ID: 1180197132

View in Genome Browser
Species Human (GRCh38)
Location 21:46203868-46203890
Sequence GTGTGTTCTGGTGCTTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180197132 Original CRISPR GTGTGTTCTGGTGCTTGCTG TGG (reversed) Intronic
900354738 1:2254985-2255007 GTGTCCTGTGGTGCGTGCTGTGG + Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
901435752 1:9246466-9246488 CTGTGTTCTGGTACGTGGTGCGG + Intronic
901565756 1:10113407-10113429 GTGTGTTTTGGTGATTGATATGG - Intronic
902682324 1:18052100-18052122 GTGGGTTATGGTGGTTGATGGGG - Intergenic
902887803 1:19418945-19418967 GTGAGTTCTGGTGCTGGGTTTGG - Intronic
903816203 1:26066245-26066267 GTCGGTTCTCGTGCCTGCTGGGG - Intronic
905869364 1:41394437-41394459 GTGTGTTTAGGAGCTGGCTGTGG + Intergenic
906145244 1:43556777-43556799 GAGTGTGGTGGTGGTTGCTGTGG + Intronic
907790240 1:57656364-57656386 GTGTGTTTTTGTGCTCGCTTTGG + Intronic
908501931 1:64752496-64752518 GTGCCTTCTGTTACTTGCTGGGG + Intronic
908823219 1:68109085-68109107 GTGTGTTCAGGTCTTTGTTGGGG - Intronic
911203800 1:95072871-95072893 GTGCGTTCTCGTTCTAGCTGCGG - Exonic
911373710 1:97024857-97024879 CTGTGTTCTGGTGGTGGCAGTGG + Intergenic
911922278 1:103780412-103780434 GTGTGTTCTGATGAATGTTGAGG + Intergenic
913549839 1:119906758-119906780 GTGTGTGCAGGTGCTAGCTGTGG + Intergenic
915022022 1:152787979-152788001 GTGTCTGCTGGTGGCTGCTGAGG + Exonic
915022983 1:152798462-152798484 GTGTCTGCTGGTGGCTGCTGAGG + Intronic
915341051 1:155177024-155177046 GTGTGATCTTGTGCCCGCTGTGG - Exonic
916284793 1:163094322-163094344 GTGAGTTCTGGTGCTTGCATGGG - Intergenic
917471510 1:175329976-175329998 GTGGGTGCTGCTGCTTCCTGAGG + Intronic
919641904 1:200053554-200053576 GTGTGTGCGTGTGCATGCTGGGG - Intronic
920736471 1:208537459-208537481 GTGACTCCTGGTGCTGGCTGAGG - Intergenic
921035005 1:211368489-211368511 TTATGTTCTGGTGTGTGCTGGGG + Intronic
921268854 1:213449218-213449240 GTGGGTACTGGGGCTTGGTGGGG - Intergenic
924708601 1:246517296-246517318 TTGGGGTCTGGTCCTTGCTGAGG - Intergenic
924840500 1:247705864-247705886 ATGTGTTGAGGTGCTTGCTGAGG - Intergenic
1064672378 10:17729832-17729854 GTGTGTTCCGATGCTGGGTGTGG + Intergenic
1067295629 10:44973792-44973814 GTGTGTGTTGGTGTATGCTGCGG + Intronic
1071433374 10:85623912-85623934 CTGTGGTCTGGTGCTTGTAGAGG + Intronic
1073050997 10:100667423-100667445 GTGTGTGCTGGTGGGGGCTGGGG + Intergenic
1074882385 10:117669149-117669171 GTGTGTTCTGGTGGCTACGGTGG + Intergenic
1075025735 10:118981867-118981889 GTGTTTTCTGGTCCTTCCTGTGG - Intergenic
1075894725 10:125984987-125985009 TTGTGTCCTGGTCCCTGCTGTGG + Intronic
