAGCAAGGTGACAGCAGAGGG - Exonic
1174790270 20:53471706-53471728 GGGACCCAGGTGAAGGCAGAGGG + Intronic
1174955280 20:55091045-55091067 GTGAGATATGTGAAGCCACAGGG + Intergenic
1175639859 20:60619912-60619934 GTGAGCAATGAGTAGGCATCTGG + Intergenic
1176025266 20:62982379-62982401 GTGAGCACAGGGAAGGCACAGGG - Intergenic
1177181834 21:17752642-17752664 GTGAAAAATGTGAATGCAGTAGG - Intergenic
1177641834 21:23853833-23853855 GAGAGCAATTTGAAGTCAGCAGG + Intergenic
1177925087 21:27204058-27204080 CTGATCACTGGGAAGGCAGAAGG + Intergenic
1178494363 21:33074388-33074410 GTGAGCAATCAGTAGACAGAGGG + Intergenic
1179111182 21:38446878-38446900 GGGGGCAAGGAGAAGGCAGATGG - Intronic
1179376075 21:40850742-40850764 GAAAGCCATGTGAAGACAGAAGG - Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186226 21:46140714-46140736 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186245 21:46140814-46140836 GTGAGCAATGTGAAGGCTGACGG - Intronic
1180186253 21:46140864-46140886 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180573022 22:16747709-16747731 GAGACCAATGTGAAAGGAGATGG - Intergenic
1180663168 22:17486794-17486816 GTGAGCAGGGAGAAGACAGAAGG + Intronic
1180853498 22:19032970-19032992 GAGAGCAAGGTGAGGGCAGCTGG - Intergenic
1181304351 22:21906327-21906349 GAGAGAAATGTGGAGGAAGAGGG + Intergenic
1181603238 22:23964785-23964807 GTTAGGAGTGTGCAGGCAGAAGG - Intergenic
1181605276 22:23976522-23976544 GTTAGGAGTGTGCAGGCAGAAGG + Intronic
1182237420 22:28886339-28886361 GTGAGAAATGAGAAAGCAGAAGG + Intronic
1185244068 22:49763938-49763960 GTGAGCAACGTGGGGGCAGCCGG + Intergenic
949314408 3:2735992-2736014 GTGACCAATGTGAAATAAGAGGG + Intronic
953223651 3:40997711-40997733 GTAGACAATGTGAAGGCAGAGGG - Intergenic
953402853 3:42641448-42641470 GGGAGCCAAGTGAATGCAGAGGG + Intronic
953820472 3:46203747-46203769 GTGAGGAAAGTGAAGGCTGCAGG + Exonic
953923678 3:46969268-46969290 GGGAGCAATGCCAAGGTAGAAGG - Intronic
954719743 3:52551278-52551300 ATGAGCTTTGTGAAGGCTGAAGG + Intronic
955339179 3:58111839-58111861 GCCAGCAAAGTGAAGGCAGAAGG + Exonic
955730033 3:61975244-61975266 ATGAGGCATGTGAGGGCAGAGGG - Intronic
956345514 3:68273563-68273585 GAGAACAACCTGAAGGCAGATGG + Intronic
956815788 3:72907059-72907081 GTGATCCAAGGGAAGGCAGATGG + Intronic
958044662 3:88268726-88268748 GTGAGGAGTGGGATGGCAGAGGG + Intergenic
959134541 3:102400511-102400533 CTGAGCATGGAGAAGGCAGAGGG - Intronic
959897244 3:111618248-111618270 GTGAGCAATACTCAGGCAGAAGG + Intronic
961482782 3:127194935-127194957 GTGGGCAAGGTCAGGGCAGAGGG - Intronic
961747877 3:129077143-129077165 GAGAGGAATGAGAAGGAAGAGGG - Intergenic
962509936 3:136088228-136088250 GTGAGCACAGTGAGGGCTGAGGG - Intronic
963227019 3:142872652-142872674 GTGAGCTATATGAGGACAGAAGG - Intronic
964526312 3:157618636-157618658 GTGAGTAGTGTCAAGGCAGGGGG - Intronic
964727209 3:159825862-159825884 GTGACTCAGGTGAAGGCAGAGGG + Intronic
