ID: 1180196638

View in Genome Browser
Species Human (GRCh38)
Location 21:46200334-46200356
Sequence GTATAAGTATGATGAGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 5, 3: 31, 4: 320}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180196638 Original CRISPR GTATAAGTATGATGAGAAAT AGG Intronic
901814902 1:11788414-11788436 GGTTAAGTATGAGGTGAAATGGG - Exonic
902574711 1:17370262-17370284 GTATAACTATGAAGTGAAAGAGG + Intergenic
908025388 1:59945828-59945850 GTATAAGAATGAGAAAAAATAGG - Intergenic
908376069 1:63542593-63542615 GTATTGGTATGTGGAGAAATTGG - Intronic
909240254 1:73204281-73204303 GTATATGCACGCTGAGAAATAGG + Intergenic
909265162 1:73549373-73549395 GTACAATTATGATGAGATTTGGG + Intergenic
910670506 1:89767957-89767979 GTATAAGAATAATGACAAGTAGG + Intronic
911527949 1:99008050-99008072 TAATATGAATGATGAGAAATTGG - Intergenic
912104584 1:106256359-106256381 GTATCAGTAGGATAAGAATTGGG + Intergenic
913422290 1:118684281-118684303 TTATAAGAATGTGGAGAAATAGG + Intergenic
913707959 1:121446947-121446969 GTATAAGTATATTGGGAAAGAGG + Intergenic
914920374 1:151842922-151842944 GCAAAAGTATGATGAGAAACAGG + Intergenic
916608050 1:166362621-166362643 GATAAAGTTTGATGAGAAATGGG - Intergenic
916707624 1:167368508-167368530 GTAAAAGTCTGTTGAGGAATGGG - Intronic
917088365 1:171327210-171327232 GTTAAAGGATGATTAGAAATTGG - Intronic
917186061 1:172357223-172357245 GTAAAAGTATGATGAGAAACAGG + Intronic
917401614 1:174655662-174655684 TTGAAAGTCTGATGAGAAATGGG - Intronic
917451722 1:175152726-175152748 GTGTATGTATAATGAAAAATAGG + Intergenic
918668606 1:187183827-187183849 GTTTGTGTATGATGAGAGATAGG - Intergenic
920141779 1:203820951-203820973 GTTGAAGTCTGATGAGAAACGGG - Intronic
920681398 1:208075587-208075609 ATGAAAGTATGATGAGAAATAGG - Intronic
921647978 1:217642285-217642307 TTTTAAGTTTGATGAGGAATAGG - Intronic
921836099 1:219780362-219780384 TTAAAAGTCTGATAAGAAATGGG + Intronic
922519278 1:226234218-226234240 GTAAAAGTTTGATGACAAATAGG - Intronic
922641710 1:227238774-227238796 GTATAAGAAAGATGAACAATTGG + Intronic
923933606 1:238733055-238733077 GAATAATGATGATAAGAAATTGG + Intergenic
924207421 1:241727727-241727749 TGATAAGTATGGTAAGAAATAGG + Intronic
1063250956 10:4274031-4274053 GTATAAGTAGAATAAGGAATTGG - Intergenic
1063904162 10:10765835-10765857 GAATGATGATGATGAGAAATGGG - Intergenic
1065132034 10:22631785-22631807 GCAAAAGTATGCTGAGAAACAGG + Intronic
1066013203 10:31213131-31213153 GTAAAAGTTTGATGAGGAAAAGG - Intergenic
1066543962 10:36479608-36479630 ATATAAGTATAAAGAAAAATAGG + Intergenic
1067815191 10:49469148-49469170 ATAAAAGTTTGATGAGAAACAGG + Intronic
1067988298 10:51178683-51178705 GTATAAACATGTTGAAAAATAGG - Intronic
1068991110 10:63151811-63151833 TTGTGAGTATGATGAGTAATAGG + Intronic
1071752639 10:88498035-88498057 GTGAAAGTTTGATGAGAAACAGG + Intronic
1072038351 10:91584788-91584810 GTATAAGAAAAATGAGAAGTGGG - Intergenic
1072258139 10:93640603-93640625 ATTTGAGCATGATGAGAAATAGG + Intronic
1072312972 10:94174436-94174458 AAGTAAGTTTGATGAGAAATAGG + Intronic
1073861392 10:107746413-107746435 GTATAAGTGAAAGGAGAAATAGG + Intergenic
1074203750 10:111262509-111262531 GTAAAAGTTTGATGACAAGTAGG - Intergenic