1076768378 10:132650022-132650044 GTGTGTGCTGGTGGCTACTGGGG + Intronic
1076942695 10:133620344-133620366 ATGTGTCCTGGGGGTTGCTGGGG + Intergenic
1077030465 11:463501-463523 GTTTGTTCTGGCGCTTGGGGAGG - Intronic
1079034664 11:17011780-17011802 GTGTGATCTGAAGCTTGGTGGGG - Intronic
1083711756 11:64554069-64554091 GTGACTTCTGGCACTTGCTGAGG + Intergenic
1085298482 11:75444479-75444501 GTGTGCTCTGGAGCCAGCTGGGG + Exonic
1085593777 11:77789982-77790004 GTGTGTACTGGTGTTGGCGGTGG - Intronic
1089552209 11:119288655-119288677 GTGCGTTCTGGTATATGCTGGGG - Intronic
1089809149 11:121117370-121117392 CTGTGATCTAGTCCTTGCTGGGG - Intronic
1090066368 11:123507199-123507221 GTTTCTTCTGGCTCTTGCTGTGG - Intergenic
1090912900 11:131136833-131136855 GTGTGTTCTGTTTCCTGCTCAGG + Intergenic
1093511472 12:19934662-19934684 GTGATTTCTGTTGCTTGGTGTGG + Intergenic
1095326132 12:40895517-40895539 GTGTGCTCGGGTGTTTGCTCAGG + Intronic
1095373558 12:41499422-41499444 GTATGTTCTGATTCTTACTGAGG - Intronic
1096023717 12:48343350-48343372 GGGTTTTCTGGTGCCTGATGAGG + Exonic
1097465800 12:59923073-59923095 GTGTGTTCTGGCTCTACCTGGGG + Intergenic
1097661575 12:62436213-62436235 GTGTGCACTGGTGTTGGCTGTGG - Intergenic
1100776419 12:97979597-97979619 GTGTGTGCAGGTGCTGACTGTGG - Intergenic
1102510011 12:113408886-113408908 CTGTGGTTTGGTACTTGCTGAGG - Intronic
1104756018 12:131269732-131269754 GTGTGGGCTGGTGCATGCTGGGG + Intergenic
1104904046 12:132204057-132204079 GTGTGTTCGGGTGCTGGGGGAGG - Intronic
1105812103 13:24004585-24004607 GGGTGTCCTGGAGCTGGCTGTGG + Intronic
1106449768 13:29869824-29869846 GTGTCTTCTGTTTCCTGCTGTGG - Intergenic
1107365163 13:39664205-39664227 GTGTCTTCAGGTGTTTGCTCTGG + Intronic
1107777270 13:43858273-43858295 ATGTGTTGTGGTGCTGCCTGTGG - Intronic
1108415259 13:50192064-50192086 GAGTTTTGTGGTGCTTTCTGAGG - Intronic
1108715444 13:53073719-53073741 GTGTGTAGTGGTGCTGGTTGGGG + Intergenic
1108858343 13:54823126-54823148 CTGTTCTCTTGTGCTTGCTGAGG - Intergenic
1108896034 13:55330216-55330238 TTGTGTTCCTGTGTTTGCTGAGG - Intergenic
1111470803 13:88679875-88679897 GTGTGTTCTGCTGTTTTGTGGGG + Intergenic
1112061262 13:95741944-95741966 ATGTGTACAGGTGCTGGCTGTGG + Intronic
1121688072 14:95854386-95854408 GTGTGTTGTGGTTGTTGCGGAGG + Intergenic
1122336076 14:100985425-100985447 GTGTCTTCTGGTGACTTCTGTGG + Intergenic
1122503893 14:102219494-102219516 CTGTCTCCTGGGGCTTGCTGGGG + Intronic
1123466141 15:20517507-20517529 GTCTGTTCTGGTCAGTGCTGTGG + Intergenic
1123651973 15:22483532-22483554 GTCTGTTCTGGTCAGTGCTGTGG - Intergenic
1123742393 15:23292392-23292414 GTCTGTTCTGGTCAGTGCTGTGG - Intergenic
