ID: 1180193993

View in Genome Browser
Species Human (GRCh38)
Location 21:46182738-46182760
Sequence GAAGCAGGTGCGCCTCCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180193993_1180193996 1 Left 1180193993 21:46182738-46182760 CCTTCAGGAGGCGCACCTGCTTC 0: 1
1: 0
2: 1
3: 5
4: 155
Right 1180193996 21:46182762-46182784 TCAGGTCCGCGTTCTCGCTCAGG 0: 1
1: 0
2: 0
3: 1
4: 49
1180193993_1180193998 7 Left 1180193993 21:46182738-46182760 CCTTCAGGAGGCGCACCTGCTTC 0: 1
1: 0
2: 1
3: 5
4: 155
Right 1180193998 21:46182768-46182790 CCGCGTTCTCGCTCAGGAGCCGG 0: 1
1: 0
2: 2
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180193993 Original CRISPR GAAGCAGGTGCGCCTCCTGA AGG (reversed) Exonic
904014584 1:27409853-27409875 GGAGGAGGTGCTCCTCCTGTTGG + Exonic
906315941 1:44786447-44786469 GACGCAGGTGCGCCGCCCGCCGG - Exonic
907243145 1:53091625-53091647 GCAGCAGATGCACCTCCTGCAGG - Intronic
910131499 1:83912770-83912792 AAAGCATGTGCTCCTTCTGATGG + Intronic
910764690 1:90769964-90769986 GAAGCAGGAGCACATCCGGAAGG + Intergenic
912344947 1:108955501-108955523 GAAGCAGGCGACCCTCTTGAAGG - Intronic
915287435 1:154861925-154861947 GAGGCAGAAGCACCTCCTGAGGG + Intronic
916159075 1:161890717-161890739 GATGCAGGTCAGCCTGCTGAAGG + Intronic
916215280 1:162388513-162388535 GAATGAGGTGGGTCTCCTGATGG - Intergenic
918764269 1:188458500-188458522 GAGGCAGGTGCTCTTCCTGGGGG - Intergenic
921252679 1:213312192-213312214 GAATCAGAAGCTCCTCCTGATGG - Intergenic
924568239 1:245215454-245215476 GAAGCAGATGCTGCTCCTCAGGG + Intronic
924912247 1:248526536-248526558 GAAGCTGTTGAGACTCCTGAAGG - Intergenic
1072224621 10:93357092-93357114 GAATGAGGTGCACCTCCTGAGGG - Intronic
1076127113 10:127983921-127983943 GAAGTAGGTGCCCCACCCGAAGG + Intronic
1076804846 10:132850227-132850249 GAAGCAGGAGCACCTACCGAGGG + Exonic
1077049142 11:558928-558950 GCTGCAGGTGCGCCTGCTGGAGG + Exonic
1078823909 11:14907901-14907923 GGAGGAAGTGCGCCTCCTGCTGG + Intronic
1078896245 11:15599767-15599789 GAATCAGGTGCTCCTCCTCTAGG + Intergenic
1079526845 11:21400796-21400818 GAAGCAGGTGGGCATACAGAGGG - Intronic
1083479037 11:62932000-62932022 GAAGCAGGAGCTGCTCCTGTGGG - Intergenic
1084410345 11:69002995-69003017 GAAGCACGTCCCTCTCCTGAAGG - Intergenic
1084468533 11:69341607-69341629 GAAGCAGGTGCTGCTGCTGTGGG - Intronic
1091859164 12:3764036-3764058 GAATCTGGTGAGGCTCCTGAAGG - Intronic
1092206941 12:6620537-6620559 GAAGACCGTGCGCCTCCTGCTGG - Exonic
1096096844 12:48941029-48941051 GAAGGAGATGCGCATCCTGATGG - Exonic
1096156124 12:49342417-49342439 GCGGCAGGAGCGCCTCCTGCGGG + Intergenic
1096355831 12:50940145-50940167 GAAGCAAGTGCTTCTCATGAGGG - Intergenic
1102842652 12:116142454-116142476 GAAGCAGGTGGCTCACCTGAGGG + Intronic
1103735549 12:123058620-123058642 GAGGCAGGTGCTGCTCTTGAGGG - Intronic
1107929890 13:45298548-45298570 GAAGCAGGTGGGCCTGCAGCAGG - Intergenic
1108259664 13:48644133-48644155 GAAGCAGGTGCCCCAGGTGAAGG - Intergenic
1112590254 13:100756993-100757015 GAAGCAGATGCACATTCTGATGG - Intergenic