1074369060 10:112884444-112884466 GGAAAAGTATGATGACAAAGAGG - Intergenic
1074729226 10:116350988-116351010 CTATAAGCCTGATAAGAAATTGG + Intronic
1076151085 10:128162380-128162402 GTATAAGTATGGGCAGAAAAAGG + Intergenic
1078723958 11:13911389-13911411 GTGAAAGTTTGATGAGAAACAGG - Intergenic
1078846292 11:15121636-15121658 GTATAAGTTTGATAAGGAACAGG - Intronic
1078917230 11:15790161-15790183 GTAAAATTTTGATGAGAAACAGG + Intergenic
1079252876 11:18800223-18800245 GTTTAAATATGGTGAGAGATAGG + Intergenic
1080043760 11:27786741-27786763 GAAAAAGTATGATGAAAAAAGGG + Intergenic
1081117009 11:39215493-39215515 GTATAATTATTTAGAGAAATAGG + Intergenic
1082213539 11:49536700-49536722 GGATATGTATGCTGAGAACTTGG + Intergenic
1082872545 11:57956689-57956711 GAATAGGTATGATAAGAATTGGG + Intergenic
1084552927 11:69859240-69859262 GTACAAGTTTGAGGAGAAAGAGG - Intergenic
1084757362 11:71248300-71248322 CAAGAAGTATGATGAGAAACTGG + Intronic
1085227846 11:74938485-74938507 GTAAAAGTATGATGAGAAACAGG - Intronic
1085852462 11:80137823-80137845 GTGTCAGTAAGATGAGGAATAGG - Intergenic
1086728105 11:90214524-90214546 TAATAAGTATGTTGAGAACTAGG - Intronic
1087124018 11:94605581-94605603 GTAAAAGTTTGATGAGGAACAGG - Intronic
1087199841 11:95334381-95334403 TTATAAGAAGGATGAGAAAGAGG - Intergenic
1088644093 11:111902550-111902572 GGATAAGGAGGATGAGAAAGGGG - Intergenic
1090155419 11:124432548-124432570 TTATAGGACTGATGAGAAATTGG - Intergenic
1090509280 11:127355925-127355947 GAATAAATATGAGAAGAAATTGG - Intergenic
1090563116 11:127955159-127955181 GTAAAAGTATGATGAGAAATGGG + Intergenic
1090598826 11:128348380-128348402 GTCTAAAAATGATAAGAAATGGG + Intergenic
1092807439 12:12237461-12237483 ATAAAAGTATGATGAGAAACAGG + Intronic
1093568919 12:20643208-20643230 GAAGAAGTATGATGAGAATAAGG + Intronic
1093578184 12:20760562-20760584 GTATAATAATGGTCAGAAATAGG - Intergenic
1093981695 12:25482077-25482099 GGATAAGTATGAGGATAAAATGG + Intronic
1094634649 12:32213875-32213897 GCAAAAGTATGATGAGAAACAGG - Intronic
1095209926 12:39481274-39481296 TTTTTAGTATGATGTGAAATAGG - Intergenic
1095897353 12:47293210-47293232 TTATATTTATTATGAGAAATTGG - Intergenic
1097444590 12:59653418-59653440 GTATAGGTATGGTGACAAATTGG - Intronic
1098336172 12:69407114-69407136 GTATAAATGTTAAGAGAAATTGG - Intergenic
1098763293 12:74452472-74452494 GACTAATTATGTTGAGAAATGGG + Intergenic
1099399400 12:82183530-82183552 GAGAAAGTATGATGAGACATTGG - Intergenic
1100475402 12:94931040-94931062 GTCTCAGTAAGATGAGAAAAGGG + Intronic
1101202304 12:102449535-102449557 GTATAATAATAATGAAAAATTGG + Intronic
1101298980 12:103458398-103458420 GAACAAGTATGATGAGTTATAGG + Intronic
1101689321 12:107061059-107061081 ATAAAAGTTTGATAAGAAATAGG - Intronic
1102384048 12:112492506-112492528 AAAAAAGTATTATGAGAAATAGG - Intronic
1103889874 12:124230477-124230499 GTAAAAATATGAAGAGAAAGGGG - Intronic
1104244116 12:127020996-127021018 GTGAATGTTTGATGAGAAATGGG - Intergenic
1105261051 13:18779680-18779702 GTATAAGAAGGATATGAAATTGG - Intergenic
1107065298 13:36208162-36208184 GTATAACTTTCAGGAGAAATGGG - Intronic
1107379319 13:39839061-39839083 TTATGAGTATGATGAGAGATAGG - Intergenic