1123760932 15:23432094-23432116 GTCTGTTCTGGTCAGTGCTGTGG + Intergenic
1124276866 15:28333483-28333505 GTCTGTTCTGGTCAGTGCTGTGG + Intergenic
1124305834 15:28578123-28578145 GTCTGTTCTGGTCAGTGCTGTGG - Intergenic
1125556087 15:40586249-40586271 GGGTGTGCTGGTGTGTGCTGCGG - Intergenic
1125578100 15:40768525-40768547 CTGTGGTCTGGCTCTTGCTGAGG + Intronic
1126825741 15:52546171-52546193 GTGTGTGCAGGTGCTGACTGTGG + Intergenic
1131801765 15:96076595-96076617 ATGTCTTTTGGTGCTTGTTGTGG - Intergenic
1131828182 15:96336410-96336432 GTGTGTTCTGGTTCTTGGGGTGG + Intronic
1133209041 16:4252844-4252866 GGGGATTCTGGGGCTTGCTGGGG + Intergenic
1133342004 16:5042747-5042769 ATGGGTTCTGGTGCTGTCTGTGG - Intronic
1135470893 16:22729501-22729523 GTTTATTCTGGTGGATGCTGTGG - Intergenic
1136318611 16:29468128-29468150 GTGCCTTCTGTTGGTTGCTGAGG + Intergenic
1136433183 16:30207474-30207496 GTGCCTTCTGTTGGTTGCTGAGG + Intronic
1136458896 16:30397952-30397974 GTGTCCGCTGGTGCTTGATGCGG - Exonic
1136748529 16:32613459-32613481 CAGGGCTCTGGTGCTTGCTGTGG - Intergenic
1139969750 16:70766437-70766459 CTGTGTTCAGGTGTTTGCTGTGG - Intronic
1141660413 16:85438313-85438335 GTCTGTGCTGCTCCTTGCTGGGG + Intergenic
1141983423 16:87563912-87563934 GTGTGTTCATGTGTGTGCTGGGG + Intergenic
1142184767 16:88689422-88689444 CTGTGGTCAGGTGCATGCTGGGG + Intergenic
1203050662 16_KI270728v1_random:872673-872695 CAGGGCTCTGGTGCTTGCTGTGG - Intergenic
1146088214 17:29850079-29850101 TTGTTTTCTGGTGCCTGTTGGGG - Intronic
1147470149 17:40650952-40650974 ATATGTTCTGGTGTTTGCTTTGG - Intergenic
1148441559 17:47714197-47714219 GTCTGTTCTTGTCCTTGCAGAGG - Intergenic
1148471191 17:47894588-47894610 GTGTCCTCTGGTGGATGCTGAGG + Intergenic
1148924131 17:51066976-51066998 TTCTGTTCAGGTTCTTGCTGTGG - Intronic
1149059993 17:52410517-52410539 GAGTCTTCTGGTGTTTGGTGGGG + Intergenic
1151207350 17:72517767-72517789 GTGTGTTTTGGGGTTAGCTGGGG - Intergenic
1153957880 18:10113591-10113613 GTGTGTGCTGGTGCCTGCCCTGG + Intergenic
1155799397 18:30081822-30081844 GTGTGTATTGGTGCTGGCTGTGG + Intergenic
1156220786 18:35049652-35049674 GTGTGTTTTGTTTTTTGCTGAGG + Intronic
1156867350 18:41903897-41903919 TGGTGGTCTTGTGCTTGCTGGGG - Intergenic
1157177149 18:45462045-45462067 ATGTTTTCTGGTGCTTGGAGAGG - Intronic
1159194574 18:65096148-65096170 GAGTGTTCTGTTACTTGCTGTGG + Intergenic
1159329126 18:66966293-66966315 GTGTGTTTTGGTGTTTTCTAAGG + Intergenic
1160363466 18:78304222-78304244 GTGTTTTCTGGTCTGTGCTGGGG + Intergenic
1160390660 18:78529037-78529059 GTGTGTCCTGGTGCAGGCTCTGG - Intergenic