1117867529 14:60165228-60165250 GCAGCTGCTGCGCTTCCTGAGGG - Exonic
1119495988 14:75079739-75079761 GAATCAGATGCTCCTCCAGATGG + Exonic
1123003121 14:105307235-105307257 GAGGCAGGTGGGACTCATGATGG - Exonic
1202921339 14_KI270723v1_random:32487-32509 GAAGCAGGTGGGCCTCTTCCAGG + Intergenic
1202923571 14_KI270724v1_random:5093-5115 GAAGCAGGTGGGCCTCTTCCAGG - Intergenic
1125847553 15:42871396-42871418 TAAGCAGGAGAACCTCCTGAAGG + Intronic
1128306251 15:66600777-66600799 GATGCACCTGCACCTCCTGATGG + Intronic
1128336140 15:66786909-66786931 GAGGCAGGTGTACATCCTGAGGG - Intergenic
1128907083 15:71476868-71476890 GAGGCAGCTGGGGCTCCTGAAGG - Intronic
1134483787 16:14640686-14640708 GAAGCAGGTGAGCCTCACCACGG - Intronic
1137562503 16:49511709-49511731 GAGGCAGCTGTGTCTCCTGAGGG - Intronic
1140296319 16:73712625-73712647 GAAGCAGCTGGCCTTCCTGAAGG + Intergenic
1141642123 16:85347417-85347439 GAGGCAAGAGCGCCTCCTCATGG - Intergenic
1141672041 16:85497225-85497247 GAAGCTGCTGGGTCTCCTGAAGG + Intergenic
1143431984 17:6894347-6894369 GCACCTGGGGCGCCTCCTGATGG + Intronic
1143568641 17:7740608-7740630 GAGGCAGGAGGGCCTCCGGAAGG - Intronic
1145214944 17:21043703-21043725 CAAGCTGGGGCGCCTCCTGTCGG + Intronic
1146629513 17:34459783-34459805 GAACTAGGTGTTCCTCCTGATGG - Intergenic
1148178418 17:45586359-45586381 GCAGCAGCCGCGCCTCCTGCAGG - Intergenic
1148270741 17:46260096-46260118 GCAGCAGCCGCGCCTCCTGCAGG + Intergenic
1148772536 17:50075714-50075736 GAAGCTGGAGCTGCTCCTGATGG + Exonic
1148858397 17:50591507-50591529 GAAGCTGGTGCGCTTCCTGCCGG + Exonic
1149608453 17:57941488-57941510 GAAGAAGGTGCTCTTCCTGTAGG - Intronic
1149639603 17:58194058-58194080 GAAGCCATTGCGCCTCCTGCTGG - Exonic
1149658644 17:58323393-58323415 GAACCAAGTGCTCCTCATGAGGG + Intronic
1150448697 17:65247619-65247641 GAAGGAGGAGCGGCTGCTGATGG + Intergenic
1151342751 17:73482287-73482309 GAAGCAGGTCTGTCTCCTGTTGG + Intronic
1151929699 17:77224516-77224538 GAGGCCGGTGCAACTCCTGAAGG + Intergenic
1152125188 17:78442417-78442439 GGAGGAGTTGCTCCTCCTGAAGG + Intronic
1152491317 17:80636583-80636605 GAAACACGATCGCCTCCTGAAGG + Intronic
1152810479 17:82379588-82379610 GAACCAGGTGCTCCTCCCGGAGG - Intergenic
1155244508 18:23894507-23894529 GAAGCAGGGTCCCCTGCTGAAGG - Intronic
1157572913 18:48724699-48724721 GAAGCAGGTGCGGCCACTGAGGG + Intronic
1163146234 19:15380516-15380538 GAAGCTGGAGCGCTACCTGAAGG - Exonic
1163509342 19:17725936-17725958 GGAGCCGGAGCGCCCCCTGAAGG - Exonic
1165616441 19:37205845-37205867 GAAGCAGGTGGATCACCTGAGGG + Intronic
1167295095 19:48645257-48645279 GAAGCTGGCCCGACTCCTGAGGG + Intronic
1167736072 19:51295284-51295306 AAAGCAGCTGCCCCTCCTGAAGG + Intergenic
925094410 2:1184585-1184607 GAAGCAGGTGTGCCTTCACATGG + Intronic
926300463 2:11598434-11598456 GAAGCTGGTGCCCCTCGGGAGGG + Intronic
927323939 2:21781227-21781249 GAAGCTGGTGCCCTTCCTCATGG - Intergenic
927923887 2:26996040-26996062 GAAGCAGGAGCTCCTCCTTTTGG - Intronic
930030866 2:47057264-47057286 CAAGCAGGGAAGCCTCCTGAAGG - Intronic