1110198875 13:72824688-72824710 GTATAAGTATGTTAGGGAATAGG + Intronic
1110440733 13:75522549-75522571 TTCTTAGTATGATGAGAATTGGG + Intergenic
1111588940 13:90318631-90318653 CTATAAGCATGATGAAAAAAAGG + Intergenic
1116117344 14:40671864-40671886 GTATAGGTTTGATGAAAAGTGGG - Intergenic
1116205546 14:41861190-41861212 GTCTAATTTTGATGAAAAATAGG - Intronic
1116450659 14:45060963-45060985 GCATATGTATGGTGAGAAATAGG - Intronic
1117217678 14:53568621-53568643 GGATAAGTATGCTGTGAAACTGG - Intergenic
1117233840 14:53751186-53751208 GTATAACTTTGAAGAAAAATAGG - Intergenic
1117321741 14:54630946-54630968 GTGTGTGTGTGATGAGAAATCGG + Intronic
1117373554 14:55100665-55100687 GTACATGTTTGATAAGAAATAGG + Intergenic
1119106440 14:71929637-71929659 GTAAAAGTTTGATGAGGAACAGG - Intergenic
1119184053 14:72625108-72625130 GCAAAAGTATGATGAGAAGTAGG - Intronic
1120383568 14:83814416-83814438 TTATAAATATGATGAGAATGAGG + Intergenic
1120701152 14:87700300-87700322 ATATATGTATGAACAGAAATGGG - Intergenic
1124037842 15:26072767-26072789 ATATAAGGATAATGGGAAATAGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125133157 15:36308391-36308413 TTATATTTATTATGAGAAATTGG - Intergenic
1126965335 15:54045765-54045787 GTAGAAGACTGATGAAAAATAGG - Intronic
1127061021 15:55184591-55184613 GTACAAGTTTGAGGAGTAATAGG + Intronic
1127132105 15:55877582-55877604 GAAAAAGTTTGATGAGAAATGGG - Intronic
1129268412 15:74407106-74407128 GTAGAAGTCTGAGGAGAGATGGG + Intergenic
1129345256 15:74913624-74913646 GTAGCAGTAAGATGAGAAAATGG - Intergenic
1129535172 15:76308266-76308288 GTAAAAGTCTGATGAGAAATAGG + Intronic
1130952427 15:88603698-88603720 GGATAAGATTGATGATAAATGGG + Intergenic
1132162959 15:99560384-99560406 GTGAAAGGATGATGAGAAACAGG - Intergenic
1133448470 16:5883368-5883390 GAAAAAGTATTATGAGGAATAGG - Intergenic
1134163216 16:11909215-11909237 GTAGAATTATGATGGGAAACTGG + Intronic
1134342684 16:13359607-13359629 GTAAAAGTATGGTGATAAATTGG - Intergenic
1134399155 16:13892995-13893017 GGATAAGCAGCATGAGAAATTGG - Intergenic
1136129956 16:28213393-28213415 GAATAGGAATGATGAGAAAGGGG + Intergenic
1137318612 16:47354372-47354394 TTTTTAATATGATGAGAAATGGG - Intronic
1138653749 16:58477789-58477811 GGGGAAGTATGATGAGACATAGG + Intronic
1139228653 16:65258678-65258700 GTAAAAGTATGATCAGAAGCTGG - Intergenic
1141358416 16:83371431-83371453 GTATAAGTATGCCAAGAAAGAGG - Intronic
1142965057 17:3575570-3575592 GTGAAAGTCTGATGAGAAACAGG + Intronic
1143999515 17:11039870-11039892 GTTAAAGCATAATGAGAAATTGG + Intergenic
1144077969 17:11735833-11735855 GTATATGCTTGATGAGAAACTGG + Intronic
1144223932 17:13126391-13126413 GTAAAAGTTTGAGGGGAAATAGG - Intergenic
1146720658 17:35121279-35121301 GAATAAGGATGGTGAGAGATGGG - Exonic
1148510729 17:48167322-48167344 GTATAAGTATGATTTGGAAGTGG + Intronic
1149331828 17:55590644-55590666 GTATAAGAATAGAGAGAAATAGG + Intergenic
1149741087 17:59046205-59046227 GAAAAAGTAGGATGAAAAATAGG + Intronic
1150104516 17:62452419-62452441 GTAGAAGTTTGATGAGGAACAGG - Intergenic
1151052144 17:70990437-70990459 TTTTAAATATGATGAGAGATAGG - Intergenic
1153335849 18:3924232-3924254 GTATATGCAAGATGATAAATGGG - Intronic
1153360617 18:4192174-4192196 GGAGAGGTATCATGAGAAATAGG - Intronic
