ID: 1180197473

View in Genome Browser
Species Human (GRCh38)
Location 21:46206443-46206465
Sequence GGGCATCAGGTCAGACCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180197473_1180197482 11 Left 1180197473 21:46206443-46206465 CCCCTAGGTCTGACCTGATGCCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1180197482 21:46206477-46206499 ACACAAGGATCCTGCCACCCCGG 0: 1
1: 0
2: 1
3: 15
4: 250
1180197473_1180197477 -4 Left 1180197473 21:46206443-46206465 CCCCTAGGTCTGACCTGATGCCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1180197477 21:46206462-46206484 GCCCTCCTATCCACAACACAAGG 0: 1
1: 0
2: 0
3: 6
4: 131
1180197473_1180197483 12 Left 1180197473 21:46206443-46206465 CCCCTAGGTCTGACCTGATGCCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1180197483 21:46206478-46206500 CACAAGGATCCTGCCACCCCGGG 0: 1
1: 0
2: 1
3: 19
4: 237
1180197473_1180197488 21 Left 1180197473 21:46206443-46206465 CCCCTAGGTCTGACCTGATGCCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1180197488 21:46206487-46206509 CCTGCCACCCCGGGGGATGGAGG 0: 1
1: 0
2: 2
3: 29
4: 280
1180197473_1180197486 18 Left 1180197473 21:46206443-46206465 CCCCTAGGTCTGACCTGATGCCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1180197486 21:46206484-46206506 GATCCTGCCACCCCGGGGGATGG 0: 1
1: 0
2: 0
3: 7
4: 133
1180197473_1180197484 13 Left 1180197473 21:46206443-46206465 CCCCTAGGTCTGACCTGATGCCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1180197484 21:46206479-46206501 ACAAGGATCCTGCCACCCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 96
1180197473_1180197485 14 Left 1180197473 21:46206443-46206465 CCCCTAGGTCTGACCTGATGCCC 0: 1
1: 0
2: 0
3: 11
4: 123
Right 1180197485 21:46206480-46206502 CAAGGATCCTGCCACCCCGGGGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180197473 Original CRISPR GGGCATCAGGTCAGACCTAG GGG (reversed) Intronic
900163894 1:1237104-1237126 GGCCATCAGGGCAGGGCTAGCGG - Intergenic
900875556 1:5340243-5340265 GGGCTTCAGGTCAGAACCATGGG + Intergenic
901201486 1:7469792-7469814 AGTCATCAGCTCAGACCTCGTGG - Intronic
901220995 1:7583727-7583749 GGGCACCAGGGCAGACCTTGTGG - Intronic
901226141 1:7613931-7613953 GGGGGGCAGGTCAGACCTGGAGG + Intronic
901241281 1:7695182-7695204 GGGCATCAGGTCCCACCTCGTGG - Intronic
901618824 1:10564719-10564741 AGGCATCAGGTTAGGCATAGTGG - Intronic
901820252 1:11824576-11824598 GGGCCTCTGGGCAGGCCTAGTGG + Intronic
903461661 1:23524972-23524994 GGGCATCCGCCCAGACCCAGGGG + Intronic
905629766 1:39512031-39512053 GGGCACGAGGTCTGGCCTAGTGG + Intronic
905667993 1:39774159-39774181 GGGCACGAGGTCTGGCCTAGTGG - Intronic
906031017 1:42720167-42720189 GAGCATCAGGGGAGACCTTGAGG - Intergenic
908607263 1:65812193-65812215 AGGCAAAAGGTCAGACCTCGGGG - Intronic
909517623 1:76530321-76530343 GGGCCTCAGGTCAGCCCTGCTGG - Intronic
