ID: 1180186245

View in Genome Browser
Species Human (GRCh38)
Location 21:46140814-46140836
Sequence GTGAGCAATGTGAAGGCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 2, 2: 3, 3: 23, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180186245_1180186254 30 Left 1180186245 21:46140814-46140836 CCGTCAGCCTTCACATTGCTCAC 0: 1
1: 2
2: 3
3: 23
4: 224
Right 1180186254 21:46140867-46140889 TCTGCCTTCACATTGCTCACAGG 0: 2
1: 2
2: 2
3: 44
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180186245 Original CRISPR GTGAGCAATGTGAAGGCTGA CGG (reversed) Intronic
901798861 1:11695746-11695768 TTGAGGAATATGGAGGCTGAGGG + Intronic
903269347 1:22177997-22178019 GGGAGCCATGGGCAGGCTGAGGG - Intergenic
903912069 1:26734898-26734920 GAGAGCAATGTGAAATCTGAGGG - Intronic
906812439 1:48842178-48842200 GTGAGGAAAGTGCAGGCTGATGG - Intronic
907937420 1:59055224-59055246 GTCAGCCATGTGAAGACTGGAGG + Intergenic
908560769 1:65303922-65303944 CTGATCAAAGTGAAAGCTGAAGG - Intronic
910813861 1:91267034-91267056 GTCTGCACTGAGAAGGCTGAGGG + Intronic
911117890 1:94265257-94265279 GTCAGCAATGCCAAGGCAGAAGG - Intronic
912254686 1:108046945-108046967 GTAGGGAATGTGGAGGCTGAGGG - Intergenic
912517410 1:110225024-110225046 GGGAGAAATGGGAAGCCTGATGG - Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
914755773 1:150560966-150560988 CTCAGCAGTGTGAAGGCAGAAGG + Intergenic
915474264 1:156143846-156143868 GTTAGCAATGTGCAGGGTGCTGG - Intergenic
915715066 1:157937657-157937679 GTGAGGAATGAGAGGGGTGATGG + Intergenic
915986385 1:160469552-160469574 CTGAGCCATCTGAAGGCTGAAGG - Intergenic
916199655 1:162258140-162258162 GAGGGGAATGTGAGGGCTGAGGG - Intronic
916579013 1:166091186-166091208 GTGAGGGAAGTCAAGGCTGAAGG + Intronic
917988175 1:180343575-180343597 GTAAGGATTGTGAAGGATGAAGG - Intronic
918957666 1:191231121-191231143 GTAAACAATCTGAAGGTTGAAGG + Intergenic
920669351 1:207991391-207991413 GACAGCGGTGTGAAGGCTGATGG + Intergenic
921585038 1:216936152-216936174 GTCAGGAATGTGAAGGTTGGGGG + Intronic
922208010 1:223465919-223465941 ATGAACAATGGCAAGGCTGATGG - Intergenic
922892814 1:229074649-229074671 GTGAGCAACGTGGAGGCTCTGGG - Intergenic
923382388 1:233434530-233434552 AAGAGCAATTTGAAGGCTAAAGG + Intergenic
1062978634 10:1703412-1703434 GTGAGCAGTGAGGAGGCTGAGGG + Intronic
1065569995 10:27060887-27060909 AGGAGAAATGTCAAGGCTGATGG + Intronic
1065800668 10:29348958-29348980 GCGAGGAAAGTGAAGGCTGCTGG - Intergenic
1065805529 10:29390494-29390516 GGGAGCAATGTCAAGGTTGGAGG + Intergenic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1070091756 10:73293556-73293578 GAGAGAAATGTCAAGGGTGAAGG + Intronic
1071119222 10:82258762-82258784 ATGAGGAATGTGAAGGTTGGAGG + Intronic
1072430023 10:95362659-95362681 GTGAGCAATGATAAGGCGGGAGG - Intronic
1074676799 10:115860346-115860368 GTGAGCAAAGGGAAGGCAGATGG - Intronic
1074869547 10:117565993-117566015 GTGAGAAATCTGAAGGCCGGGGG - Intergenic
