ID: 1180192381

View in Genome Browser
Species Human (GRCh38)
Location 21:46172122-46172144
Sequence GGATGCACAGAGTGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180192381 Original CRISPR GGATGCACAGAGTGTGAGGT GGG Intronic
900789838 1:4672653-4672675 GGATGCACACACTGGGAGGGCGG - Intronic
902804603 1:18853058-18853080 GGATGCCCAGAAGGTGAAGTGGG + Intronic
903034067 1:20483789-20483811 TTATGCCCAGAGTGGGAGGTCGG + Intronic
903569101 1:24291297-24291319 GAATGCACAGGGTGTGAGCAGGG - Intergenic
904943546 1:34182218-34182240 AAATGCAAAGACTGTGAGGTGGG + Intronic
905904804 1:41610904-41610926 GGGAGCACAGAGTGGGAGCTTGG - Intronic
905954772 1:41983147-41983169 GGCTGCACAGCCTGTGAGGTGGG - Intronic
906563586 1:46779014-46779036 GGAGGCACAGAGAGTGAGCAAGG + Intronic
906707338 1:47904300-47904322 GGAAGCACAGAGTGTGGTGGAGG + Intronic
907392689 1:54168560-54168582 GGGTTCACATAGTGGGAGGTGGG - Intronic
908002738 1:59696647-59696669 TGAAGGACACAGTGTGAGGTAGG - Intronic
908741154 1:67328988-67329010 AGAAGCACATAGTGTGAGGTTGG - Intronic
908774834 1:67629698-67629720 GGATGCACACAGTGTGTTGAAGG + Intergenic
908963290 1:69727894-69727916 GGAAGCTCTGAGTGTGAGGATGG + Intronic
909100825 1:71345791-71345813 GGACACACAAAGGGTGAGGTTGG + Intergenic
911442356 1:97943276-97943298 GTATGTACAGAGTGTGACTTGGG - Intergenic
911652462 1:100405169-100405191 GGAGGCAGAGAGTGAGGGGTAGG - Intronic
912724757 1:112049093-112049115 GGATACACAGAGTGTGGAGGTGG + Intergenic
913178721 1:116298496-116298518 GGAGGCACAGAGAGTGAGCGAGG + Intergenic
915348730 1:155211686-155211708 GGATCCAGGGAGTGTGAGGATGG + Intronic
915351923 1:155232312-155232334 GGATCCAGGGAGTGTGAGGATGG + Intergenic
917863137 1:179167386-179167408 GGCTGAAAAGAGTGGGAGGTGGG + Intronic
919580924 1:199371860-199371882 GAATGCACTGAGGGTGAAGTAGG + Intergenic
919948537 1:202341107-202341129 AGACGCACAGAGGGTGACGTTGG - Intronic
919977772 1:202623697-202623719 GCATGCTCTGAGTGTGAGGGAGG + Intronic
921159538 1:212463317-212463339 TGAGGCACAGCCTGTGAGGTGGG + Intergenic
922543131 1:226433943-226433965 GCATGCACAGCATGTGAGATGGG + Intergenic
922637599 1:227190862-227190884 GAATGGGCAGAGTGTGTGGTGGG + Intronic
923112523 1:230903554-230903576 GGATGCGCAGTGTGTTGGGTTGG + Intergenic
1063517304 10:6709593-6709615 TGATGCCCAGAGGGTGAGGAAGG + Intergenic
1064493752 10:15886313-15886335 GGATGAGCAGAGGCTGAGGTGGG + Intergenic
1065992279 10:31023878-31023900 GGAAGCACAGAGTTTGAGATTGG - Intronic
1066517391 10:36178208-36178230 GGATTCATACAGTGTGGGGTGGG + Intergenic
1067060047 10:43073624-43073646 GGAAGCACAGACTCTGAGGCTGG - Intergenic
1067444114 10:46329883-46329905 GGTTGCACAGAGTCTGTGCTTGG - Exonic
1070368406 10:75758177-75758199 GGAGGCAAAGGGTGTGAGGGGGG + Intronic
