ID: 1180190933

View in Genome Browser
Species Human (GRCh38)
Location 21:46162119-46162141
Sequence GTGGCCGAGGGCACCCTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180190933 Original CRISPR GTGGCCGAGGGCACCCTCGA GGG (reversed) Intronic
901662409 1:10806809-10806831 GTGGAAAAGGGCACCCTGGATGG - Intergenic
905182994 1:36178132-36178154 GTGGGCGAGGGCGCCGGCGAAGG - Exonic
907281632 1:53350803-53350825 GTGGCTGAGGCCTCCCTCCATGG - Intergenic
915546017 1:156598364-156598386 GTGGGAGAGGGGACCCTTGAGGG - Intronic
917640549 1:176979364-176979386 CAGGCCTAGGGCACCCTGGATGG - Intronic
919573207 1:199274330-199274352 GTGGCAGAGGGCACTGTAGATGG - Intergenic
919984205 1:202661541-202661563 GTGGCATAGGGCAACCACGAGGG - Intronic
1072151667 10:92689659-92689681 CCGGCCGAGGACGCCCTCGAGGG - Intergenic
1074907232 10:117875393-117875415 GTGGCTGAGGTGACCCTCTAGGG - Intergenic
1078665352 11:13320369-13320391 GAAGCTGAGGGCACCCTCAAAGG - Intronic
1079355923 11:19730361-19730383 TTGGCCAAGGGCACCCTGGAGGG + Intronic
1081969130 11:47186223-47186245 GTGGCCGGGGGCTCCCTGGGCGG + Intronic
1083013470 11:59426444-59426466 GTGGCAGAGGGCAGCCTCTTGGG - Intergenic
1084174821 11:67417678-67417700 GTGCCCAAGGGCTCCCTGGAGGG + Intronic
1084711375 11:70845991-70846013 GTGGCCAAGGGCAGCCGCCAAGG + Intronic
1088892792 11:114058488-114058510 GTGGCCGAGAGCGCCATCCAGGG - Intergenic
1103954149 12:124567278-124567300 GGGGCCGAGGGTCCCCGCGAAGG - Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107624263 13:42267085-42267107 GTGTCCAAGGGCACCCAAGAGGG - Intergenic
1108221025 13:48233335-48233357 GCGGCCTGGGGCGCCCTCGAAGG - Exonic
1114055551 14:18964828-18964850 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1114106995 14:19436935-19436957 GTGTCCCAGGGCACCCTCAGTGG + Intergenic
1116984272 14:51203333-51203355 TTGGCTGAGGCCACCCTCAAGGG - Intergenic
1117353429 14:54902359-54902381 ATGGCCGAGGCCGCCCTCCAGGG + Exonic
1123155561 14:106221626-106221648 GTGGACGAGGACAACCTCTATGG - Intergenic
1123402221 15:19998766-19998788 GTGGACGAGGACAACCTCTATGG - Intergenic
1129663197 15:77564851-77564873 GTGGCCTTGGGCACCCAAGATGG - Intergenic
1133453913 16:5926016-5926038 GTGAGCAAGGGAACCCTCGAGGG - Intergenic
1135293483 16:21260205-21260227 GGGACAGAGGGCACTCTCGAGGG + Intronic
1139952997 16:70680936-70680958 GTGGCCCAGGGCACCCCAGCAGG - Intronic
1142230542 16:88898209-88898231 GTGGCCGCGGGCGCCCCTGAGGG - Intronic
1147313610 17:39608377-39608399 GTGGCCAAGGGGACCCTCCTGGG - Intronic
1153565613 18:6414739-6414761 GCGGCCGTGGGCACCCACGCGGG + Intronic
1159770851 18:72543842-72543864 GGGGCCGAGGGGACCCGCGAGGG - Intronic
1159965067 18:74587293-74587315 GTGAGCGAGGGCTCCCCCGAGGG + Intergenic
1160954933 19:1686816-1686838 GCGGCTGAGGCCACCCTAGAAGG + Intergenic
1161766593 19:6211973-6211995 ATGGCCGAGCCCACGCTCGAGGG + Intergenic
1162565030 19:11441277-11441299 ATGGCCGAGGTCACCCGCGAAGG + Exonic
1163849352 19:19654596-19654618 CTGGACGACGGCACCCTCGTGGG - Exonic
1167660699 19:50794476-50794498 GAGGCCCAGGGCCCCCTGGAGGG - Exonic
925298990 2:2796480-2796502 GTGGCTGAGGGGAGCCTGGAAGG + Intergenic
