ID: 1180190083

View in Genome Browser
Species Human (GRCh38)
Location 21:46158782-46158804
Sequence TGTCTCCTGGGGCAGCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180190083_1180190090 0 Left 1180190083 21:46158782-46158804 CCCGGGTGCTGCCCCAGGAGACA No data
Right 1180190090 21:46158805-46158827 TGGCCACGCCAGCCACTTCAGGG No data
1180190083_1180190089 -1 Left 1180190083 21:46158782-46158804 CCCGGGTGCTGCCCCAGGAGACA No data
Right 1180190089 21:46158804-46158826 ATGGCCACGCCAGCCACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180190083 Original CRISPR TGTCTCCTGGGGCAGCACCC GGG (reversed) Intergenic
No off target data available for this crispr