1074953417 10:118363676-118363698 GTGAGCAATGACAATGATGATGG + Intergenic
1075643914 10:124085264-124085286 GCGAGAAATGTGGAGGCTGCTGG - Intronic
1076310739 10:129505858-129505880 GAGAGCAGTGTGAAGCCTGAGGG + Intronic
1080476382 11:32595791-32595813 GTGAGCCATGTGAAAGCAGATGG + Intronic
1081583548 11:44369002-44369024 GTGAGCCAGGTGAGAGCTGAGGG + Intergenic
1081647070 11:44797467-44797489 CTGAGCGATGTGAGGGATGATGG + Intronic
1081994807 11:47356668-47356690 GTGAGCAATGTAAGGTGTGAGGG - Intronic
1085391765 11:76185764-76185786 TGGAGCACTGGGAAGGCTGAAGG - Intergenic
1086052212 11:82606575-82606597 GTGAGCTCTGGGAAGGCAGAGGG + Intergenic
1088626477 11:111733788-111733810 GCCAGCAAAGTGAGGGCTGAAGG + Intronic
1090900824 11:131029410-131029432 GTGAGGAGTGTGTAGGTTGATGG + Intergenic
1091389700 12:118574-118596 AGGAGCATTTTGAAGGCTGATGG - Intronic
1093163110 12:15772292-15772314 TTGGGAAATGTGAAGTCTGAGGG + Intronic
1097243528 12:57592150-57592172 TTGACCAAAGAGAAGGCTGAGGG + Intronic
1098053941 12:66483812-66483834 GTGAGCAATGTAAAGGAGTAGGG - Intronic
1099559738 12:84156344-84156366 GAGATTAATGTGAAGGCTTAGGG - Intergenic
1102026820 12:109718400-109718422 GTGAGGGATGGGAAGGCAGAGGG - Intronic
1106070244 13:26404039-26404061 GTGAGTACTGTGGAGGCTGCTGG - Exonic
1106763779 13:32893658-32893680 GTGAGAGAAGGGAAGGCTGAAGG - Intergenic
1107010566 13:35666104-35666126 TGGAGGAATGAGAAGGCTGAAGG + Intronic
1107565042 13:41593684-41593706 TTGTACAATGTGAAGACTGAAGG - Intronic
1108673396 13:52714284-52714306 GTAAGCAATGTGGAGGCAGGTGG - Intronic
1109453241 13:62546458-62546480 CTGACCACTGTGAAGGATGAGGG + Intergenic
1110236990 13:73227433-73227455 GTGTGCATTGGGAAGGGTGAAGG - Intergenic
1111116837 13:83789794-83789816 GTTTGCAATGTGCAGGCTGGAGG + Intergenic
1114475770 14:22993682-22993704 GTGAGGACTGTAAAGGCTGTTGG + Intronic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1116342452 14:43741664-43741686 ATGAGCAAGGTTAAGGCAGAAGG - Intergenic
1116575903 14:46575050-46575072 GTAAGACATGTGAATGCTGATGG + Intergenic
1118101110 14:62604183-62604205 TTCAGCAATATCAAGGCTGATGG - Intergenic
1121779691 14:96614290-96614312 GTGAGCAATTTTAAGGCTAATGG + Intergenic
1121954179 14:98198970-98198992 GTGAGGATGGTCAAGGCTGAGGG + Intergenic
1123061406 14:105596346-105596368 GTCACCAAGGTGGAGGCTGATGG - Intergenic
1124897740 15:33792690-33792712 ATGAGAAATGTGAAGGCTTGTGG + Intronic
1125546199 15:40507358-40507380 GTGAGCAATGGGAAGCCAGGGGG + Intergenic
1127849978 15:62903668-62903690 GTAAGCAATCTGTGGGCTGAGGG - Intergenic
1129718937 15:77867138-77867160 GTGGGCAGTGAGGAGGCTGAGGG - Intergenic
1129833256 15:78684215-78684237 GTGAGCTGTCTGAAGGCTGCTGG - Intronic
1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG + Intronic
1130059294 15:80558102-80558124 GTCAGTAATGTGAAGAGTGAAGG - Intronic
1130459997 15:84153722-84153744 GTGGGCAGTGAGGAGGCTGAGGG + Intergenic
1130809795 15:87364914-87364936 GTGAGCAATGTGAGGGTTGAGGG + Intergenic