927241235 2:20921023-20921045 GTGCCAGAAGGCTCCCTCGATGG - Intergenic
932689114 2:73897336-73897358 GTTGCTGAGGGGACCCTAGAGGG + Intronic
932699599 2:73984324-73984346 GAGGCTAAGGGCACCCTCGCAGG - Intergenic
933983582 2:87573024-87573046 GAGGCTCAGGCCACCCTCGATGG + Intergenic
934717522 2:96552201-96552223 GTGGCGGAGGGCACTGTCGAAGG - Exonic
935695049 2:105764033-105764055 GGGGCTGAGGGCAGCCTCGTGGG - Intronic
936531391 2:113278869-113278891 CGGGCCCAGGGCACCCTCGCGGG - Exonic
938378798 2:130825329-130825351 GTGGGCGAGGGCTCCTTTGATGG - Intergenic
1169141501 20:3229614-3229636 GTGGCCGAGGGCAGCTCCGTGGG + Exonic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172178307 20:32985853-32985875 CTGGCCGCGGTCACCCTCAAAGG + Exonic
1175998827 20:62822948-62822970 GTGGCCAAGGGCGCCCTCTGCGG - Intronic
1180000698 21:44994060-44994082 CAGGTCGAGGGCACCATCGAGGG + Intergenic
1180190933 21:46162119-46162141 GTGGCCGAGGGCACCCTCGAGGG - Intronic
1180474028 22:15687380-15687402 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1181478423 22:23182155-23182177 GTGTCCGAGGCCACCATCGTGGG + Exonic
1181573741 22:23781371-23781393 GTGGCCCTGGGCATCCTCGAAGG - Exonic
1183683668 22:39349893-39349915 GCGGCCCAGGGCTCCCGCGAGGG - Intergenic
1183931606 22:41238749-41238771 GTGGCCGAGGGCGCCTTCCGTGG - Exonic
1185132465 22:49046922-49046944 TTGGCCGACGGCACCCTGGCTGG + Intergenic
949925479 3:9037739-9037761 GTGGCTGAGGGCAGCCTGTAGGG - Intronic
950663210 3:14479741-14479763 GTGGGCGAGAGCATCCTCGTGGG - Intronic
954752871 3:52823527-52823549 GTGGCCAAAGCCACCCTGGAGGG - Intronic
963067910 3:141278479-141278501 GTGGCCGAGCGCAGCATGGAAGG + Exonic
966786736 3:183629431-183629453 GTGGCAGATGGCACCCTTGAGGG + Intergenic
968708535 4:2095530-2095552 GTGGACGAGGGTCTCCTCGAAGG + Intronic
968980987 4:3849212-3849234 GTGGCCAAGGCCACCCTGCAGGG - Intergenic
973760494 4:54110223-54110245 GTGTCCGAGGGCACCCAGCAGGG - Intronic
985653914 5:1120085-1120107 GGGGCTGAGGGGACCCTCCACGG + Intergenic
986903771 5:12468470-12468492 GTGGCAGAGTGCACACTCAATGG - Intergenic
991007655 5:61845806-61845828 GAAGCCGAGGGCACTCTCTAGGG + Intergenic
993901200 5:93585066-93585088 GTGGCCGGGGGCAACCCCGGCGG + Exonic
1002836637 6:870103-870125 ATGGCCGAGGGCACACCCCAGGG - Intergenic
1003137687 6:3445859-3445881 AGGGCTGAGGGCACCCTTGATGG + Intronic
1006415437 6:33900921-33900943 GTGGGCAGAGGCACCCTCGAGGG + Intergenic
1019153400 6:170023654-170023676 GTGGCCGAGGGGACCCCGGGTGG + Intergenic
1019539390 7:1545014-1545036 GTGGCCGAGGGCTCCCTTTCTGG - Exonic
1022400163 7:30028748-30028770 GTGGCCGCGGGCGCCATGGAGGG + Exonic
1023842326 7:44104474-44104496 GTGGGCGAGGGGACCCGGGAAGG - Exonic
1023863413 7:44228075-44228097 GGGGCAGAGGGCACCCTCCAGGG + Intronic
1030033359 7:105388584-105388606 GCGGCCGCGGGCGCCCCCGACGG + Intronic
1034746674 7:153529374-153529396 GTGGCCCAGGGCACCCACTGTGG + Intergenic
1037530058 8:19764362-19764384 GTGGCCGAGAGCACAATCCAGGG + Intergenic
1039579208 8:38650516-38650538 GTGGCCACGGGCACCCCAGAGGG + Intergenic
1185877579 X:3713177-3713199 GTGGCGGAGGAGACCCCCGACGG - Exonic
1188451058 X:30308655-30308677 GCGGCCGAGGGCCCCCTGGTGGG - Exonic