933302801 2:80561626-80561648 GAAATTGGTGCTCCTCCTGAGGG + Intronic
934752564 2:96802937-96802959 GATGCTGGTGCTGCTCCTGATGG - Intronic
935595459 2:104874001-104874023 GAAGCAGGTGCGCCTGCCTCGGG - Intergenic
937670050 2:124528887-124528909 GTAGCAGGTGCCTCTACTGAGGG + Intronic
938014831 2:127858378-127858400 GATGCAGGAACGCCTGCTGATGG + Intergenic
942377929 2:175356043-175356065 GAAGCAAATGTGCCTCCTGGGGG - Intergenic
946168118 2:217877744-217877766 GCAGCAGGAGGGCCTCCTGGGGG + Intronic
948888174 2:240894132-240894154 GAGGCAGGGGCACCTCCTGTGGG - Intronic
1169075655 20:2758624-2758646 GAAGCAGATGGGCCCTCTGAAGG + Intronic
1172767676 20:37359430-37359452 GAAGCGGGTGGGCCTGCTGGTGG + Intronic
1173854024 20:46238162-46238184 GAAGCAGGAGCCCCATCTGAAGG - Intronic
1174657264 20:52181952-52181974 GACTCAGCTGCTCCTCCTGATGG - Intronic
1175541632 20:59751518-59751540 GAAGCAGGTGGGCAGCCTGGTGG + Intronic
1175682368 20:60999054-60999076 GGAGCAGGTGCGCCCCATGGAGG + Intergenic
1176222370 20:63975731-63975753 GCAGCAGGTGCTCCGCCTGCAGG - Exonic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1178872742 21:36389835-36389857 GGAGCAGGAGCGCCACCTGGGGG + Intronic
1178883656 21:36467725-36467747 GTAGCAGGTGAGACTGCTGAGGG - Intronic
1179565438 21:42244990-42245012 GAAGGAGGTCCTCTTCCTGAGGG - Intronic
1179826007 21:43966903-43966925 CAAGCAGGTGGGCCTCTTGTCGG - Intronic
1180085281 21:45505409-45505431 GAACCATGGGCGCCTCCTCAGGG + Exonic
1180193993 21:46182738-46182760 GAAGCAGGTGCGCCTCCTGAAGG - Exonic
1181108603 22:20588853-20588875 GAAGCAGTGGCTCCTCCTCAAGG + Intergenic
1181961063 22:26622129-26622151 GAAGCAGGTGCTGGTCTTGATGG - Intronic
1183782377 22:40007182-40007204 GCAGCAGGAGCCCCTCCTGCGGG + Intronic
1184234209 22:43174414-43174436 GAGGCAGGTGCGCCAGCTCAAGG + Intronic
1184345463 22:43910100-43910122 GGAGCAGGAGCACCTGCTGAGGG - Intergenic
1184580503 22:45413478-45413500 GATGCAGGTGAACCTCCGGAAGG + Exonic
1184640085 22:45866102-45866124 GGAGCCTGTGAGCCTCCTGAGGG - Intergenic
1184720076 22:46307067-46307089 GGAGCAGGTGCCCCTGCAGAGGG + Intronic
1184738281 22:46411808-46411830 GTGACAGGTGCGCCTGCTGAGGG - Intronic
1185335351 22:50268798-50268820 GGAGCAGGAGCGGCTCCTGCTGG + Intronic
953971454 3:47351786-47351808 GAAGCAGGTGCCCACCCTAAGGG - Intergenic
955281275 3:57597074-57597096 GAAGCAGATGCGCATTTTGATGG - Exonic
956294889 3:67701519-67701541 AAAACAGGTGCCCCTCCTTAGGG - Intergenic
956707653 3:72013111-72013133 GAAGCTGGTAGGGCTCCTGAAGG - Intergenic
960583458 3:119300037-119300059 GAGGCAGGTGCCCCTGCTGGAGG + Intronic
962570033 3:136703776-136703798 GAAGCAGGTGGATCACCTGAGGG + Intronic
968874022 4:3255779-3255801 GAAGCAGCTGCGGCTGCTGGAGG + Exonic
968950817 4:3690478-3690500 GAAGCAGGTGAGCCTCCTGCAGG + Intergenic
969256897 4:6008361-6008383 GGAGCAGGAGCGCGTCCTGCGGG - Intergenic
971705024 4:30030493-30030515 GTAGCAGGTGTGCTTCCTCATGG + Intergenic
975321952 4:73018800-73018822 GAGGCAGGTGGGGCTCCTGCTGG - Intergenic