1131811220 15:96175500-96175522 GTGGGCAATATGAAGACTAAAGG - Intergenic
1131840060 15:96427667-96427689 ATGGGCCATGTGAAGGCAGAGGG + Intergenic
1132187811 15:99818342-99818364 GTGAGCAAAGTTAAGGATCAAGG + Intergenic
1132213190 15:100041566-100041588 GTTAGCAAGGTGAAGGCTGCTGG + Intronic
1132301138 15:100776368-100776390 GTGAGCAATTTGAAAGTTTAAGG + Intergenic
1132982570 16:2745999-2746021 CTGAGCTGTGTGAAGGCTGCAGG + Intergenic
1134254729 16:12601651-12601673 GTGAGCAATGCTCAGGCAGAAGG + Intergenic
1134375073 16:13664564-13664586 GTGAGACCAGTGAAGGCTGAAGG - Intergenic
1134834823 16:17352314-17352336 GTGAGCATTTGGAAGGCTGGAGG - Intronic
1136271016 16:29148280-29148302 GTCAGCAATGTGGAGCCTCAGGG - Intergenic
1137004285 16:35258450-35258472 ATGAGCAAGGGGAATGCTGATGG - Intergenic
1137027218 16:35489058-35489080 ATGAGCAAGGGGACGGCTGATGG - Intergenic
1138755987 16:59486018-59486040 GGGAGAAAGGTGAGGGCTGAGGG - Intergenic
1140189757 16:72805338-72805360 GTGAGCAATGCCAAGGCGGTAGG - Intronic
1141051305 16:80767066-80767088 GTGAGCAATGTGCAGGTTCTGGG - Intronic
1141348246 16:83268321-83268343 GTGAGCTGTGTGTAGCCTGAGGG + Intronic
1141361082 16:83395609-83395631 TTGAGCAATGACCAGGCTGAAGG - Intronic
1142074629 16:88110289-88110311 GTCAGCAATGTGGAGCCTCAGGG - Intronic
1144716615 17:17440592-17440614 GTGAGGAAAGTGCAGGGTGAGGG - Intergenic
1145183224 17:20771307-20771329 CTGAGCAATGGGAACGCTCACGG - Intergenic
1147039158 17:37704184-37704206 TTGAGGCATGAGAAGGCTGAAGG - Intronic
1149551334 17:57542430-57542452 GTGACCAATGCTAAGGCTGTGGG - Intronic
1153121844 18:1738247-1738269 GAGAGCAATGTGGGAGCTGAGGG + Intergenic
1155936720 18:31762393-31762415 TTTAGAAATGTGAAGGCAGATGG - Intergenic
1157087889 18:44600345-44600367 GTGATGAAAGTGAAAGCTGAGGG + Intergenic
1157200442 18:45654791-45654813 GTGAGGGATTTGAGGGCTGATGG - Intronic
1158288773 18:55915412-55915434 GTAAGATATGTGAAGGCTGTTGG + Intergenic
1159084085 18:63767995-63768017 GTGAGGTCTGTGAAGTCTGAAGG + Intronic
1159648582 18:70950213-70950235 GTTAGCAATGTGAATCCTCAGGG - Intergenic
1159664343 18:71139795-71139817 GTAATCAAGGTGACGGCTGATGG - Intergenic
1159793279 18:72811119-72811141 GTGAGTACTGTGAAGCCTGAGGG - Intronic
1160965182 19:1744312-1744334 GTGAGCAAACTGAGGCCTGAGGG - Intergenic
1164180174 19:22811420-22811442 GTGAGCAGGGTGAAGGCAGCAGG - Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1166169756 19:41019487-41019509 ATGAGGAGTGAGAAGGCTGAGGG - Intergenic
1167573412 19:50305094-50305116 GGGAGCCATGGGAAGGCTGTGGG + Intronic
1168682569 19:58326798-58326820 GAGGGAAATGTGAAGGCTGAGGG - Intergenic
925085324 2:1103056-1103078 GTGAGGAGTGTGAGGTCTGAAGG - Intronic
925651483 2:6094144-6094166 GTGAACAAGGTAAAGGGTGAAGG - Intergenic
928169478 2:28994169-28994191 GTGGGCAATGCGGTGGCTGAGGG + Intronic
929883496 2:45858024-45858046 GTGTGCTGTTTGAAGGCTGAAGG + Intronic
933779015 2:85788608-85788630 GAGAGCACTGTCAAGGCAGAAGG + Intergenic