965983333 3:174720674-174720696 GTGGGCATTGGGAATGCAGATGG + Intronic
966914362 3:184576817-184576839 GTGAGGAATATGGAGGGAGAAGG - Intronic
967248899 3:187516986-187517008 GTGACCCACGTGAAGGGAGAGGG - Intergenic
968291028 3:197539972-197539994 GTGAGCAAGGTGAAGCCATTGGG + Intronic
969183713 4:5460522-5460544 GTCAGCTCTGTGGAGGCAGAAGG - Intronic
969328944 4:6461838-6461860 GTGAGCACTGTGTGGGCAGGCGG + Intronic
970088665 4:12377812-12377834 TTGAGCAATGAGGAGGCAGAGGG + Intergenic
970156736 4:13149654-13149676 GTGAGCCATTGGGAGGCAGAGGG - Intergenic
970158267 4:13163487-13163509 TGGAGCAATGTGAAGTCTGAGGG - Intergenic
972715900 4:41645562-41645584 GTGAGGATTCTGGAGGCAGATGG - Intronic
973110865 4:46396300-46396322 GTGAGCTATTTAAAGGCAGAAGG + Intronic
975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG + Intergenic
977082873 4:92555508-92555530 GTGAGAAAAATGAAGGCAGCTGG + Intronic
977140092 4:93359816-93359838 GTCAGTAATGGGAAGGCAGTAGG + Intronic
977836057 4:101647520-101647542 GGGAGGAATGTGATAGCAGAAGG + Intronic
981064509 4:140468739-140468761 GTGATTTATGTGAAGGGAGAGGG - Intronic
982463593 4:155702525-155702547 GTGAGCTATGTAAAGGCAAAGGG - Intronic
982586513 4:157247825-157247847 GTGAGGCAGGTGCAGGCAGAAGG + Intronic
983656326 4:170089142-170089164 GTGACCAAAGAGAAGGCAGAGGG + Intronic
984278934 4:177643837-177643859 GTCAGCAAGTTGAAGACAGATGG - Intergenic
984963285 4:185119007-185119029 TTTATCAGTGTGAAGGCAGAGGG + Intergenic
985301624 4:188496308-188496330 GTAAGGACTGTGAAGGCAGCAGG - Intergenic
985320947 4:188710664-188710686 CTGAACAATTTGGAGGCAGAAGG - Intergenic
985994755 5:3591729-3591751 GTGGCCATTGTGAAGGCAGGAGG + Intergenic
986328354 5:6698802-6698824 ATGTGAAATGTAAAGGCAGATGG + Intergenic
987483422 5:18490748-18490770 GTGAGCAATGGGACGGAAGTCGG + Intergenic
987875547 5:23675751-23675773 GTGAGCAATACTCAGGCAGAAGG + Intergenic
988850191 5:35173101-35173123 GTGAACAATGTGGAGGCAAAGGG - Intronic
988897737 5:35696414-35696436 ATGAGCAATGGGAAGGGAAATGG + Intronic
989285489 5:39694446-39694468 CTGGGGAATGTGAAGGCATAAGG - Intergenic
990991022 5:61684140-61684162 GGGAGCTATGTGCAGGCAGGTGG + Intronic
991573364 5:68078194-68078216 GGGCGGAAGGTGAAGGCAGAGGG - Intergenic
992333820 5:75744920-75744942 GTGAGCAATTTAAAGACAGAAGG - Intergenic
992769411 5:80033576-80033598 GAGAGCAATAAGAAGGTAGAAGG - Intronic
993227034 5:85180790-85180812 CTGAGGAATGAAAAGGCAGAAGG + Intergenic
993336471 5:86665712-86665734 GTGAGCCATTAGAAGGTAGAAGG - Intergenic
995214157 5:109575415-109575437 GTGAGCAAAGAGAAAGTAGATGG - Intergenic
995434795 5:112123509-112123531 GTGACCACTGTGTAGGAAGAAGG + Intergenic
996020170 5:118582430-118582452 GAGACCAAGGTGAAAGCAGAAGG + Intergenic
997642786 5:135460420-135460442 GTGAGCCATGTGAGGCCACATGG - Intergenic
998254414 5:140573801-140573823 GTGAGCAAGGTGAAGCCTGAGGG - Intronic