910930982 1:92442289-92442311 GGGAAGCAGGCCAGACCCAGAGG + Intergenic
913707018 1:121435066-121435088 TGGCTTCAGGTCTGACCCAGTGG + Intergenic
918876355 1:190049566-190049588 GGGCATCAGCTTAGACCTCTGGG - Intergenic
1065565893 10:27009196-27009218 GGACACCAGGTCAGACATAAAGG + Intronic
1069650371 10:70042801-70042823 GGGCCTCAGCTCAGCCCTTGGGG - Intergenic
1072750918 10:97978092-97978114 GGGCATTTGGTCAGAATTAGGGG - Intronic
1073082552 10:100869070-100869092 AGGCACCAGGTCAGAACTAGAGG + Intergenic
1078456983 11:11483117-11483139 GGGCATCAGATTGGACCAAGGGG - Intronic
1079727512 11:23893857-23893879 TGGTTTCAGGTCAGAGCTAGTGG + Intergenic
1080720570 11:34844475-34844497 GGGCATAAGTTCAGAGATAGTGG + Intergenic
1084672840 11:70617526-70617548 GGGCTTCAGAGCAGAGCTAGGGG + Intronic
1084910069 11:72381348-72381370 TGGCACCAGGGCAGGCCTAGAGG - Intronic
1085302549 11:75467025-75467047 GAGCATCAGGTCTGGCCTAGGGG - Intronic
1087701562 11:101441484-101441506 CTGCATCAGGTCTGCCCTAGAGG - Intergenic
1088256143 11:107905090-107905112 GGGCATGAGGCCAGACGTGGTGG - Intronic
1088812344 11:113400183-113400205 GGGCATCATGTCCTTCCTAGAGG + Exonic
1089559116 11:119334771-119334793 GGGCAACGGGTCAGACCGGGAGG - Exonic
1091831735 12:3554914-3554936 GGGACTCAGGTCAGACCCAGAGG - Intronic
1093996914 12:25652857-25652879 GGGCAATAGGTCAGCACTAGAGG + Intergenic
1094322315 12:29199057-29199079 GGACATCAGCTCAGTCTTAGTGG + Intronic
1108427878 13:50323568-50323590 GGGCATGAGGTGAGACATGGTGG - Intronic
1112428864 13:99332075-99332097 GGACAACAGGACAAACCTAGGGG - Intronic
1114678080 14:24458940-24458962 GGGCATCAGGCCAGCCCTGCGGG + Intergenic
1119728763 14:76938068-76938090 GGGCATCATGTCTGACACAGTGG + Intergenic
1121223775 14:92306447-92306469 GGGCATTAGGCCAGGCATAGTGG - Intergenic
1121485159 14:94309091-94309113 GGGCCTGAGGTCAGAGATAGAGG + Intronic
1124610033 15:31201812-31201834 GGGCATCAGCTCTGACCCAAGGG - Intergenic
1128220363 15:65964459-65964481 GGGCACCAGGGCAGAAGTAGAGG - Intronic
1131013871 15:89041732-89041754 GGTCAGCAGGGCAGACCGAGGGG - Intergenic
1132605734 16:792980-793002 GGGCATGAGGGCCGACCCAGGGG + Exonic
1141707286 16:85673921-85673943 GGGGTTCAGCTCAGACCTTGTGG - Exonic
1142262137 16:89048021-89048043 GGCCGTCAGGTGGGACCTAGGGG + Intergenic
1142353169 16:89588947-89588969 GGGCTCCAGGTCAGGCCTCGGGG + Intronic
1143375404 17:6464156-6464178 GGTCGTCAGGTAAGACCCAGGGG - Exonic
1147699158 17:42381129-42381151 GACTATCAGGTCAGACCTATTGG - Intronic
1147986454 17:44309884-44309906 GGGCATCAGGTGGGCACTAGTGG - Intronic
1148979850 17:51563026-51563048 GGGCTTGAGGTCTGACCTAGTGG - Intergenic
1152209756 17:78996838-78996860 GGGCCGCAGGTCAGAGCAAGAGG + Intronic
1155054840 18:22173482-22173504 GGACAGCAAGTCAGTCCTAGGGG + Intronic
1156112352 18:33743909-33743931 GGGAATCAAGACAGAGCTAGTGG - Exonic