933835264 2:86240710-86240732 GTGAGCAGTGTGAAGGAGGCAGG + Intronic
935525293 2:104158343-104158365 TTTAGCATGGTGAAGGCTGAAGG + Intergenic
935614647 2:105064579-105064601 GTGAGCGATGTGGAAGCTGAAGG + Intronic
935736214 2:106108536-106108558 AAGAACAATGAGAAGGCTGAGGG - Intronic
936524287 2:113232420-113232442 GTGAGCACTTTGAAGGTTGCTGG - Intronic
936928008 2:117757818-117757840 GTCTGCAATGAGAAGGTTGAAGG + Intergenic
937950019 2:127377513-127377535 ATGAGCAATGTGGAGGCAGTGGG + Intronic
939084666 2:137705068-137705090 TTGAACAACGTGAAGGCTAAGGG - Intergenic
939422745 2:141994915-141994937 GTGAGCGGTATGAAAGCTGAAGG + Intronic
943932309 2:193869090-193869112 GTGAGCAATATTCAGGCAGAAGG + Intergenic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
948993426 2:241565694-241565716 GTGAGCCGTGTGAGGGCTGCAGG + Intronic
1169115973 20:3066155-3066177 TTGAGCAATGGGAAGGATGAAGG - Intergenic
1169172112 20:3473309-3473331 GGAAGCGATGTGAAGTCTGAGGG + Intronic
1169803049 20:9531028-9531050 GTGAGCAGTTTGAAGACTTAGGG - Intergenic
1170695721 20:18656661-18656683 GTTAGCTATGTGAGGGCTGCAGG - Intronic
1172947941 20:38703067-38703089 GTGAGCCATGTGGATGCTGGAGG + Intergenic
1173441501 20:43080862-43080884 GTGATCCATGTGATGACTGAAGG - Intronic
1173666407 20:44766409-44766431 GTGAGAAAAGTGAAGGGTAAAGG + Intronic
1175921859 20:62453835-62453857 GGGAGCGAGGTGGAGGCTGATGG + Intergenic
1179321029 21:40291407-40291429 GTGAGCAATGAGAGTGGTGATGG - Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186226 21:46140714-46140736 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186245 21:46140814-46140836 GTGAGCAATGTGAAGGCTGACGG - Intronic
1180186253 21:46140864-46140886 GTGAGCAATGTGAAGGCAGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1182237420 22:28886339-28886361 GTGAGAAATGAGAAAGCAGAAGG + Intronic
1184544174 22:45154770-45154792 GTCATCTAAGTGAAGGCTGAAGG - Intergenic
1184873862 22:47260083-47260105 GTGAAGAATTTGAAGGCTGGGGG + Intergenic
951471890 3:23065313-23065335 GTGAGAAATGTGAAATCTCAAGG + Intergenic
952964266 3:38611323-38611345 GGGAACAAAGTGAAGACTGATGG + Intronic
952981024 3:38736074-38736096 GTGAGCTAAGTGAAGACTAAAGG + Intronic
953078472 3:39593445-39593467 GGAAAAAATGTGAAGGCTGATGG + Intergenic
953223651 3:40997711-40997733 GTAGACAATGTGAAGGCAGAGGG - Intergenic
953820472 3:46203747-46203769 GTGAGGAAAGTGAAGGCTGCAGG + Exonic
954719743 3:52551278-52551300 ATGAGCTTTGTGAAGGCTGAAGG + Intronic
954916873 3:54156093-54156115 CTGGGCAATTTGAAGACTGAAGG - Intronic
955339179 3:58111839-58111861 GCCAGCAAAGTGAAGGCAGAAGG + Exonic
956784212 3:72628784-72628806 ATGAGCAATGTGAACTTTGATGG - Intergenic
957262534 3:77920336-77920358 TTGAGAAAAGTGCAGGCTGAAGG - Intergenic
957356545 3:79095061-79095083 GTGAGCCCTATGAAGGTTGAGGG - Intronic
958167061 3:89889679-89889701 GTGGGTGATGTGAAGGTTGAGGG - Intergenic
961772066 3:129257372-129257394 CTTAGAAATGAGAAGGCTGAAGG + Intronic
