ID: 1180188239

View in Genome Browser
Species Human (GRCh38)
Location 21:46150897-46150919
Sequence CTCAGTCACCCCGACAAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180188239_1180188244 -10 Left 1180188239 21:46150897-46150919 CCGCACTTGTCGGGGTGACTGAG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1180188244 21:46150910-46150932 GGTGACTGAGTCCACGTGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 125
1180188239_1180188248 15 Left 1180188239 21:46150897-46150919 CCGCACTTGTCGGGGTGACTGAG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1180188248 21:46150935-46150957 TCTGACCTCTGCCCTTGGCCGGG 0: 1
1: 1
2: 5
3: 44
4: 325
1180188239_1180188249 16 Left 1180188239 21:46150897-46150919 CCGCACTTGTCGGGGTGACTGAG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1180188249 21:46150936-46150958 CTGACCTCTGCCCTTGGCCGGGG 0: 1
1: 0
2: 3
3: 24
4: 306
1180188239_1180188253 27 Left 1180188239 21:46150897-46150919 CCGCACTTGTCGGGGTGACTGAG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1180188253 21:46150947-46150969 CCTTGGCCGGGGCCTAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 91
1180188239_1180188247 14 Left 1180188239 21:46150897-46150919 CCGCACTTGTCGGGGTGACTGAG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1180188247 21:46150934-46150956 CTCTGACCTCTGCCCTTGGCCGG 0: 1
1: 0
2: 2
3: 48
4: 443
1180188239_1180188246 10 Left 1180188239 21:46150897-46150919 CCGCACTTGTCGGGGTGACTGAG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1180188246 21:46150930-46150952 GGGACTCTGACCTCTGCCCTTGG 0: 1
1: 0
2: 3
3: 38
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180188239 Original CRISPR CTCAGTCACCCCGACAAGTG CGG (reversed) Intronic
901464662 1:9413520-9413542 CTCATTCACCCCCACAAGCAAGG - Intergenic
903422253 1:23226431-23226453 CTCTGTCACCCCGGCTAGAGTGG + Intergenic
904182253 1:28674302-28674324 CTCTGTCACCCAGACCAGTGTGG - Intronic
904219302 1:28952005-28952027 CTCAGTTCCCCTAACAAGTGAGG - Intronic
911092462 1:94028792-94028814 CTCAGCCCCCCCGAGTAGTGGGG - Intronic
1065917583 10:30365945-30365967 CTCAGACAACCCAACAAGGGAGG + Intronic
1070762757 10:79034993-79035015 CTAAGTCACATCGACAAGTGTGG - Intergenic
1075936027 10:126342097-126342119 CACAGTCATCCCTGCAAGTGGGG - Intronic
1077239122 11:1501516-1501538 CTCAGTCACCCACACTAGGGCGG + Intergenic
1078742445 11:14079902-14079924 GTCAGTCACCCCATCAAATGTGG - Exonic
1080855678 11:36109556-36109578 CTCAATTACCCAGACTAGTGGGG - Intronic
1083023875 11:59533485-59533507 CTCTGTCACCCAGGCAAGAGTGG - Intergenic
1083935243 11:65866643-65866665 TTCAGTCACCCCGAGAGGAGAGG - Exonic
1085301984 11:75464031-75464053 CTGTGTCCCCCAGACAAGTGTGG + Intronic
1092366600 12:7881584-7881606 CTGAGCCTCCCCGACAAGCGCGG + Intronic