999862581 5:155664396-155664418 ATGAGCAGTCTGAAGACAGAGGG + Intergenic
1000249555 5:159481100-159481122 GGGAGCATTGTGTATGCAGAAGG + Intergenic
1000451967 5:161400513-161400535 ATGGGCAATTTGAAGGCAGGGGG + Intronic
1001925367 5:175632265-175632287 TTGAACAATGTGAAGGCTAAGGG + Intergenic
1002469393 5:179426464-179426486 GGGAGCAAGGTGGAGGGAGAGGG + Intergenic
1002808691 6:604306-604328 GTGAGAAAGGTGAAGGGACAGGG - Intronic
1004319684 6:14622593-14622615 GTGGGCACTATGAAGGGAGAGGG + Intergenic
1005137237 6:22583810-22583832 GGGAGAACTGTGAAGGCAGGTGG + Intergenic
1005331327 6:24753299-24753321 GTGGGAGATGGGAAGGCAGAAGG - Intergenic
1007597130 6:43058184-43058206 GGGAGCAACATCAAGGCAGAGGG + Exonic
1008420318 6:51291694-51291716 GTGAGCAATGTGGAGACAGGAGG + Intergenic
1008679169 6:53854004-53854026 GTGACCAATGTGAATGCTAATGG - Intronic
1009050579 6:58271013-58271035 GTGAGCACCGAGAAGCCAGATGG + Intergenic
1009239840 6:61171371-61171393 GTGAGCACCGAGAAGCCAGATGG - Intergenic
1009958576 6:70489198-70489220 ATGAGTAATGTGAAAACAGATGG + Intronic
1011010004 6:82693201-82693223 GCCAGCAATGTAAAGGCACAAGG + Intergenic
1011861896 6:91768353-91768375 GTCAGCAATGTGATGGAAGAAGG + Intergenic
1011937832 6:92803249-92803271 GTGAGTAATGTGAAGAGAAAGGG + Intergenic
1012247050 6:96937744-96937766 GTAAGGAAGCTGAAGGCAGAAGG - Intronic
1012654745 6:101802406-101802428 GTGATCAGTCTGAAGGAAGAAGG + Exonic
1012717926 6:102701078-102701100 GTGGGCAATATTCAGGCAGAAGG - Intergenic
1013780176 6:113720120-113720142 GGGAGAAATGGGGAGGCAGAGGG - Intergenic
1016590376 6:145736845-145736867 ATGAAAAATGTGAAGACAGAAGG + Intergenic
1016885124 6:148951751-148951773 ATTAGCACAGTGAAGGCAGAGGG - Intronic
1019067710 6:169316380-169316402 GTGACCACTGTGCAGACAGACGG - Intergenic
1020384939 7:7590797-7590819 GTGAGAAATGTGAAGTATGAGGG - Intronic
1020861408 7:13496524-13496546 GTGAGTGATGGAAAGGCAGATGG - Intergenic
1023529123 7:41135558-41135580 ATGAGCAATATTCAGGCAGAAGG - Intergenic
1024024783 7:45400919-45400941 GTGAGCAATACTCAGGCAGAAGG + Intergenic
1024118279 7:46213052-46213074 GTGAGAAGGGTGAAGGCAGTTGG + Intergenic
1025285176 7:57654724-57654746 GGGACCAATGTGAAAGGAGATGG - Intergenic
1027299087 7:76810575-76810597 GTGAGCAACATGGAGGCAAATGG + Intergenic
1029065749 7:97846646-97846668 GTCATCAATGTGTTGGCAGAAGG - Intergenic
1029106050 7:98177027-98177049 GTGTGAAATCTGGAGGCAGACGG - Intronic
1030359605 7:108580657-108580679 GTGAGCAATACTCAGGCAGAAGG + Intergenic
1030633267 7:111918665-111918687 GTGAGTATTTTGAAGGCAAAAGG - Intronic
1031141667 7:117949536-117949558 ATGGACAATGTGAAGGGAGATGG + Intergenic
1033129772 7:138735703-138735725 GTGAGCAAGGGGAATGCCGAGGG - Intronic
1033834789 7:145296790-145296812 TTGAGCAAGGTCAAGGCACATGG - Intergenic
1034160799 7:148993158-148993180 GTAAGCTAAGTGATGGCAGATGG + Intergenic
1035569330 8:661808-661830 GTCAGGAAAGTGAATGCAGAAGG + Intronic