1070492905 10:76994042-76994064 GGCTCCACAGAGTGTGGAGTCGG - Intronic
1070764767 10:79050013-79050035 GGCTGCACAGAGAGTCAGGGAGG - Intergenic
1070833058 10:79432057-79432079 GGGAGCACAGAGTGTGGGGCAGG + Intronic
1072933693 10:99691486-99691508 GGAAGGACAGAGGTTGAGGTAGG - Exonic
1073139910 10:101240155-101240177 GGAGGCACAGACTGTGTGGCAGG + Intergenic
1073302061 10:102476873-102476895 GGGTGGACGGAGTGGGAGGTGGG - Exonic
1075914899 10:126158544-126158566 GGATGCACAGAGCATGGGGCAGG + Intronic
1075914906 10:126158566-126158588 GGATGCACAGAGCCGGGGGTGGG + Intronic
1075914923 10:126158634-126158656 GGATGCACAGAGCATGGGTTGGG + Intronic
1076835537 10:133019336-133019358 AGCTGCACAGAGTGCGAGGCAGG - Intergenic
1077106434 11:844452-844474 AGATGCACAGAGCCTGAGGCTGG - Exonic
1077178338 11:1200648-1200670 GGAGGCAGAGAGTGGGAGCTGGG + Intronic
1077233595 11:1469399-1469421 GGATGCCCACAGTGTGGGGGGGG + Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1079769856 11:24445339-24445361 GGAGACAGAGAGAGTGAGGTGGG - Intergenic
1080134325 11:28836710-28836732 GGATGCACAGAGTGGGAACAAGG + Intergenic
1080223453 11:29934055-29934077 GGAGGCACTGAGAGTGAGGGAGG - Intergenic
1081363126 11:42204380-42204402 GGATACACAGTGTCTGGGGTGGG + Intergenic
1081396941 11:42597314-42597336 GGATGCAGAGGGTGTGATGTAGG - Intergenic
1082935137 11:58647971-58647993 GAATGCCCAGAGTGTGAGAGGGG - Intronic
1084277629 11:68062686-68062708 GGATGAACAGAGAGTAGGGTTGG - Intronic
1084422187 11:69066001-69066023 GGAGGTACACAGTGTGGGGTGGG + Intronic
1085968538 11:81558538-81558560 AGATCCACAGAGTATGAGCTTGG + Intergenic
1088130296 11:106480706-106480728 TGAAGCTCAGTGTGTGAGGTGGG + Intergenic
1088852906 11:113719885-113719907 GGATGGAAAGAGTGTATGGTCGG - Intergenic
1089588235 11:119523465-119523487 GGGTCCCCACAGTGTGAGGTAGG + Intergenic
1089591641 11:119545976-119545998 GGTTGCACACAGAGTGGGGTGGG + Intergenic
1090440700 11:126723050-126723072 GGCTGCACATAGTGTACGGTAGG + Intronic
1091596745 12:1883552-1883574 GGATGAACACGGTGGGAGGTGGG - Intronic
1098226305 12:68328843-68328865 GAATGCTCAGAATGGGAGGTGGG - Intronic
1099540979 12:83907388-83907410 TGATGCCCAGTGTTTGAGGTGGG + Intergenic
1100081536 12:90858149-90858171 GGACACAAAGAGAGTGAGGTTGG + Intergenic
1100282903 12:93135425-93135447 GGTAGCACAGAGTGTGTGTTGGG - Intergenic
1100441167 12:94618393-94618415 TGAGACACAGAATGTGAGGTAGG - Intronic
1103636980 12:122315037-122315059 GGATGCACAGCTTGTGATGTCGG - Intronic
1103860715 12:124010962-124010984 GGAAGCACAGGGAGTGAGGTGGG + Intronic
1104522096 12:129485525-129485547 GGATGCACAGACTTGGAAGTGGG - Intronic
1104908198 12:132226692-132226714 GTATGTACAGTGTGTGGGGTGGG - Intronic
1104908209 12:132226753-132226775 GTATGTACAGTGTGTGGGGTGGG - Intronic
