ID: 1180187359

View in Genome Browser
Species Human (GRCh38)
Location 21:46146168-46146190
Sequence ACTCAGCCGGGTCTCCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180187356_1180187359 -2 Left 1180187356 21:46146147-46146169 CCAAAGGGAGGCGCTGGGAGGAC 0: 1
1: 0
2: 1
3: 26
4: 236
Right 1180187359 21:46146168-46146190 ACTCAGCCGGGTCTCCACGCAGG 0: 1
1: 0
2: 2
3: 5
4: 68
1180187346_1180187359 25 Left 1180187346 21:46146120-46146142 CCGGCTTGGCGCAGGCCGAGTAG 0: 1
1: 0
2: 0
3: 1
4: 44
Right 1180187359 21:46146168-46146190 ACTCAGCCGGGTCTCCACGCAGG 0: 1
1: 0
2: 2
3: 5
4: 68
1180187345_1180187359 26 Left 1180187345 21:46146119-46146141 CCCGGCTTGGCGCAGGCCGAGTA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1180187359 21:46146168-46146190 ACTCAGCCGGGTCTCCACGCAGG 0: 1
1: 0
2: 2
3: 5
4: 68
1180187350_1180187359 10 Left 1180187350 21:46146135-46146157 CCGAGTAGGCGCCCAAAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 111
Right 1180187359 21:46146168-46146190 ACTCAGCCGGGTCTCCACGCAGG 0: 1
1: 0
2: 2
3: 5
4: 68
1180187344_1180187359 27 Left 1180187344 21:46146118-46146140 CCCCGGCTTGGCGCAGGCCGAGT 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1180187359 21:46146168-46146190 ACTCAGCCGGGTCTCCACGCAGG 0: 1
1: 0
2: 2
3: 5
4: 68
1180187355_1180187359 -1 Left 1180187355 21:46146146-46146168 CCCAAAGGGAGGCGCTGGGAGGA 0: 1
1: 0
2: 3
3: 26
4: 212
Right 1180187359 21:46146168-46146190 ACTCAGCCGGGTCTCCACGCAGG 0: 1
1: 0
2: 2
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180187359 Original CRISPR ACTCAGCCGGGTCTCCACGC AGG Intronic
903420718 1:23216825-23216847 AGCCAGCCGGGGCTCCACACCGG + Intergenic
910619332 1:89235965-89235987 ACTGGGCAGGGCCTCCACGCAGG - Intergenic
1063243562 10:4195220-4195242 ACCAAGCCGGGCTTCCACGCTGG + Intergenic
1070333036 10:75431521-75431543 CCTCGGCCCGGTCTCCGCGCAGG - Intronic
1074603577 10:114938549-114938571 CCTCAGCCTGGTCCCCACCCGGG - Intronic
1082722569 11:56696095-56696117 TCCCAGCAGGGTCTCCACTCTGG + Intergenic
1083464974 11:62839316-62839338 ACTCACCTGGGTCTCGCCGCCGG + Exonic
1085051079 11:73380598-73380620 CCCCAGCCTGGTCTCCAGGCAGG + Intronic
1089294040 11:117457500-117457522 TCTCAGCACAGTCTCCACGCTGG + Intronic
1091399753 12:174807-174829 GCTCAGCAGGGGCTCCATGCGGG - Exonic
1093683423 12:22029691-22029713 CCACAGCCGGATCTCCATGCTGG + Intergenic
1104633340 12:130423104-130423126 ACTCAGACGGGTCTCCTTTCTGG + Intronic
1104713657 12:131003121-131003143 ACTCAGCCAGGGCACCAGGCAGG - Intronic
1111975555 13:94963364-94963386 ACTCAGATGTGTCTCCATGCAGG + Intergenic
1113836178 13:113330040-113330062 ACGCACCCGGGTTTCCATGCAGG - Intronic
1120706042 14:87746806-87746828 ACTCAGGCGGCTAACCACGCAGG + Intergenic
1122454902 14:101842505-101842527 ACTCATCAGGGTCCCCACCCAGG + Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1124345310 15:28918250-28918272 ACAGAGCCGGGTCTCAACCCAGG + Intronic
1137539906 16:49355189-49355211 TCTCAGCCAGGTCTCCTCGCTGG + Intergenic
1137554644 16:49462956-49462978 ACTCAGCTGGTTTTCCACCCAGG - Intergenic
1140198468 16:72875319-72875341 ACCAAGCCAGGTCTCCCCGCTGG - Intronic
1142165301 16:88583684-88583706 CTGAAGCCGGGTCTCCACGCTGG - Intronic
1146186470 17:30727630-30727652 GCTCAGCGGGGGCTCCACTCTGG + Intergenic
1147274575 17:39304809-39304831 ACTCACCCGGCTGTCCAGGCTGG + Intronic
1147622707 17:41878417-41878439 ACACAGCCGGGAGTCCAGGCAGG + Intronic