1154366282 18:13712021-13712043 GTGTAAGAATAAAGAGAAATTGG + Intronic
1155652187 18:28155770-28155792 GTAATTGTATGGTGAGAAATTGG - Intronic
1156577338 18:38333206-38333228 GCAAAAGTATGATGAGAAATAGG - Intergenic
1160117689 18:76097191-76097213 GTGAAAGTATAATGAGAAATAGG + Intergenic
1165679436 19:37761272-37761294 GTAAAAGTTGGAGGAGAAATAGG + Intronic
1165790917 19:38491727-38491749 GTAAAAGAATGAAGAAAAATGGG - Intronic
1167580371 19:50337683-50337705 GTATGAAGATGATGAGAATTAGG + Intronic
1168684541 19:58340226-58340248 GTATAAGTATGCTGAGATGCAGG + Exonic
925488266 2:4361573-4361595 GTGAAAGTATAATGAGAAAAAGG + Intergenic
926865596 2:17354387-17354409 GTATATCTAGGATGAGAATTGGG - Intergenic
927265361 2:21141799-21141821 GAAAAAGCATGATCAGAAATGGG + Exonic
928846943 2:35686190-35686212 GAATAATTTTGCTGAGAAATAGG - Intergenic
929078819 2:38101649-38101671 GAATAGGTATGATGAGTTATTGG + Intronic
929732460 2:44510588-44510610 GGGAAAGTATAATGAGAAATGGG - Intronic
930301988 2:49628169-49628191 GAATAAGCAAGAAGAGAAATAGG - Intergenic
930792923 2:55353996-55354018 GTATAAGTTTGAGAAGCAATAGG - Intronic
930992070 2:57668308-57668330 TTATAAAAATGATGAGAAAATGG + Intergenic
931042013 2:58311332-58311354 TTATAAGCATGATGATAAACAGG - Intergenic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
931562742 2:63580311-63580333 GTAAAAGTTTGGTGAGAAACAGG + Intronic
933466839 2:82662274-82662296 GTCTAAGTATTGTGATAAATAGG - Intergenic
933623443 2:84571282-84571304 GCAAAAGTATAATAAGAAATGGG + Intronic
933687118 2:85150830-85150852 GTAAAGGTTTGATGAGAAATGGG - Intronic
934965240 2:98715844-98715866 GTAAAAGTATGATAAGAAACAGG + Intronic
935599338 2:104906796-104906818 GAATAAGTAGGAGGAGAAATGGG - Intergenic
937658261 2:124401744-124401766 GTAGAAGAAGGATGAGAAAATGG + Intronic
937824902 2:126357799-126357821 GTATATTTATTATAAGAAATTGG - Intergenic
937953210 2:127404246-127404268 GCAAAAATATGATGAGAAACAGG + Intergenic
938528328 2:132159208-132159230 GTAGAAATATGTAGAGAAATAGG - Intronic
939053796 2:137337600-137337622 GTAAAAGAATGATAAGAAACAGG - Intronic
940185101 2:150975650-150975672 GTTTAAGTTTGATGAAGAATGGG - Intergenic
940698212 2:157007341-157007363 ATATTGGTATGATGAGAAAGAGG - Intergenic
941129875 2:161634457-161634479 GCAAAAGTTTGAGGAGAAATAGG - Intronic
941320249 2:164046016-164046038 GCAAAAGTATGATGAGAAACAGG + Intergenic
941479385 2:165987390-165987412 GTGAAAGTTTGATGAGGAATAGG - Intergenic
941688537 2:168472792-168472814 GTATAAGTTTGTTGACAAACTGG + Intronic
942967023 2:181907534-181907556 GAATTAGAATGATGAGTAATGGG - Intronic
943012402 2:182466305-182466327 ATTTTAGTCTGATGAGAAATAGG - Intronic
943597405 2:189875004-189875026 GTATAAGTGTTAAGAAAAATGGG + Intronic
945844606 2:214929327-214929349 GTATAAATATTATGAAAATTAGG + Intergenic
947846587 2:233249489-233249511 TTATAATAATGATGAGAAGTTGG - Intronic
1168787627 20:553440-553462 ATTAAAGTTTGATGAGAAATAGG + Intergenic
1169097312 20:2913848-2913870 GTGAAAGTTTGATGAGGAATGGG - Intronic
1169533268 20:6508188-6508210 GTGAAAGTCTGATGAGAAAGAGG + Intergenic
1169960821 20:11158096-11158118 GTCAAAGTCTGATGAGAATTTGG - Intergenic
1170240312 20:14158579-14158601 GTATATGTATGGTAAGAGATAGG + Intronic