1106085849 13:26540765-26540787 AGATGCAAAGCGTGTAAGGTCGG - Intergenic
1106090904 13:26592544-26592566 GGGTGCAGAGAGTGTGAGTTTGG + Intronic
1112597911 13:100826159-100826181 GGATGCAGAGAGCATGAGGCGGG - Intergenic
1112883123 13:104133964-104133986 GGATGCCCAGAGTGTAAAGAAGG + Intergenic
1113882456 13:113635331-113635353 GGACCCACAGAGTGTCAGGAGGG + Intronic
1114577676 14:23728711-23728733 GGATGCACAGCCCATGAGGTGGG + Intergenic
1115164914 14:30437417-30437439 AGATGCACAGAGATAGAGGTTGG - Intergenic
1117048851 14:51840548-51840570 AGATGCAGAGAGTTTGAGATTGG - Intronic
1117180583 14:53187184-53187206 GGCTGCAAAGAGGGTGAGGGAGG + Intergenic
1118506477 14:66418839-66418861 GGTTGCACAGGGTATGTGGTGGG + Intergenic
1118726866 14:68634838-68634860 AGATGGACAGAGTATGAGGGAGG + Intronic
1118815824 14:69313318-69313340 GGATGGAGGGAGTGTGAGGCTGG - Intronic
1120156635 14:81100739-81100761 AGATGCATAGGGTGAGAGGTAGG + Intronic
1120715582 14:87837691-87837713 GGATACATAGAATGTGAGGAGGG - Intergenic
1121234332 14:92380979-92381001 GTGTGCACATAGTGAGAGGTGGG + Intronic
1122637452 14:103137002-103137024 GGATGAACGGAGGGTGCGGTGGG - Exonic
1122769385 14:104091257-104091279 GGATGCCCAGGGTCTGAGGTTGG + Intronic
1122792655 14:104190860-104190882 GCAGGCACAGAGGCTGAGGTGGG + Intergenic
1122793352 14:104193636-104193658 GGAGGCACTGAGGGTGAGGAGGG - Intergenic
1123627885 15:22239862-22239884 GGAAGCAGAGAGGGTGAGGAAGG - Intergenic
1123775445 15:23574871-23574893 GCAGGCACACAGTGTGAGATTGG + Intronic
1123927658 15:25134060-25134082 GTATGGACACAGGGTGAGGTTGG + Intergenic
1124493416 15:30172064-30172086 GCATGCTCTGAGTGTGAGGGAGG + Intergenic
1124750118 15:32366261-32366283 GCATGCTCTGAGTGTGAGGGAGG - Intergenic
1125760787 15:42094261-42094283 GGATGCAGAGTGGGTGGGGTGGG - Intronic
1126008761 15:44283047-44283069 GGATGAGCAGAGGGTGAAGTTGG - Intergenic
1128145861 15:65332192-65332214 AGATACACAGGGTGAGAGGTGGG + Intronic
1130048728 15:80465850-80465872 GGATGCTGAGAGTGTGCGATGGG - Intronic
1130948321 15:88566251-88566273 TGAAGCACAGAGAGTCAGGTGGG + Intergenic
1132208958 15:100006313-100006335 GAATGCAGTGAGTGTGTGGTTGG - Intronic
1133451461 16:5907274-5907296 GCATGCACAGAGGATGAGGCAGG - Intergenic
1133868499 16:9666238-9666260 GGGTGCAAAGAGTGTGGGCTGGG + Intergenic
1136014465 16:27386573-27386595 GGATTAACTGAGTGTGTGGTTGG - Intergenic
1136716613 16:32287687-32287709 TCATTCACAGAGGGTGAGGTGGG + Intergenic
1136834993 16:33493932-33493954 TCATTCACAGAGGGTGAGGTGGG + Intergenic
1138679130 16:58672362-58672384 GGAGGCTCAGAGTGGGAGATGGG + Intronic
1141167223 16:81668811-81668833 GAAGGCAGTGAGTGTGAGGTGGG - Intronic
1141167228 16:81668838-81668860 GAAGGCAGTGAGTGTGAGGTGGG - Intronic
1141167233 16:81668865-81668887 GAAGGCAATGAGTGTGAGGTGGG - Intronic