962509936 3:136088228-136088250 GTGAGCACAGTGAGGGCTGAGGG - Intronic
963411527 3:144933396-144933418 GTGAGCAATAAGAAATCTGATGG + Intergenic
969089924 4:4686025-4686047 GTAAGGAATGTGCAGGCTGCTGG + Intergenic
969191520 4:5524881-5524903 GTCAGCAATGTGTAAGCTGTTGG + Intronic
969441122 4:7217303-7217325 CTGAGCACTGTGATGCCTGAGGG - Intronic
970088665 4:12377812-12377834 TTGAGCAATGAGGAGGCAGAGGG + Intergenic
970158267 4:13163487-13163509 TGGAGCAATGTGAAGTCTGAGGG - Intergenic
970413982 4:15838461-15838483 GTGAGCAATGGGTAGGGTGGAGG - Intronic
971968147 4:33589931-33589953 GTGGGGAATGTCAAGACTGAAGG + Intergenic
972804826 4:42518478-42518500 GAGGGCAAGGTGGAGGCTGAGGG + Intronic
972942820 4:44217924-44217946 GTAAGCCATCTGAAAGCTGAGGG - Intronic
973110865 4:46396300-46396322 GTGAGCTATTTAAAGGCAGAAGG + Intronic
978493574 4:109334627-109334649 GTGCGGGGTGTGAAGGCTGATGG - Intergenic
978863965 4:113484984-113485006 TGGAGTAATGTGAGGGCTGAGGG + Intronic
982463593 4:155702525-155702547 GTGAGCTATGTAAAGGCAAAGGG - Intronic
983656326 4:170089142-170089164 GTGACCAAAGAGAAGGCAGAGGG + Intronic
984457918 4:179994543-179994565 GTTAGCAATGGCAAGGATGAAGG + Intergenic
984902587 4:184598319-184598341 GTGAGGAAGGAGAGGGCTGATGG - Intergenic
988850191 5:35173101-35173123 GTGAACAATGTGGAGGCAAAGGG - Intronic
989632871 5:43504743-43504765 GTAAGCTATGTGAAGGATCATGG + Intronic
992333820 5:75744920-75744942 GTGAGCAATTTAAAGACAGAAGG - Intergenic
993901981 5:93590364-93590386 GTGAGGACTGTGCAGGCTGCAGG + Intronic
994081709 5:95714535-95714557 TTGGGCAATTTGAAGGCTGTTGG + Intronic
995287230 5:110403839-110403861 GGGAGCAATGTGAGGAGTGAAGG + Intronic
998254414 5:140573801-140573823 GTGAGCAAGGTGAAGCCTGAGGG - Intronic
1000535330 5:162471641-162471663 ATGAGCAATGTCATGCCTGATGG + Intergenic
1001925367 5:175632265-175632287 TTGAACAATGTGAAGGCTAAGGG + Intergenic
1002563615 5:180098336-180098358 CTGAGGGATGTGAAGGATGAGGG + Intergenic
1002819324 6:710259-710281 GTTAGGAATATGAAGGTTGACGG - Intergenic
1003672725 6:8174468-8174490 GGGAGCCATGTGAATGCTGGGGG + Intergenic
1006808607 6:36805569-36805591 GTGTGCACTGGGGAGGCTGAGGG + Intronic
1008420318 6:51291694-51291716 GTGAGCAATGTGGAGACAGGAGG + Intergenic
1008679169 6:53854004-53854026 GTGACCAATGTGAATGCTAATGG - Intronic
1011861896 6:91768353-91768375 GTCAGCAATGTGATGGAAGAAGG + Intergenic
1013770701 6:113624914-113624936 GTGTGCAGTGGGGAGGCTGAAGG - Intergenic
1014087123 6:117359133-117359155 ATGAGACAGGTGAAGGCTGAGGG - Intronic
1015276863 6:131391186-131391208 ATGAGAAATATAAAGGCTGAGGG + Intergenic
1015310793 6:131765217-131765239 GTGGCTTATGTGAAGGCTGATGG + Intergenic
1016327784 6:142922595-142922617 GTGAGCAAACTGGAGGCTAAGGG + Intronic
1017713980 6:157195253-157195275 GTGAGCTCTTTGAAGGCTCAGGG + Intronic
1019038734 6:169084803-169084825 GTGAGCAGTGAGAAAGCTGTTGG - Intergenic
1020384939 7:7590797-7590819 GTGAGAAATGTGAAGTATGAGGG - Intronic