1035943577 8:3932401-3932423 ATGAGAAATGTCAATGCAGATGG - Intronic
1038008568 8:23456010-23456032 GCGTGCACAGTGAAGGCAGAAGG - Intronic
1038149175 8:24927609-24927631 GTGGCCAGTGTGATGGCAGATGG - Intergenic
1038397357 8:27257156-27257178 TGGAGCAGTGAGAAGGCAGAGGG - Intronic
1039167909 8:34706996-34707018 TTCAGCAATATGAATGCAGATGG - Intergenic
1039705954 8:40007661-40007683 GAGAGCAATGTGAAGCAAAAAGG - Intronic
1046186880 8:110733920-110733942 GTGAGCAATATTCAGACAGAAGG - Intergenic
1046994083 8:120496254-120496276 GTGAGTGATGGGAAGGAAGAGGG + Intronic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1047840027 8:128741515-128741537 GTGACCAATGGGAAATCAGATGG - Intergenic
1048614342 8:136058026-136058048 GTGTGGAATTTGAAGTCAGAAGG + Intergenic
1050551957 9:6756819-6756841 GTGAACATTGTGAGGACAGATGG - Intronic
1051595826 9:18823657-18823679 GTGAGCAATGTGAGGGAAAGAGG + Intronic
1052623772 9:30947684-30947706 GAAAGTCATGTGAAGGCAGAAGG + Intergenic
1053276352 9:36786554-36786576 GTGAGCCATGTGAAGACATGTGG + Intergenic
1054824000 9:69552853-69552875 ATGAGCAAGGTGAGGGTAGAAGG - Intronic
1055172504 9:73276173-73276195 GACAGCAATGTGAAGACTGAGGG + Intergenic
1057842395 9:98496517-98496539 GTCAGCAAAGAGAAAGCAGAGGG + Intronic
1060038343 9:120278347-120278369 GTGGGCAATGGGAAGCTAGAAGG + Intergenic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1061368930 9:130187139-130187161 GGGAGCAATGTGAGGCCACAGGG + Intronic
1062187808 9:135227939-135227961 GAGAGCAGCGTGCAGGCAGAGGG + Intergenic
1187030901 X:15487095-15487117 GATAACAATGAGAAGGCAGAAGG + Intronic
1187268043 X:17755408-17755430 CTGGGCCATCTGAAGGCAGAGGG - Intergenic
1187321207 X:18238875-18238897 CTGGGCCATCTGAAGGCAGAGGG + Intergenic
1188435172 X:30150615-30150637 GTGAGCAATACTCAGGCAGAAGG + Intergenic
1189227310 X:39423587-39423609 GTGAGCTCTATGAAGGCAGGTGG + Intergenic
1189988217 X:46572486-46572508 ATGAGTAATGAAAAGGCAGAGGG + Intergenic
1191086450 X:56572707-56572729 ATGTGAAATGTGATGGCAGAGGG + Intergenic
1195724282 X:107898120-107898142 GAGAGCAAGGTGAAGAGAGAAGG - Intronic
1196236064 X:113281685-113281707 GAGAGCAGTGTTAATGCAGATGG + Intergenic
1197462698 X:126762122-126762144 GTGAGCAATGTGAATGATGTGGG + Intergenic
1198363939 X:135922481-135922503 ATGATTAATGTAAAGGCAGAAGG + Intergenic
1198479364 X:137026985-137027007 GTGAGGCAGGTGAAGGCAGTGGG + Intergenic
1198871533 X:141180895-141180917 GTGAGCAGGGTGAATGGAGAAGG - Intergenic
1199601851 X:149545743-149545765 GTGAGCAATGTGGACGGCGATGG - Exonic
1199614356 X:149645004-149645026 GTGAGCAATGTGACAGCCAAAGG + Intergenic
1199648533 X:149933740-149933762 GTGAGCAATGTGGACGGCGATGG + Exonic
1199902965 X:152195664-152195686 GAAAGCAATGTGATGACAGAAGG - Intronic
1200791010 Y:7299008-7299030 GTGAGGAAGGTGACGGGAGAAGG - Intergenic
1200904841 Y:8471300-8471322 GTGGGCAATGTCCAGGCAGGAGG - Intergenic