1141838686 16:86560038-86560060 GGATGCACACAGGCAGAGGTGGG + Intergenic
1141976069 16:87517477-87517499 GGAAGCAGAGAGGGTGAGGAAGG + Intergenic
1203009810 16_KI270728v1_random:230100-230122 TCATTCACAGAGGGTGAGGTGGG - Intergenic
1203145163 16_KI270728v1_random:1794253-1794275 TCATTCACAGAGGGTGAGGTGGG + Intergenic
1146185464 17:30721385-30721407 GGACACACAGAGAGTGAGGAGGG - Intergenic
1146693613 17:34892996-34893018 AGTTGCACTGAGGGTGAGGTGGG - Intergenic
1148983687 17:51601768-51601790 GGATGCACAGGGAGTGGGGAAGG + Intergenic
1149117274 17:53112469-53112491 GGATGCACAGATCTTGAGTTTGG - Intergenic
1150787680 17:68176059-68176081 GGAAGCAGAGAGTGGGAGGCAGG + Intergenic
1151100473 17:71550636-71550658 TGAGCCACAGAATGTGAGGTGGG + Intergenic
1151272845 17:73010179-73010201 TGAGGCACAGAGTCTGGGGTGGG + Intronic
1152550991 17:81030140-81030162 GAGAGCACAGAGTGGGAGGTAGG - Intergenic
1154213568 18:12399438-12399460 TGAGGCACTGAGTTTGAGGTAGG + Intergenic
1155313066 18:24543912-24543934 GGAAGCACAGTGTGTGAGGATGG - Intergenic
1155995237 18:32324262-32324284 GCGTACACAGAGTGTGAGGAGGG + Intronic
1156617089 18:38799759-38799781 GCATGGACACAGGGTGAGGTTGG - Intergenic
1157734332 18:50033294-50033316 GGATGCACAGAGTAAGAAGAGGG - Intronic
1159820524 18:73136461-73136483 GGATGTAGAGAGTGTGATGATGG + Intergenic
1160040949 18:75345000-75345022 GGAGGCACAGGCTGTGAGGAAGG + Intergenic
1160054731 18:75467679-75467701 CCATGCAGACAGTGTGAGGTTGG + Intergenic
1161168801 19:2802744-2802766 TGATGCCCAGAGGGTGAGGGCGG - Intronic
1161474113 19:4474860-4474882 GGATGCAGAGGGTGGGGGGTGGG - Intronic
1161537798 19:4830995-4831017 GGTGGTACAGGGTGTGAGGTTGG + Intronic
1161612648 19:5251627-5251649 GAATGCAGAGGGTGTGAGGCAGG + Intronic
1165333150 19:35152579-35152601 GGATGCAGGGAATGTGAGGATGG + Intronic
1165780913 19:38433795-38433817 GGAAGCCCAGGGTCTGAGGTCGG - Intronic
1166946882 19:46402882-46402904 GGAGACACAGAGAGGGAGGTGGG - Intergenic
925039585 2:721027-721049 GGATGCACCCAGCATGAGGTAGG - Intergenic
927917577 2:26946877-26946899 GGAAGCACAGAGGGTGAGACGGG - Intronic
928936814 2:36688113-36688135 GGAGGCACAGAGAGAGAGGGAGG - Intergenic
929319107 2:40519392-40519414 GAAGGCACAGAGTGTCAGATTGG - Intronic
929683274 2:44012390-44012412 GGATGCACTGGGTGTGAGAGAGG - Intergenic
929996333 2:46828430-46828452 AGAGGCACAGAGTGAGAGGGAGG - Intronic
930422661 2:51174096-51174118 TGATTTACAGAGTTTGAGGTGGG - Intergenic
931265920 2:60660493-60660515 GGATGTAGAGAGTGTGAGTTGGG + Intergenic
931268010 2:60677810-60677832 GGAGGCACAGAGTTGGAAGTTGG - Intergenic
931332435 2:61301672-61301694 GGCTGAACATAGTGTGAGATAGG - Intronic
934887973 2:98041181-98041203 TGATCCACAGAGGGTGATGTTGG - Intergenic