976878993 4:89895230-89895252 GAAACAAGTGCACCTGCTGAGGG + Exonic
976977952 4:91186784-91186806 GCAGCAGGTGCATCTCCTTAAGG + Intronic
980008044 4:127563407-127563429 CAAGCAGGTGTGCCAACTGATGG + Intergenic
980104939 4:128578656-128578678 GCAGGAGGTGCGCCTTCAGAAGG - Intergenic
986145226 5:5071542-5071564 GAGGCTGGTGGGCCTCCTGGGGG + Intergenic
988230163 5:28466380-28466402 GAAGGAGATGTGCCTCGTGAAGG - Intergenic
990509848 5:56480693-56480715 GAAGCAGATTCGGCCCCTGATGG - Intronic
992778804 5:80110069-80110091 GAAGCAGAAGTGGCTCCTGAGGG - Intergenic
996035981 5:118759309-118759331 GAAGCAGAGGCTCCTCCTGTCGG - Intergenic
997859565 5:137404236-137404258 GTAGCAGCTGCCCCTTCTGACGG - Intronic
1002603937 5:180370911-180370933 GAAGCAGCTGCCCCTCCCCATGG - Intergenic
1005795687 6:29359630-29359652 GAAGCAGGTGCAGCACCTGGAGG + Intronic
1023291383 7:38672011-38672033 GGAGCTGGTGCCCCACCTGATGG - Intergenic
1023394727 7:39742382-39742404 GAAGGAGGAGCGCTTCCTGCTGG + Intergenic
1024019162 7:45349366-45349388 GGAGCAGGTGGGTCTGCTGATGG + Intergenic
1024086489 7:45895922-45895944 GAATGTGGTGCGCCTCCTCATGG + Intergenic
1024111722 7:46154086-46154108 GAAGCACCTGCCTCTCCTGAGGG + Intergenic
1025753582 7:64313579-64313601 GAAGCAGCTGCATCTCCTGGAGG + Intronic
1025816298 7:64915526-64915548 GCAGCAGGAGCACGTCCTGAAGG + Intronic
1026034915 7:66824060-66824082 GAAGCAGTTGGGCCTGCGGAGGG + Intergenic
1026111898 7:67465124-67465146 GAAGCAGGTGTCCTTCCTTATGG - Intergenic
1026984671 7:74547202-74547224 GAAGCAGTTGGGCCTGCGGAGGG - Exonic
1032197821 7:129799503-129799525 GTTGCAGGGGCGCCCCCTGAGGG + Intergenic
1032201546 7:129825904-129825926 GAAGCACGTACGCCCCCTGGTGG + Intergenic
1033832295 7:145269528-145269550 GGAGCAGGTGAGCCTCCAGCAGG + Intergenic
1034496953 7:151428746-151428768 GAAGCATGTGTGGCTCTTGAGGG + Intergenic
1035430005 7:158812183-158812205 GAAGCATGTACTCCTCCAGAGGG - Intronic
1035596791 8:864726-864748 GAAGCAGGTGCACCTGTCGATGG + Intergenic
1039786936 8:40842139-40842161 GAAGCAAGTGTGGCTCCTGGGGG + Intronic
1040518191 8:48151517-48151539 GGAGCAGGTGAGTCTCCTCAAGG + Intergenic
1048138343 8:131768330-131768352 GAAGCTGGTGCTCCACCTGCAGG - Intergenic
1051749333 9:20325124-20325146 GAAGGAGGACAGCCTCCTGAAGG - Intergenic
1057668087 9:97062267-97062289 GAAGCAGGTGCTCTTCCACAAGG - Intergenic
1060137293 9:121169750-121169772 GAAGCAGGTGGCCAGCCTGAAGG + Exonic
1060162066 9:121372918-121372940 GAAAGAAGTGCTCCTCCTGAGGG - Intergenic
1062574299 9:137199408-137199430 GAAGAAGCTGAGCCTGCTGAGGG - Exonic
1185596955 X:1313023-1313045 GAAGCAGGTCCACCTCCCCAAGG + Intergenic
1185623140 X:1465531-1465553 GAGGCCGGTGCGCACCCTGAAGG - Exonic
1189473069 X:41329282-41329304 GAGGCAGCTCGGCCTCCTGAGGG + Intergenic
1190286384 X:48964148-48964170 GAGGCAGGTGGACCACCTGAAGG + Intronic
1191720581 X:64225250-64225272 GAAGCTGGTGCCTCTCCTGGTGG - Exonic
1195324877 X:103750417-103750439 GGAGGAGGTGCCCCTGCTGAAGG + Intergenic
1199392445 X:147296755-147296777 GAAGCAGGTGTGACTTCTGTGGG - Intergenic