1170497889 20:16944527-16944549 GTAAAAGTATGATGAGAAGCAGG - Intergenic
1170722827 20:18899514-18899536 GTAGAAGTTTGAGGAAAAATGGG - Intergenic
1172356445 20:34283623-34283645 CTATGAGTTTGGTGAGAAATTGG - Intronic
1172496638 20:35390654-35390676 GCAAAAGTATAATGTGAAATGGG + Intronic
1172667068 20:36607559-36607581 GTATAAGTAAGAGGTGAAACAGG + Intronic
1174151841 20:48491456-48491478 GTATATGTATGATGAGCAAATGG + Intergenic
1174643322 20:52064008-52064030 GGAAAAGAATGATGACAAATGGG + Intronic
1175169110 20:57067540-57067562 ATATATGTATGAAGAGGAATTGG + Intergenic
1177117439 21:17103633-17103655 GTACAGGTAAGATGAGAAATAGG - Intergenic
1177337222 21:19745553-19745575 GTAAAAGTTTGCTGAGAAGTAGG + Intergenic
1177780540 21:25618167-25618189 GGAGAAGTAGGATGGGAAATGGG + Intergenic
1178144845 21:29727554-29727576 GCATGAGTATGAGGAGAGATAGG + Intronic
1178613368 21:34107532-34107554 GTTCAAGTTTGATGAGAAATAGG - Intronic
1179475257 21:41639151-41639173 GTGTAAGTCTGAGGAGTAATGGG - Intergenic
1180196638 21:46200334-46200356 GTATAAGTATGATGAGAAATAGG + Intronic
1180753868 22:18146677-18146699 TTAAAAGTTTGATGAGAAACAGG - Intergenic
951421405 3:22490192-22490214 GTATAAGGATGAAGAGATGTTGG + Intergenic
951845982 3:27085331-27085353 GAAGAAGTTTGAGGAGAAATAGG - Intergenic
952316190 3:32234638-32234660 GTGAAAGTGTGATGAGAAAAAGG - Intergenic
952979025 3:38720385-38720407 GCATAAGCAAGATGAGAAAGAGG + Intronic
953114853 3:39982338-39982360 ATGTATGTACGATGAGAAATTGG + Intronic
953248324 3:41218177-41218199 TTAAAAGTATTAGGAGAAATGGG - Intronic
953432132 3:42848662-42848684 ACAAAAGCATGATGAGAAATAGG + Intronic
953562718 3:44006019-44006041 ATGTAAATATGCTGAGAAATGGG + Intergenic
954475756 3:50743917-50743939 TTATAAGAATGTGGAGAAATTGG - Intronic
955648224 3:61163733-61163755 GTAGAAGTATGATTGGACATAGG - Intronic
956438141 3:69254427-69254449 GTGAAAGTTTGATGAGAAACAGG + Intronic
958474608 3:94564842-94564864 GTATAAACGTGATAAGAAATAGG + Intergenic
958566070 3:95812219-95812241 TTATTAATATTATGAGAAATGGG + Intergenic
958621843 3:96572722-96572744 GAATAAGTGTGATGAGTTATCGG + Intergenic
958797803 3:98724648-98724670 GTTCAAGTAAGATGAGAAAAAGG + Intergenic
958812517 3:98878110-98878132 GTATAAGTTTGATGAGTAACAGG + Intronic
960135694 3:114102783-114102805 GTATAACTATGATTACAAATTGG - Intergenic
961983949 3:131112712-131112734 TTTCAAGTATGATGAAAAATGGG + Intronic
962657422 3:137562298-137562320 GTGAAAGTTTAATGAGAAATGGG + Intergenic
962674138 3:137741122-137741144 GTAGAAGTATGAAGAGGAAAAGG - Intergenic
963370882 3:144398421-144398443 TTTTATGTATGATGAGACATAGG + Intergenic
963713801 3:148779880-148779902 GTATAGCTACAATGAGAAATGGG + Intergenic
964985724 3:162735242-162735264 TTTCAAGTATGATGGGAAATGGG + Intergenic
965227154 3:166004363-166004385 GTAAAAGTAGGATGAGATACGGG + Intergenic
965229399 3:166030521-166030543 ATATAAATATGATAAGAAACAGG - Intergenic
965735509 3:171815561-171815583 TTTTGTGTATGATGAGAAATAGG + Intergenic
967375233 3:188793480-188793502 CTATCAGTATAATGAGAAAGTGG - Intronic
968376687 4:49656-49678 ATACAAGTATTATGAGAAAGAGG - Intergenic
970127087 4:12826831-12826853 GTGGAAGTTTCATGAGAAATAGG - Intergenic