935194788 2:100806702-100806724 TGATGCAAAGGGTGGGAGGTTGG - Intergenic
938160234 2:128979112-128979134 GGCTGCACAGAGAGTGAGTCTGG - Intergenic
939950004 2:148458765-148458787 GGAGGCAAAGAGTGTGACGGAGG + Exonic
940619365 2:156091848-156091870 GGATGCAGAAAGTATGAAGTAGG - Intergenic
945784120 2:214212398-214212420 GGATGCAGGGAGTGGGTGGTCGG - Intronic
1169027432 20:2382692-2382714 TCAGGCACAGAGTGTGTGGTAGG - Intronic
1169180730 20:3564476-3564498 TGAGACACTGAGTGTGAGGTTGG + Intronic
1170787657 20:19481640-19481662 GGATGAGCAGAGTTTGATGTTGG + Intronic
1171256855 20:23695178-23695200 GGGAGCACAGAGTTGGAGGTAGG + Intergenic
1171571171 20:26252830-26252852 GAAAGTACAGACTGTGAGGTTGG - Intergenic
1172342226 20:34167422-34167444 GGATGGCCAGAGAGTGAGTTGGG - Intergenic
1173213438 20:41056591-41056613 GGCTGCTCTGAGGGTGAGGTGGG - Intronic
1176168702 20:63687595-63687617 GAGGGCACAGAGTGTGAGGACGG - Intronic
1176267331 20:64217028-64217050 GGATGCACAGCCAGTGAGATGGG - Intronic
1180186628 21:46143289-46143311 GGAGGGACAGAGTGGGAGGGAGG - Intronic
1180192373 21:46172079-46172101 GGATGCACAGAGCATGAGGCAGG + Intronic
1180192381 21:46172122-46172144 GGATGCACAGAGTGTGAGGTGGG + Intronic
1180192386 21:46172145-46172167 GGATGCAAAGAGCGTGAGGCGGG + Intronic
1180192394 21:46172191-46172213 GGATGCACAGAGCGTGAGGCGGG + Intronic
1181338461 22:22159544-22159566 GGAAGCAGAGAGGGTGAGGAGGG - Intergenic
1181472876 22:23151765-23151787 GGACACACAGAGGGTGAGGGTGG + Intronic
1182753418 22:32659505-32659527 GGGTGCACAGAATGTGATGTGGG - Intronic
1183513148 22:38247699-38247721 GGCTGAACAGAGTGTGGGTTAGG - Intronic
1183830434 22:40415941-40415963 GGCTGCCGAGGGTGTGAGGTGGG - Intronic
949597627 3:5564583-5564605 TGTTGCAGAGAGTCTGAGGTGGG - Intergenic
950291634 3:11789366-11789388 GCAAATACAGAGTGTGAGGTGGG + Intergenic
955204879 3:56886888-56886910 GGAAGCACATAGTTTGAAGTAGG - Intronic
956806194 3:72814406-72814428 TGATTCAGTGAGTGTGAGGTGGG + Intronic
959051657 3:101530292-101530314 AGACACACAGAGGGTGAGGTTGG + Intergenic
964896967 3:161610119-161610141 GGAGGCAGAGTGTTTGAGGTGGG - Intergenic
966143523 3:176784467-176784489 ACATACACAGAGTCTGAGGTGGG + Intergenic
968066304 3:195761587-195761609 TGAGGGACAGAGTGGGAGGTTGG + Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969457392 4:7307989-7308011 GTGTGCACAGAGTGGGAGGTAGG + Intronic
974055953 4:56983178-56983200 GGAAGCACAGATTGTGAAGTTGG - Intronic
974369074 4:60990414-60990436 CAAAGCACAGAGTGTGAGGCTGG - Intergenic
975390789 4:73814952-73814974 GGAGGCAAAGAGAATGAGGTAGG + Intergenic
975923585 4:79422204-79422226 AAATGCACAGATTGTGGGGTAGG - Intergenic
977455179 4:97250220-97250242 GCACTCACAGAGTGTAAGGTGGG - Intronic
978582446 4:110245737-110245759 GGCTTCACAGAGTGGGAGGTTGG + Intergenic