1147995645 17:44358943-44358965 ACCCAGCCAGGTCCCCTCGCAGG + Intronic
1152502393 17:80721089-80721111 CGTCTGCCGGGTCTCCAAGCAGG + Intronic
1152742403 17:82024072-82024094 ACCAAGCCGGCTCTGCACGCGGG - Intronic
1154122948 18:11666325-11666347 GCTGAGCTGGGGCTCCACGCAGG - Intergenic
1159964683 18:74583756-74583778 ACACACCCGGGTCTACACGTGGG + Intronic
926329107 2:11810313-11810335 ACTCAGCTGAGTCTCCATGGAGG + Intronic
927149253 2:20186296-20186318 CCTCAGCAGGGTCTCCAGGCAGG + Intergenic
927929113 2:27032931-27032953 ACTCTGCCACGTCTCCTCGCAGG - Intronic
932566858 2:72916241-72916263 ACTCTGCGGGGACTCCAGGCCGG - Intronic
934067174 2:88350851-88350873 ATTCAGCCGGGTCGCCGCTCTGG - Intergenic
936531242 2:113278237-113278259 CCCCAGCTGGGTCCCCACGCGGG + Intronic
1172146785 20:32762832-32762854 ACCCAGCCGGGTCTCCAACCCGG - Intronic
1172834941 20:37867351-37867373 ACTCATCCAGGTCTCCGCCCTGG + Intronic
1172963505 20:38816219-38816241 ACTCAGCTGGGTTTCCCCACAGG - Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1176030163 20:63007820-63007842 ACTCGGCCGGGCCTCCAGGCAGG - Intergenic
1179716196 21:43290060-43290082 AATCAGGCGGGTCTCCAGGGAGG - Intergenic
1180140174 21:45888488-45888510 ACTCACCTGGGTCTCCCAGCCGG + Intronic
1180187359 21:46146168-46146190 ACTCAGCCGGGTCTCCACGCAGG + Intronic
1183966621 22:41446373-41446395 ACTCACTCGGGTCTCCGCGGCGG + Exonic
953157552 3:40388226-40388248 ACTCAGCTGGGTTTCAACACCGG + Intronic
954436750 3:50500358-50500380 ACTCAGCCAGGACTCCACAGAGG + Intronic
968810685 4:2798455-2798477 TCTGAGCCTGGTCTCCATGCAGG - Intronic
980625615 4:135371497-135371519 CCTCAGACTGGTCTCCAAGCTGG + Intergenic
981423013 4:144572648-144572670 ACTCAGGCTGTTCTCCAAGCTGG - Intergenic
985764256 5:1768545-1768567 ACTCCGCCTGGACGCCACGCTGG - Intergenic
986829588 5:11560996-11561018 ACTCAGGCAGGTCTCCAGGCAGG + Intronic
987012004 5:13776337-13776359 CCTCAGCTGGATCTCCAGGCAGG - Intronic
989099654 5:37812002-37812024 ACTCCACCAAGTCTCCACGCAGG + Intergenic
994670144 5:102754677-102754699 ACTCAGCCAGGTCTCCAGGCTGG + Intronic
1001250170 5:170140969-170140991 ACTCAGGCTGTTCTCCAAGCTGG + Intergenic
1002548651 5:179970467-179970489 ACTAAGCCAGGGATCCACGCAGG + Exonic
1003712014 6:8602842-8602864 GCTCAGCTGGGTCCCCAAGCAGG - Intergenic
1003927195 6:10887304-10887326 ATTCTGCCTGGTCTCCCCGCAGG - Intronic
1007376020 6:41457158-41457180 ACTCAGCCAGGTCACCCTGCAGG + Intergenic
1015636849 6:135285015-135285037 AATCAGCCGGGTCTCATGGCAGG - Exonic
1024209397 7:47190732-47190754 ACACAGCCAGATCTCCACTCTGG - Intergenic
1034412060 7:150947036-150947058 ACTCAGCCGGGTCTCCAGCCTGG + Exonic
1039064949 8:33599614-33599636 TTTCAGCTGGCTCTCCACGCTGG - Intronic
1040906232 8:52472323-52472345 CCTCAGCCTGCTCTCCATGCGGG + Intergenic
1041689823 8:60678447-60678469 CTTCAGGCGGGTCTCCCCGCCGG - Intergenic
1042266765 8:66916446-66916468 ACTCAGCAGGGTTGCCAGGCAGG + Intronic
1043889029 8:85635889-85635911 ACAAAGCGGGGTCTCCACCCTGG - Intergenic
1052157919 9:25217339-25217361 ACTCAGCTGGGACTACAGGCGGG - Intergenic
1053001168 9:34578008-34578030 ACTGACCTGGGTCCCCACGCAGG + Intronic
1055023473 9:71694514-71694536 TAACAGACGGGTCTCCACGCTGG + Exonic
1057110733 9:92468304-92468326 ACTCAGCCAGCTCACCATGCAGG - Intronic
1061951750 9:133940123-133940145 ACTCACCCTGGTCTCCCTGCTGG - Intronic
1186449747 X:9662127-9662149 ACACAGCCTGGCCTCCACTCCGG - Intronic
1200048929 X:153418221-153418243 ACTAAGCAGGGTCTTCAAGCAGG + Intergenic