971677207 4:29647265-29647287 AAATAAGTATTATGACAAATTGG + Intergenic
971783773 4:31074189-31074211 ATATAAGTAAGAAGATAAATGGG - Intronic
972188484 4:36561888-36561910 GTATAAGTGTTACGGGAAATAGG + Intergenic
974022059 4:56700498-56700520 GTATAAAGATGATAAGGAATTGG - Intergenic
974530761 4:63105241-63105263 GGATAAGTCTGATAAGGAATGGG + Intergenic
975561576 4:75713350-75713372 GTGAAAGTTTGATGAGAAACAGG + Intronic
976126812 4:81841927-81841949 GGATAAGTATGATGTGAGGTGGG - Intronic
976687810 4:87835516-87835538 ATATAAGTATGATTGGCAATGGG - Intronic
977523698 4:98119085-98119107 GTGAGAGTTTGATGAGAAATAGG + Intronic
977887580 4:102271050-102271072 GTATAAGGAGGATGAGAAGGAGG + Intronic
977899367 4:102401567-102401589 ATATATGTATGATGAAAAGTTGG + Intronic
979053222 4:115962564-115962586 GTATTAGTATAAAGAGAGATAGG + Intergenic
979154882 4:117372156-117372178 TTATAAATATAATAAGAAATGGG + Intergenic
979409703 4:120361754-120361776 GTTTAATTATGATGACAACTAGG - Intergenic
979539822 4:121869257-121869279 CTAAAAATATGATGAGGAATTGG + Intronic
980384357 4:132067794-132067816 GTACAAGTATGATTCAAAATAGG + Intergenic
980948143 4:139343782-139343804 GTGAAAGTTTGATGAGCAATAGG - Intronic
981805892 4:148714780-148714802 GCATATGTGTGTTGAGAAATGGG - Intergenic
982685899 4:158488636-158488658 ATAAAAGTAAGATGAGAAAAAGG + Intronic
983332587 4:166350172-166350194 ATAAAAGTATGATTAAAAATAGG + Intergenic
983807124 4:172008573-172008595 GTATAATGAAGAAGAGAAATAGG + Intronic
984921893 4:184771941-184771963 ATATTAATATAATGAGAAATCGG + Intronic
985701691 5:1377358-1377380 GCAAAATTAGGATGAGAAATGGG - Intergenic
987178014 5:15336638-15336660 GTTTAAGTATGATGAGTATATGG + Intergenic
987448579 5:18053358-18053380 ATATTAGTATGTTGAAAAATAGG - Intergenic
987822896 5:22989013-22989035 GGATAGGCATGAAGAGAAATCGG + Intergenic
990147706 5:52781310-52781332 ATGTAAGAATGAAGAGAAATTGG - Intergenic
991366468 5:65873188-65873210 TTCTAAGTATGATGAGAAGCGGG - Intergenic
991379967 5:66010497-66010519 GTAAAAGTATGATGAAAAACAGG - Intronic
992007405 5:72491347-72491369 GAAGAAGGATGATGAGAAAAAGG + Intronic
992819442 5:80481305-80481327 GTATAGGTAAGATCACAAATAGG + Intergenic
993024632 5:82631137-82631159 ACATAAGGGTGATGAGAAATTGG - Intergenic
993897307 5:93551888-93551910 GTATAATTATGGTGAGACCTTGG + Intergenic
993922120 5:93818247-93818269 TTGTAAGTATGGGGAGAAATGGG + Intronic
995214856 5:109583436-109583458 GTATAATCATCATGATAAATAGG + Intergenic
996249210 5:121306968-121306990 GTATAAGTAACATAGGAAATGGG + Intergenic
996308742 5:122078803-122078825 GTGTAGGTAATATGAGAAATGGG + Intergenic
998720369 5:144939628-144939650 GTTTTATTATGATGAGAGATAGG - Intergenic
998768141 5:145511540-145511562 GTGACAGTATGATGAGAGATAGG + Intronic
998780365 5:145649760-145649782 GTAGAAGTTTGATGGAAAATTGG - Intronic
998823389 5:146077045-146077067 CTAAAAGGATGATGGGAAATTGG - Intronic
999533671 5:152491858-152491880 ATAAAAGTTTGATGAGAAACAGG - Intergenic
999911356 5:156203996-156204018 ATATAAGTTTGATGAGAACTTGG - Intronic
1000230165 5:159308583-159308605 GTAGAAGTATGATGAGAAAAAGG + Intergenic
1000392259 5:160736328-160736350 GCAAAGGTATGATGATAAATGGG + Intronic
1000680331 5:164176067-164176089 GTATTAGTATTATGAGGAACAGG + Intergenic