1020991519 7:15202567-15202589 CTGACTAATGTGAAGGATGATGG - Intronic
1021834857 7:24659961-24659983 GGGAGAAAGGTGAAGCCTGATGG - Intronic
1023079595 7:36514684-36514706 ATGAGAAATGTGATTGCTGAAGG + Intronic
1024478174 7:49836244-49836266 GAGATAAATGTGTAGGCTGATGG + Intronic
1024541952 7:50482107-50482129 GTGAGCTATGTTAAGGTTGGAGG + Intronic
1024742533 7:52370630-52370652 GTGAGAAAAGGGAAGGGTGAAGG + Intergenic
1025770578 7:64501555-64501577 GAGATTAATGTGAAGTCTGAGGG + Intergenic
1026134501 7:67647400-67647422 GGGAGAAAGATGAAGGCTGAAGG + Intergenic
1033129772 7:138735703-138735725 GTGAGCAAGGGGAATGCCGAGGG - Intronic
1035269999 7:157713857-157713879 GTGTGCCATGTGAGGGCTGGAGG - Intronic
1037612107 8:20484458-20484480 GTCAGCAGGGGGAAGGCTGAAGG - Intergenic
1039878930 8:41611314-41611336 GGGAAGAATGTGAGGGCTGAAGG - Intronic
1042570265 8:70156482-70156504 GTGAGCAGTGAGAGAGCTGACGG - Exonic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1046021805 8:108674413-108674435 GGAAGCAAGGTGATGGCTGATGG - Intronic
1047061430 8:121231214-121231236 ATGAACAATGTGAAGGTAGAGGG + Intergenic
1048317914 8:133375563-133375585 GAGGGCAGTGGGAAGGCTGAAGG + Intergenic
1048848747 8:138624134-138624156 GTGAGCACAGTGATGGGTGAGGG + Intronic
1049430471 8:142560797-142560819 CTGAGCAGCGTGAATGCTGAGGG - Intergenic
1050334904 9:4581449-4581471 GTAAGCAAGGTCAAGGCTCAAGG + Intronic
1055172504 9:73276173-73276195 GACAGCAATGTGAAGACTGAGGG + Intergenic
1055428710 9:76221724-76221746 TTGAACAACGTGTAGGCTGAAGG + Intronic
1058027535 9:100158679-100158701 GTGAGCAAAGTTAACTCTGATGG + Intronic
1058426074 9:104876219-104876241 ATAAGCAATGGCAAGGCTGAGGG + Intronic
1059228967 9:112699814-112699836 GTCAGCTATGTGAATTCTGATGG + Intronic
1059801768 9:117756909-117756931 GAGAGCACTTTGAGGGCTGAGGG + Intergenic
1061809476 9:133154042-133154064 CTTAGCAATGTGCTGGCTGATGG + Exonic
1062159651 9:135073305-135073327 AGCATCAATGTGAAGGCTGAAGG + Intergenic
1186143109 X:6597966-6597988 GTGATCAATTTGAACTCTGAAGG - Intergenic
1186668446 X:11743823-11743845 GTGAGCAACTTCATGGCTGAAGG - Intergenic
1194603345 X:95950693-95950715 GTTAGCAATGTGAAGATTAAGGG - Intergenic
1197280624 X:124531296-124531318 GGGAGGAATGTAAAGGCTCATGG + Intronic
1197462698 X:126762122-126762144 GTGAGCAATGTGAATGATGTGGG + Intergenic
1198303621 X:135356562-135356584 TTGAGCAATGTGGAGGTTAAGGG + Intronic
1198430587 X:136562809-136562831 ATGAGCAATAAGAAGTCTGAAGG - Intergenic
1199418404 X:147614301-147614323 TTGAGCAATGTGAAGGTTAGGGG - Intergenic
1199601851 X:149545743-149545765 GTGAGCAATGTGGACGGCGATGG - Exonic
1199614356 X:149645004-149645026 GTGAGCAATGTGACAGCCAAAGG + Intergenic
1199648533 X:149933740-149933762 GTGAGCAATGTGGACGGCGATGG + Exonic
1200783427 Y:7237527-7237549 GTCAGAAATGAAAAGGCTGAGGG + Intergenic
1202379249 Y:24261451-24261473 GTGGGCAGTGAGGAGGCTGAGGG - Intergenic
1202491533 Y:25408670-25408692 GTGGGCAGTGAGGAGGCTGAGGG + Intergenic