1161650944 19:5484529-5484551 GTGGATTCTGGAGCTTGCTTTGG - Intergenic
1162957512 19:14107459-14107481 GTGGGTTCAGGTGATTTCTGGGG + Intronic
1163249157 19:16115925-16115947 GTTTGTTCAAGTGCCTGCTGGGG - Intronic
1165092607 19:33394839-33394861 ATGAGGTTTGGTGCTTGCTGGGG - Intronic
1165638395 19:37363328-37363350 GTGTCCTCTGGTGCGTGCTCAGG - Exonic
1165698441 19:37918976-37918998 GTGTATTCTGGTGGGTGCTGTGG + Intronic
1165737399 19:38185399-38185421 GTGTGTACGGGTGATTGTTGAGG - Intronic
1166633547 19:44429334-44429356 GTGTCTTCTGATGACTGCTGAGG + Exonic
1168407533 19:56118735-56118757 GTGTCCTCTGGTGCATCCTGAGG - Intronic
1168681589 19:58319817-58319839 GTACCTGCTGGTGCTTGCTGAGG - Intergenic
925365646 2:3310022-3310044 CTGTGTTCTGGTGTCTGCAGTGG - Intronic
925392199 2:3503587-3503609 CTGTGCTCAGGTGCTTTCTGTGG - Intronic
925731833 2:6924560-6924582 GTTTGTTCTGGAGGATGCTGAGG + Intronic
927328156 2:21830754-21830776 GTGTGTTCTGATCCATTCTGTGG + Intergenic
927743074 2:25590071-25590093 GTGTTTGCTGGTGCCAGCTGTGG - Intronic
928757884 2:34547535-34547557 GTGTGTGCAGGTGCTGGCTGTGG + Intergenic
930502137 2:52234787-52234809 GTGTGGTCTGTTGCTTGCCTTGG - Intergenic
933083360 2:78023314-78023336 GTGTGTGCTGGTGTTGGCAGTGG + Intergenic
933773921 2:85760368-85760390 GTGGGCTCTGGGCCTTGCTGTGG + Intronic
935089399 2:99880316-99880338 CTGTGTTCTGGGGCTGGCTGTGG + Intronic
937088063 2:119185109-119185131 GTGTGTTCTGGAAATTGGTGGGG - Intergenic
937672576 2:124553967-124553989 GAGTGTTCTGGTGCCTGCAAAGG + Intronic
941508992 2:166382604-166382626 GTGTGGCCTGGTTCCTGCTGTGG - Intergenic
942321279 2:174738275-174738297 GTCTGGTGTGGTGATTGCTGAGG - Intergenic
944020480 2:195097078-195097100 GGGTGTTCTGGTGTTAGGTGTGG - Intergenic
944038354 2:195325306-195325328 GATAGTTCTGGTGCTTTCTGAGG - Intergenic
947465989 2:230347141-230347163 CTGTGCTCTGGTGTTTGCTGGGG + Intronic
947528961 2:230896547-230896569 GTGTGTTATGGAGCTGGCCGAGG - Intergenic
948656023 2:239477043-239477065 GTGGGTCCTGGTGGTTGTTGGGG + Intergenic
1169039846 20:2484006-2484028 GTGTTCTCTGGTGTCTGCTGAGG + Exonic
1170050634 20:12140839-12140861 CTGTGTTCCTGTGCTTACTGTGG + Intergenic
1170658794 20:18316207-18316229 GTATGTTCTGGTGTCTGTTGAGG - Exonic
1175350543 20:58315016-58315038 GTCTCTCCTGGTTCTTGCTGTGG - Intronic
1176998404 21:15581948-15581970 GGGTGTTACGGTGTTTGCTGGGG + Intergenic
1177261897 21:18740208-18740230 AAATGTTCTGGTGCTTGTTGGGG - Intergenic
1177730739 21:25024652-25024674 GTGTGTGCAGGTACTGGCTGTGG + Intergenic
1179184540 21:39074900-39074922 GTGTGTTTTGGAGCATGCTGGGG - Intergenic
1179468448 21:41594262-41594284 GTGTGTGCTGCTGAGTGCTGGGG + Intergenic