1001932186 5:175681087-175681109 GAAAAACTTTGATGAGAAATAGG + Intronic
1002970474 6:2012404-2012426 ATATAAGTATGAAGACAGATTGG + Intronic
1003165143 6:3671007-3671029 GTATGAGTATGGGGAGAAAGAGG + Intergenic
1003307723 6:4944747-4944769 GTAAAAGTGTGATGAGAAAAAGG + Intronic
1004889362 6:20084607-20084629 GTGAAAGTTTGATGAGAAACAGG - Intergenic
1004950787 6:20669174-20669196 GTGAGAGCATGATGAGAAATAGG - Intronic
1007564004 6:42834394-42834416 GTGCAAGTTTGATGAGAAACTGG - Intronic
1008502105 6:52193562-52193584 GTTTAATGATGATGAGAAATGGG - Intergenic
1011092010 6:83613597-83613619 GTTAAAGCATGATGAGACATGGG - Intronic
1011111386 6:83840258-83840280 GTAAAAGTTTAATGAGAAACAGG + Intergenic
1011750770 6:90452543-90452565 GTAAAAGTTTGATGAGCAATAGG - Intergenic
1012024768 6:93974514-93974536 GTATGAATATGAGGACAAATGGG - Intergenic
1012952538 6:105534042-105534064 GTAAAAGGATGATGAGAATAAGG - Intergenic
1013050754 6:106532850-106532872 GTCTAAATATGACAAGAAATTGG + Intronic
1013551192 6:111209435-111209457 ATCTAAGTATGATGATGAATTGG + Intronic
1013947695 6:115742016-115742038 AAACAAGTAGGATGAGAAATAGG + Intergenic
1014399252 6:120966609-120966631 GTACAAGTAATATGAGGAATAGG - Intergenic
1014903895 6:127003082-127003104 GTCTAAGAATTATCAGAAATAGG - Intergenic
1015522066 6:134141390-134141412 TTGAAAGTATGATGAGGAATGGG + Intergenic
1020742327 7:12037618-12037640 GTATAAGTTTTATGTGACATGGG + Intergenic
1020993777 7:15235567-15235589 GTATAGTTATGATCAGAAATAGG + Intronic
1021000409 7:15323592-15323614 GTCTAAATATTATAAGAAATTGG - Intronic
1021383219 7:19994434-19994456 GTATCAGTAGGATGAGAACGTGG - Intergenic
1021444736 7:20720320-20720342 TTGAAAGTTTGATGAGAAATTGG + Intronic
1023065457 7:36373205-36373227 GTATAAGTTCTATGAGAACTGGG - Intronic
1023323039 7:39020724-39020746 TTAGAAATACGATGAGAAATTGG - Intronic
1023439923 7:40174731-40174753 CTATAAGTATGCTAAGACATAGG - Intronic
1024390375 7:48804657-48804679 GTAAAAGAATGAAGATAAATTGG - Intergenic
1024838893 7:53560561-53560583 GTGTTAAAATGATGAGAAATTGG + Intergenic
1025063448 7:55831445-55831467 GTTTGTATATGATGAGAAATGGG - Intronic
1028123914 7:87089385-87089407 GTTGGAGGATGATGAGAAATTGG + Intergenic
1028353017 7:89872438-89872460 GTTTGAATATGGTGAGAAATAGG + Intergenic
1028525373 7:91778989-91779011 GCAAATGTATGATGAGAAACAGG + Intronic
1028956001 7:96691135-96691157 GTTTATGTATTAAGAGAAATAGG - Intronic
1030858811 7:114597280-114597302 GTATAAGTATGAAGAGACTGAGG - Intronic
1031613987 7:123859243-123859265 ATAAAAGTATGTGGAGAAATTGG - Intronic
1031675622 7:124608484-124608506 GTAAAAGTGGGATGAGCAATAGG + Intergenic
1032033684 7:128505628-128505650 GTAGAAGTTTGATGAGGAACAGG - Intronic
1033854324 7:145539397-145539419 GTTTAAGTATGTTGACAATTGGG + Intergenic
1035551195 8:527726-527748 GTGTGTGTATGGTGAGAAATAGG - Intronic
1036047402 8:5159381-5159403 GTTTAATCTTGATGAGAAATGGG + Intergenic
1036082996 8:5578515-5578537 GTGAAAGTAAGATGAGAAACAGG + Intergenic
1037701901 8:21283057-21283079 GAATAAGGAGGATGAGAAAGTGG + Intergenic
1038649551 8:29390086-29390108 GTATAAGAATGTCTAGAAATTGG + Intergenic
1039562209 8:38521578-38521600 TTAAAAGTTTGATGAGAAACAGG - Intronic