1114528669 14:23381765-23381787 CTCAGTCAACCACACAAGGGTGG - Intergenic
1119366780 14:74099644-74099666 CTCAGTCTCCCCGAGAATTTGGG + Intronic
1121491805 14:94366446-94366468 CTTAGTCACCCCAACAAGCGTGG - Intergenic
1123174486 14:106403371-106403393 ACCAGTCACCTCCACAAGTGAGG - Intergenic
1123182705 14:106484316-106484338 ACCAGTCACCTCCACAAGTGAGG - Intergenic
1202944201 14_KI270726v1_random:12413-12435 ACCAGTCACCTCCACAAGTGAGG + Intergenic
1124633076 15:31348200-31348222 CACAGTCATCCTGACAAGAGTGG - Intronic
1129211470 15:74072335-74072357 CTCAGACAACCCAACAAGGGAGG + Intronic
1129476072 15:75785451-75785473 CTCAGACAACCCAACAAGGGAGG - Intergenic
1130276303 15:82477951-82477973 CTCAGACAACCCAACAAGGGAGG + Intergenic
1130468665 15:84205344-84205366 CTCAGACAACCCAACAAGGGAGG + Intergenic
1130485084 15:84394418-84394440 CTCAGACAACCCAACAAGGGAGG - Intergenic
1130495610 15:84468235-84468257 CTCAGACAACCCAACAAGGGAGG - Intergenic
1130590958 15:85209943-85209965 CTCAGACAACCCAACAAGGGAGG + Intergenic
1131053425 15:89362415-89362437 CCCCTTCACCCCGACCAGTGCGG - Intergenic
1131188403 15:90294289-90294311 CTCAGACAACCCAACAAGGGAGG - Intronic
1131881970 15:96871524-96871546 CTCAGATACCCCGCCAGGTGTGG - Intergenic
1132432555 15:101773156-101773178 CTCAGACAACCCAACAAGGGGGG + Intergenic
1138106324 16:54288850-54288872 CTCAGTCACGCCGGCGGGTGGGG + Intergenic
1139327222 16:66161826-66161848 CTCAGACTCCCCGACAACAGTGG + Intergenic
1141433362 16:83982474-83982496 CCGAGTCACCCAGACAAGGGTGG + Intronic
1144742729 17:17593000-17593022 CTCAGTCACCCAGACTGCTGGGG + Intergenic
1148912601 17:50950866-50950888 ATCAGGCACCCCGCCCAGTGTGG - Intergenic
1161376062 19:3939557-3939579 CTCAGTCTCCCCAAGAAGGGTGG - Intronic
1162484803 19:10953066-10953088 CTCAGTCACCCAGGCAGGAGCGG + Intergenic
1163243321 19:16077078-16077100 CTCATTCTCCCCCACAAGTCCGG - Intronic
1164229594 19:23275750-23275772 CTCATTCTCCCCAGCAAGTGTGG + Intergenic
1164245072 19:23421492-23421514 CTCATTCTCCCCAGCAAGTGTGG + Intergenic
1164308982 19:24030030-24030052 CTCATTCTCCCCAGCAAGTGTGG - Intergenic
1166127614 19:40725185-40725207 CTCACTCACCCCAACAAGCCTGG + Intronic
1166712827 19:44948379-44948401 CTCAGTCCCCCCCACCAGAGTGG + Intronic
1166873180 19:45882948-45882970 ATCAGCCACCCGGACAGGTGCGG + Intergenic
926939940 2:18124813-18124835 CTATGTCACCAGGACAAGTGAGG - Intronic
927231262 2:20826317-20826339 CTCAGCCTCCTGGACAAGTGAGG - Intergenic
928401074 2:30979196-30979218 CGCAGTCACCCAGACGAGAGGGG + Intronic
929391837 2:41478065-41478087 GTCAGTCACCCAGCCAAGTCTGG + Intergenic
929547253 2:42863689-42863711 CCCAGACACCTCGAGAAGTGGGG + Intergenic
931645321 2:64416870-64416892 CTCAGTTACCTGGACAGGTGTGG + Intergenic