1179731740 21:43372077-43372099 GTGTGTTCTGCGGCTGTCTGGGG - Intergenic
1180104045 21:45605576-45605598 ATGTGTTCTGGAGCTCTCTGTGG + Intergenic
1180197132 21:46203868-46203890 GTGTGTTCTGGTGCTTGCTGTGG - Intronic
1180730119 22:17974995-17975017 GTGTGATGTGGTCCATGCTGGGG - Intronic
1181475717 22:23166784-23166806 GTGGGTGGTGGTGCCTGCTGGGG - Intergenic
1181759680 22:25049520-25049542 CTGTGTTGTGGTTCTTGATGTGG + Intronic
1184986896 22:48141879-48141901 GTTTGTTCTGGTACTTGCGCAGG + Intergenic
949304981 3:2629535-2629557 CTGACTTCTGGTCCTTGCTGGGG + Intronic
949624248 3:5849623-5849645 GTGGCCTCTGGTGCTTGCTGAGG + Intergenic
950512334 3:13438582-13438604 TTGTGCTCTGGTTCTTGGTGAGG - Intergenic
951068451 3:18295771-18295793 CTGTGTGCTGGTGCTGGCAGTGG - Intronic
952243720 3:31562451-31562473 GTGTGTTTGGGTACTTGCTTTGG + Intronic
952616177 3:35276636-35276658 GTGTGTGCAGGTGTTAGCTGTGG - Intergenic
953781180 3:45872224-45872246 GTGTGTTCTGATGCATGTGGAGG + Intronic
954125014 3:48523049-48523071 GTTTGTTCTGGGGCTGGGTGCGG - Intronic
954966691 3:54617768-54617790 GTGTGCTCAAGAGCTTGCTGGGG + Intronic
955278434 3:57570349-57570371 TGGTGTGCTGGTGCATGCTGTGG - Intergenic
956716909 3:72087279-72087301 GGGTGGCCTGGTTCTTGCTGAGG - Intergenic
958059829 3:88465636-88465658 GTGTGTTCTGATGCTTGGCATGG - Intergenic
959515236 3:107258690-107258712 GTGTGTGCTTGTGCGTGCTTTGG - Intergenic
962537566 3:136343925-136343947 GTGAGTTGTGGTGCTGGCAGGGG + Exonic
962843511 3:139255737-139255759 GTGTGTCCAGATCCTTGCTGAGG - Intronic
963070927 3:141304569-141304591 GTGTGTGCAGGGGGTTGCTGGGG - Intergenic
963250129 3:143095500-143095522 GGGTGTTCAGGTGCTTGGGGTGG + Intergenic
967863390 3:194170318-194170340 GTGCGGTCTGGAGCCTGCTGAGG + Intergenic
967996111 3:195167975-195167997 AGGTGTTCTGGTGCTGCCTGTGG - Intronic
968458725 4:713108-713130 GTGTGGTCTGGTGGGGGCTGTGG + Intronic
968458770 4:713269-713291 GTGTGGTCTGGTGGGGGCTGTGG + Intronic
968648614 4:1751714-1751736 GTCTGCTCTGGTGGTGGCTGCGG - Intergenic
968824724 4:2886600-2886622 GTCTGTTGTGGTCCCTGCTGTGG + Intronic
970433178 4:16007809-16007831 GTTTGTTCTGAGACTTGCTGGGG + Intronic
972595470 4:40526168-40526190 GTGTGTTCTGGTCTTGGCTTTGG - Intronic
973263650 4:48188422-48188444 GAGTGCTCTGGTGGTTTCTGAGG + Intronic
977105406 4:92876745-92876767 GTGTGTTCTGCTGCTCCCTGTGG - Intronic
980613749 4:135192451-135192473 GTGTGTGTTGGCTCTTGCTGAGG - Intergenic
980886673 4:138769948-138769970 GTGTGCTCTGGTTCAGGCTGGGG - Intergenic
981012054 4:139935126-139935148 CTGTGTTCTGTGCCTTGCTGAGG - Intronic
982532109 4:156558222-156558244 GTGTGCTCTGGTACTGGCTGTGG + Intergenic