1040663801 8:49606189-49606211 TGTTGAGTATGATGAGAAATTGG + Intergenic
1040682041 8:49822501-49822523 TAATATGTATGATGAGAAAATGG - Intergenic
1043117301 8:76274273-76274295 ATATAATTATTATAAGAAATTGG - Intergenic
1043312790 8:78883014-78883036 GTATATGTATGATATGAAAATGG + Intergenic
1044164170 8:88960084-88960106 GAATAAGTATTATGAGAATTTGG + Intergenic
1045398083 8:101782210-101782232 GTATGACTTTGATGAGTAATAGG + Intronic
1045453924 8:102356961-102356983 GCAAAAGTATGATGAGGAAGAGG + Intronic
1046005867 8:108482897-108482919 TTTTATGTATGATGTGAAATAGG + Intronic
1047095080 8:121616398-121616420 ATAGAAGTATGGTAAGAAATTGG - Intronic
1048055666 8:130860908-130860930 GTATTAGTTTGCTGAGAATTGGG + Intronic
1048230967 8:132641153-132641175 ATGGAAGTATGATGAGGAATAGG + Intronic
1048681527 8:136847113-136847135 CTTTAAGAATGCTGAGAAATAGG - Intergenic
1051347076 9:16161818-16161840 GCATAGCAATGATGAGAAATAGG + Intergenic
1051807105 9:21006731-21006753 CTGTAAGTTTAATGAGAAATAGG - Exonic
1052409186 9:28101213-28101235 GTCTAACTATAAAGAGAAATAGG - Intronic
1055205523 9:73725224-73725246 GTAGAACTATCATGAAAAATTGG + Intergenic
1056017818 9:82409450-82409472 ATATAAGTATTCTTAGAAATAGG - Intergenic
1056236724 9:84601841-84601863 GCCTAAGTATCATGACAAATGGG - Intergenic
1056353849 9:85778109-85778131 GTATAAGTTACATGAGAAAGTGG - Intergenic
1057012330 9:91615950-91615972 GTACAAGTTTGAGGAGAAACTGG + Intronic
1058976620 9:110130937-110130959 GCATAATTAAGGTGAGAAATAGG - Intronic
1203572543 Un_KI270744v1:144590-144612 ATACAAGTATTATGAGAAAGAGG + Intergenic
1185916340 X:4039626-4039648 GTAGAAGGATGAAGAGAAGTTGG + Intergenic
1186283135 X:8015960-8015982 GTACAAATTTGATGAGGAATGGG - Intergenic
1187443598 X:19341792-19341814 GTAAATGTATGATGAGAAACAGG - Intergenic
1189665622 X:43351557-43351579 TTATAAATATGATTAAAAATAGG - Intergenic
1189990574 X:46590099-46590121 ATAAAAGTTTGTTGAGAAATGGG + Intronic
1190107897 X:47572426-47572448 GGAAAATTATGATGGGAAATAGG + Exonic
1192169414 X:68844939-68844961 GAATAAGGATGAAGAGATATGGG + Intergenic
1192225611 X:69225711-69225733 GTGTAAGGATGTAGAGAAATGGG + Intergenic
1192813797 X:74570952-74570974 GTATGAGTATGAATATAAATTGG + Intergenic
1193104740 X:77657755-77657777 GCTTAAGTATGATAAGAAACAGG + Intronic
1194498207 X:94645087-94645109 TAATAATGATGATGAGAAATAGG + Intergenic
1195551026 X:106171178-106171200 GTATAAACATGTTGAGAACTTGG + Intronic
1195644546 X:107214055-107214077 GAATAAATAAGATGTGAAATGGG + Intronic
1195676121 X:107508177-107508199 CTAGAAATATGATGAGAATTTGG + Intergenic
1195811737 X:108840929-108840951 GTATGTGTACAATGAGAAATGGG + Intergenic
1196034549 X:111129949-111129971 GTAAAAGTCTGAGGAGAAAAAGG - Intronic
1196726035 X:118896357-118896379 GGAGGAGGATGATGAGAAATTGG + Intergenic
1196775055 X:119330953-119330975 GGCAAAGTATGATGAGAAACAGG - Intergenic
1196851865 X:119945642-119945664 GCAGAAGGATGAAGAGAAATAGG - Intergenic
1197461184 X:126743236-126743258 GTATAAGCATGAGGTGAGATTGG - Intergenic
1197487160 X:127067112-127067134 TTTTATATATGATGAGAAATAGG + Intergenic
1198522541 X:137467662-137467684 GTGAAAGTTTGATGAGAAATGGG - Intergenic
1199445710 X:147918212-147918234 GAAAAACTATGATGAGAAACAGG + Intronic