937660432 2:124424343-124424365 CTCTGTCAGCCCTCCAAGTGGGG + Intronic
940637692 2:156318876-156318898 CTCTGTCTCCCTGACAGGTGCGG - Intergenic
945152278 2:206803749-206803771 CTCTGTCACCCCCAGCAGTGAGG + Intergenic
1177006561 21:15679743-15679765 CTCTGTCACCCAGGCTAGTGCGG - Intergenic
1178499307 21:33112614-33112636 CACAGTCACCAGGAAAAGTGGGG - Intergenic
1179242423 21:39603886-39603908 CTAAGTCAGCCCAAAAAGTGGGG + Intronic
1180188239 21:46150897-46150919 CTCAGTCACCCCGACAAGTGCGG - Intronic
1180919714 22:19515259-19515281 CTAAGTCACTCAGACAAGTAGGG + Intronic
1182724663 22:32434626-32434648 CTCAGTAATCCCTAAAAGTGAGG - Intronic
950899883 3:16487998-16488020 CTCTGCCAGCCCCACAAGTGAGG + Intronic
952543120 3:34388858-34388880 GACAGTCAGCCCAACAAGTGTGG - Intergenic
957628604 3:82688361-82688383 CGCAGTCACTCCGACATCTGTGG - Intergenic
958938777 3:100287145-100287167 CTCTGTCACCCAGACTAGAGTGG + Intronic
962877123 3:139543603-139543625 CTCTGCCACCCCAACAACTGGGG - Intergenic
966112068 3:176414972-176414994 CTCAGTGACTCCTACAATTGTGG + Intergenic
969900858 4:10348017-10348039 CTCAGTCACCTCCACAAAGGAGG - Intergenic
976670951 4:87653458-87653480 CTCTGTCACCCAAACAGGTGTGG + Intronic
977902375 4:102437370-102437392 CTCACTCACCCAGAAAAATGGGG - Intergenic
985492158 5:186476-186498 GTCACTCACCCCGCCACGTGAGG + Exonic
992453045 5:76890611-76890633 CTCTGTCACCCAGGCTAGTGTGG - Intronic
1002059131 5:176616066-176616088 CTCTGTCACCCCACCAACTGTGG - Intergenic
1005517025 6:26564588-26564610 CTCAGTCACCCAGACTGGAGTGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020575435 7:9921169-9921191 CTCAGTCACAGAGACAAGAGAGG + Intergenic
1028413793 7:90558568-90558590 CTCAGACATCCCAAGAAGTGAGG + Intronic
1029175380 7:98660909-98660931 ATCACTCACCCCTACAAATGAGG - Intergenic
1034291492 7:149935971-149935993 CACAGTCACCCCCAAAAGTATGG + Intergenic
1035568344 8:656630-656652 CCCTGTCACTCTGACAAGTGTGG + Intronic
1040453060 8:47567619-47567641 CTCAGTTACTCAGAGAAGTGAGG + Intronic
1042785126 8:72537513-72537535 CACAGCCACCCAGACAAGAGAGG - Exonic
1043552924 8:81395334-81395356 CTCACTCACCACGACAAGCAGGG + Intergenic
1049541018 8:143209039-143209061 ATCAGTCACCCTCACAAGTGGGG + Intergenic
1056053269 9:82792623-82792645 CTCAGTCAGACCTACAACTGTGG - Intergenic
1056419122 9:86406594-86406616 CTGAGTCACCCCGACACAGGGGG + Intergenic
1185795533 X:2961228-2961250 CTCAGTCTCGCCGAGAAGTGAGG + Intronic
1186281161 X:7994770-7994792 CTCAGTGACCCCCAGGAGTGAGG + Intergenic
1191931810 X:66381945-66381967 CTCAGTGATACAGACAAGTGGGG + Intergenic
1201112451 Y:10809489-10809511 CTCTGTCACCCAGACAGGAGTGG + Intergenic
1202373021 Y:24210872-24210894 CTCAGACAACCCAACAAGGGAGG + Intergenic
1202497761 Y:25459248-25459270 CTCAGACAACCCAACAAGGGAGG - Intergenic