979189990 4:117845041-117845063 GGAGGCAGAGTGTGTGAAGTAGG + Intergenic
979568656 4:122187921-122187943 TGATGCACAGAGTTTGCGGCTGG - Exonic
985111041 4:186546658-186546680 GCATGAACAGGGTGTGATGTGGG - Intronic
985195933 4:187429224-187429246 GGATCCCCAAAGTTTGAGGTAGG - Intergenic
986127200 5:4894095-4894117 GGATGCACAGGGAGTAAGCTAGG + Intergenic
989988400 5:50731203-50731225 GATTTCACAGAGTGTTAGGTTGG - Intronic
990285100 5:54293609-54293631 TCATGCACTGAGTGAGAGGTTGG - Intronic
991069526 5:62461213-62461235 GGATGGAAAGGGTGGGAGGTTGG + Intronic
993981107 5:94544769-94544791 TGATGTACAGAGTGTCAGGAAGG + Intronic
995494012 5:112722738-112722760 AGATGCACAGAGTGAGATATAGG + Intronic
997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG + Intronic
997758269 5:136420778-136420800 GGAGGGACAGAGTGAGAGGATGG - Intergenic
998129894 5:139646476-139646498 TGAGGCACAGACTGTGAGGGAGG - Intergenic
998737189 5:145155565-145155587 GAATGCACTGAGTGTGATTTTGG + Intergenic
999715363 5:154355926-154355948 GGAGGTACAGAGTGGAAGGTAGG - Intronic
1001886491 5:175295302-175295324 GGAGGCACAGAGTGGCAAGTTGG + Intergenic
1002106606 5:176882340-176882362 GGATGCACTGATGGTGATGTTGG - Intronic
1004804492 6:19187846-19187868 AGAAGCACAGAGTCTGAGGGGGG - Intergenic
1006836421 6:37001693-37001715 GGAGGGAGAGAGTGTGAGGGAGG + Intergenic
1007762014 6:44138789-44138811 GGCTGCACAGAGGTTGAGGCAGG - Intronic
1009031237 6:58060793-58060815 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1009207094 6:60815255-60815277 GGGTGAACAGAGTGTGAGATGGG - Intergenic
1010616398 6:78017705-78017727 GGGTGCACAGAGGGTGGGATTGG + Intergenic
1012460923 6:99459130-99459152 GGGTGCACAGGGTGGGAGGAGGG - Intronic
1013298140 6:108778442-108778464 GGACGCTCAGAGTGTGATGAAGG + Intergenic
1014091675 6:117411258-117411280 GGATGGAGAGAGTGGGAGGGAGG - Intronic
1015465953 6:133548921-133548943 GGAAGCACAGAGGGTAAGGAGGG + Intergenic
1015818881 6:137239005-137239027 AGAGGAACAGAATGTGAGGTTGG - Intergenic
1015979617 6:138825893-138825915 GGGTGTTCAGAGTGTGAAGTGGG - Intronic
1016000951 6:139040647-139040669 TGTTGCACAGAGTGTCATGTAGG + Intronic
1016893755 6:149032661-149032683 GGGTGCACAGGGTGGGAGGGAGG - Intronic
1017565072 6:155675034-155675056 GGATGCACAGAGCATGGGCTAGG + Intergenic
1018225323 6:161622534-161622556 GGCTGCATAGAGTGTGGGGGAGG - Intronic
1018317688 6:162573251-162573273 GCATGCACAGAGTGAGGGCTGGG - Intronic
1018379529 6:163245680-163245702 AGAAGCTCAGAGTGTGTGGTGGG - Intronic
1018462938 6:164016556-164016578 GAATGCACAGTGTGTTATGTGGG - Intergenic
1019256526 7:56018-56040 GGATGGAGAGAGTGTGAGTTGGG - Intergenic
1019554795 7:1623904-1623926 GGGAGCACAGAGTCTGGGGTCGG - Intergenic
1019635437 7:2073076-2073098 GGCTGCAGAGAGTGGGATGTGGG - Intronic