982931982 4:161419980-161420002 GAGAGTTATGGTGCTGGCTGGGG + Intronic
1202769388 4_GL000008v2_random:187568-187590 GTGTTTTGTGGTGGTTGTTGTGG + Intergenic
985767269 5:1786659-1786681 ATGTGTTCTGGAGATTTCTGTGG + Intergenic
988434041 5:31152799-31152821 GTGCTTTCTGCTTCTTGCTGAGG + Intergenic
988528012 5:32003289-32003311 GTGTGGTGTGGTGTTTGCTGTGG - Intronic
988901785 5:35740752-35740774 GCTTGTTATTGTGCTTGCTGGGG - Intronic
990910779 5:60850270-60850292 GGGTGTGGTGGTGCATGCTGTGG - Intergenic
994176495 5:96717691-96717713 GTGTGTTATGCTGCCTGATGTGG + Intronic
996602002 5:125275138-125275160 GTTTGTTCTGGTGGTTGGAGTGG - Intergenic
997781973 5:136667929-136667951 GTGTGTGCTGGTGTTGGCCGTGG - Intergenic
1000123503 5:158220706-158220728 GGGTATTCTGATGCTTTCTGGGG + Intergenic
1002267378 5:178044907-178044929 CAGGGCTCTGGTGCTTGCTGTGG - Intronic
1002612309 5:180428884-180428906 GTGTGCTCTGGTGCTTACTCAGG + Intergenic
1004094704 6:12541329-12541351 TTGATTTCTGTTGCTTGCTGTGG + Intergenic
1004135099 6:12958316-12958338 GGGAGTCCTGGTGCCTGCTGAGG + Intronic
1005765577 6:29008121-29008143 AGGTGTTCTGGTGCTTTCAGTGG + Intergenic
1005944188 6:30583799-30583821 GTGTGGTCTTGCCCTTGCTGGGG - Exonic
1006226714 6:32543983-32544005 GTGTATTCTGCTGTTTGGTGTGG + Intergenic
1008119370 6:47593591-47593613 GTGTGAAGTGGTGCTCGCTGTGG - Intronic
1011064602 6:83311587-83311609 GTGTTTTCTGGGCCTTCCTGTGG - Intronic
1011743848 6:90389751-90389773 AAGTGTTCTGGCGCTTGCAGAGG - Intergenic
1012160733 6:95882209-95882231 GTGTGCTTTGGTGTGTGCTGAGG - Intergenic
1013355170 6:109340039-109340061 GTGTGGTCTGCTTCTGGCTGAGG + Intergenic
1013638492 6:112051037-112051059 GTGTGTTCTGGAGCTGGGGGAGG + Intergenic
1013866565 6:114705179-114705201 GTGGGTTCTGGAGCTTGGCGAGG + Intergenic
1014294490 6:119601974-119601996 GTGTGTTTTCATGCTTGCTTAGG + Intergenic
1014983050 6:127967675-127967697 GGATGTCCTGGTGCTGGCTGGGG - Intergenic
1015156212 6:130099243-130099265 CTCTGTTCTTCTGCTTGCTGAGG + Intronic
1015865942 6:137726707-137726729 GTGTGTGGTGGGGCTTGGTGGGG - Intergenic
1016287373 6:142488103-142488125 GTCTTTTCTGGTACTTGCTATGG + Intergenic
1016983026 6:149870307-149870329 GGGTGATCTGGTGCTTGAAGAGG - Intergenic
1017927327 6:158921760-158921782 GTGGGTTCTGGTGTCTACTGAGG + Intergenic
1018814882 6:167323190-167323212 GTGTGTTCTGGTGCCAACAGTGG + Intergenic
1018995555 6:168707223-168707245 CTGTGTTCTGCTGCTTGCTGTGG + Intergenic
1019019332 6:168904318-168904340 GTGTATACTGCCGCTTGCTGAGG - Intergenic
1019359120 7:595632-595654 GTGTATGCCTGTGCTTGCTGTGG - Intronic