1021945215 7:25719758-25719780 GGATGAGCTGAGGGTGAGGTCGG + Intergenic
1023492937 7:40763629-40763651 GGTTGCACAGAGAATGAGATTGG + Intronic
1024605664 7:51020644-51020666 GCAAGCACTGAGTGTGGGGTGGG + Intronic
1026054145 7:66970329-66970351 GGATGGACTGAGTGTGAGGTAGG - Intergenic
1026535720 7:71237074-71237096 GGGTCCAGAGAGTGGGAGGTAGG + Intronic
1027159903 7:75794735-75794757 GGAGGCACAGTGTGTTAGGAGGG + Intergenic
1029594941 7:101532702-101532724 TGATGAACAGATAGTGAGGTGGG - Intronic
1030952443 7:115808149-115808171 GGATGCACAGAATATGGGATGGG - Intergenic
1032489808 7:132315914-132315936 GGAAGCCCAGAGTGGTAGGTTGG + Intronic
1032720752 7:134549303-134549325 GCATGGACAGAGTCTGAGGGAGG - Intronic
1034539733 7:151749367-151749389 GGAAGCAGAGAGAGTGAGGGAGG - Intronic
1035765096 8:2099213-2099235 GGAGGCCCTGAGGGTGAGGTGGG + Intronic
1037512710 8:19599891-19599913 GCATGCACTGGGTGTGGGGTAGG - Intronic
1040399909 8:47039598-47039620 TGATGCCCAGTGGGTGAGGTGGG - Intergenic
1041872197 8:62648003-62648025 GGATGTACAGAATGAGAAGTAGG + Intronic
1045660126 8:104428601-104428623 GGATGAACAGAGGGTGAGACTGG + Intronic
1047761514 8:127958088-127958110 GGATGGACAGAGTGGTTGGTTGG + Intergenic
1048008537 8:130438544-130438566 GGATGGGCAGGGTGTGAGCTGGG - Intronic
1048802765 8:138209289-138209311 GGATGTAGAGAGTGTGACATAGG + Intronic
1048948863 8:139476144-139476166 TGATGAACAGAGAGGGAGGTGGG + Intergenic
1049039648 8:140102836-140102858 GGGTGAACAGAGTGAGAGGCAGG - Intronic
1049498502 8:142948036-142948058 GGAAGCAAAGATGGTGAGGTAGG + Intergenic
1050463566 9:5897401-5897423 GGGTGCCCAGTGTGGGAGGTGGG + Intronic
1051539297 9:18196524-18196546 GGATGCAGAGAGCCTGAGCTTGG + Intergenic
1051816101 9:21106887-21106909 GACTGAACAGAGTGTGAGCTAGG - Intergenic
1053417409 9:37955409-37955431 GTATACACAGAGGGGGAGGTAGG + Intronic
1053487983 9:38475337-38475359 AGATGAAAAGAGTGTGAGGATGG - Intergenic
1186438068 X:9560553-9560575 GGTGTCACAGAGGGTGAGGTGGG + Intronic
1186467849 X:9797798-9797820 GGAGGCACAGTGGGTGGGGTGGG + Intronic
1188886985 X:35562593-35562615 GAATCCCCAGAGTGTGAGGTGGG - Intergenic
1190280702 X:48927579-48927601 AGATGCACAGAGTGAGATATGGG + Intronic
1190516332 X:51227257-51227279 GGAGGCATATTGTGTGAGGTGGG - Intergenic
1195385861 X:104313217-104313239 GGAGGCACAGAGAGGGAGGAAGG - Intergenic
1195850388 X:109276261-109276283 AGATGCACTGAGTGTGAGTGGGG - Intergenic
1197724891 X:129769614-129769636 GGAAGAAGAGAGGGTGAGGTGGG + Intergenic
1198019876 X:132647188-132647210 GGATGCACACAGCATGAGGTGGG - Intronic
1199489062 X:148378973-148378995 GGAGGCTCAGAGTGAGAGGAAGG + Intergenic
1200754431 Y:6977038-6977060 GGTGTCACAGAGGGTGAGGTGGG + Intronic
1200955254 Y:8938190-8938212 GGAGGCACAGAGAGTGAGCAAGG - Intergenic