1019470071 7:1214772-1214794 GGGTGTCCTGGGTCTTGCTGAGG + Intergenic
1019576189 7:1738779-1738801 GTGTGTCCTGGTCACTGCTGTGG - Intronic
1019905199 7:4057201-4057223 GTGTGTGCAGTTGCTAGCTGTGG - Intronic
1021451059 7:20784451-20784473 GCGTCTTCACGTGCTTGCTGAGG + Exonic
1022493104 7:30835824-30835846 CTGTGTTCTGGTGAATGCAGCGG + Intronic
1024665710 7:51544884-51544906 GGGTGTTTTGGAGCTTGGTGTGG + Intergenic
1028582398 7:92421714-92421736 GTGTCATCTGTTCCTTGCTGGGG - Intergenic
1029021200 7:97366149-97366171 GTGTTTGCTGGTATTTGCTGAGG - Intergenic
1029283379 7:99450706-99450728 GTGTGTGCCGGTGCCTGCAGAGG - Exonic
1029289845 7:99493993-99494015 GTGTCCTCTGGTGCTTGGTCAGG + Exonic
1029504831 7:100956827-100956849 GAGTGTACTGGTGATGGCTGGGG - Exonic
1029993827 7:104986913-104986935 GTATATTCTGGTACTTGCTTAGG - Intergenic
1031170060 7:118282052-118282074 GGCTGTTTTGGGGCTTGCTGCGG + Intergenic
1031745675 7:125495033-125495055 GTGTTATCTTGTACTTGCTGGGG + Intergenic
1033368884 7:140691502-140691524 TTGTGTCCTGGTGCTTTCAGAGG + Intronic
1035624278 8:1059778-1059800 GTCTGTCCTGGTGGTTCCTGCGG - Intergenic
1036759492 8:11497465-11497487 GTGTGTGCTGGTGGTTGCTGGGG - Intronic
1037456253 8:19067437-19067459 GGCTGTTCTGGTGCCTTCTGTGG - Intronic
1039610235 8:38913750-38913772 GAGTGGTCTGGCGCTGGCTGGGG - Intronic
1040055786 8:43056184-43056206 GAGTGTGCGGGTGCTGGCTGCGG - Exonic
1042180279 8:66080593-66080615 GTGGGACCTGGTGCTTGCTCAGG - Intronic
1043916437 8:85927948-85927970 GTGGGTTGTGCTGCTGGCTGGGG - Intergenic
1045362359 8:101445027-101445049 GTGTGTTCTAGAACTTGCCGAGG + Intergenic
1046431521 8:114134727-114134749 TTGTGCTCAGGTGCTGGCTGTGG + Intergenic
1048329749 8:133463627-133463649 GTGTCTATTGGGGCTTGCTGTGG - Intronic
1049009225 8:139876194-139876216 CTGCGTCCTGGTGCTTTCTGGGG - Intronic
1049542401 8:143214562-143214584 GTGTGTGGTGGGGCATGCTGGGG - Intergenic
1049943257 9:569251-569273 GTATGTTATAGTGCTTGCTAAGG + Intronic
1050448215 9:5750075-5750097 GTGCTTGCTGGTGCTTGCTTTGG - Intronic
1053273233 9:36764620-36764642 GTGTGCTGTGGTGTGTGCTGTGG + Intergenic
1057351199 9:94300302-94300324 GTGTCCTCTGGTGCTTGATAAGG - Exonic
1059156785 9:111996727-111996749 GTGTGTTTTGGTGCTTGCTTTGG - Intergenic
1061160876 9:128893000-128893022 ATGGGGTCTGGTGCGTGCTGGGG + Intronic
1061750350 9:132772755-132772777 GAGAGCTCAGGTGCTTGCTGGGG - Intronic
1062151359 9:135020785-135020807 CTGTTTTCTGGTGATTTCTGAGG + Intergenic
1190726674 X:53194588-53194610 GTGTGGGCAGGTGCTGGCTGGGG - Exonic
1193265372 X:79462965-79462987 GTTTGTTCTTGTGCTCGATGGGG - Intergenic
1196603675 X:117630786-117630808 GTGTGAACTGGTGCTTGGGGAGG - Intergenic