1157069877 18:44393654-44393676 GGGCACAAGGTCATACCTTGTGG + Intergenic
1157131814 18:45014316-45014338 GGGTGGCAGGTCAGAGCTAGAGG - Intronic
1157902792 18:51536324-51536346 GGACATCAGCTCAGTCCCAGTGG + Intergenic
1162099618 19:8331936-8331958 GAGCCTCAGGGCAGAACTAGGGG + Intronic
1162719718 19:12655216-12655238 GGGTGACAGGTCAGACCTTGAGG - Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1165108245 19:33486874-33486896 GCCCATCAGGTCAAACCAAGAGG + Intronic
1167095992 19:47375419-47375441 GGGCCTCAGGGCAGACTCAGTGG - Intronic
931835887 2:66097957-66097979 GGGCAGGAGGGCAGCCCTAGAGG + Intergenic
936343571 2:111658427-111658449 GGCCATCAGGTCAAACCCATGGG + Intergenic
936594444 2:113834399-113834421 GGGCAGCAGGCCAGGCGTAGTGG - Intergenic
937212992 2:120289634-120289656 GGGAAACAAGTCTGACCTAGAGG + Exonic
938372204 2:130777851-130777873 TGGCATAAGGACAGACATAGTGG + Intergenic
938936993 2:136135924-136135946 GGAAATCAGGTCAGGCCCAGAGG - Intergenic
939958974 2:148549669-148549691 GGCCATCATGTCTGAACTAGGGG - Intergenic
941955250 2:171197489-171197511 GAGCATCAGGTCAGGCACAGTGG + Intronic
942195924 2:173519961-173519983 GTGAATCAGGGCAGACCTACTGG + Intergenic
943687918 2:190838878-190838900 GGGCATCAAGGGAGACCGAGAGG - Intergenic
947544769 2:231002952-231002974 GAGCATCAGGTCTTCCCTAGAGG - Intronic
1169132240 20:3172414-3172436 GGGCATCAGGAGAGTCCTTGGGG - Intronic
1169730073 20:8777117-8777139 GGGCATCAGGTCAGAGAGATGGG + Intronic
1172492274 20:35349708-35349730 GAGAATCAGGTCAGGCCTGGTGG + Intronic
1174098071 20:48105325-48105347 AGGCATCAGTTCTGACCTTGAGG - Intergenic
1178830565 21:36053197-36053219 GGGCATCAGGAGAGAGCAAGCGG - Intronic
1179774566 21:43652846-43652868 GGGCATCAGGCCAGGCGCAGTGG + Intronic
1180197473 21:46206443-46206465 GGGCATCAGGTCAGACCTAGGGG - Intronic
1181846318 22:25712108-25712130 TGGCAGCTGGTCAGAGCTAGGGG + Intronic
1184431448 22:44443494-44443516 GGGCCTCAGGCCAGTCCTGGAGG + Intergenic
1184566772 22:45296734-45296756 GGGCATCAGGTCAGCCTGGGGGG + Intergenic
1185146702 22:49141123-49141145 GGGCCTCTGGTCAGCCCTAGGGG + Intergenic
950428618 3:12938220-12938242 GGGCATCACATCACACCTGGAGG + Intronic
951129929 3:19030076-19030098 TGGCTTCAGGTGTGACCTAGTGG + Intergenic
953466668 3:43127764-43127786 GGGCATTAACCCAGACCTAGGGG + Intergenic
953587830 3:44221120-44221142 GTGCATTAGGTGAAACCTAGTGG + Intergenic
961445251 3:126977538-126977560 GAGCAGCAGCTCAGACCTACAGG - Intergenic
962253525 3:133854397-133854419 GAGCAGCAGGTCTGACCTTGGGG + Intronic
963591886 3:147270419-147270441 TGGCTTCAGGTCTGACCCAGTGG + Intergenic
967373379 3:188773816-188773838 GGGCCTCAGGAAAGAACTAGTGG + Intronic
967655636 3:192044545-192044567 GGCCTTCAGGTCTGACCTAGTGG + Intergenic
969051687 4:4377788-4377810 GTGCATCAGGGCTGGCCTAGGGG + Intronic
970173754 4:13315470-13315492 GGTCATCAGGCCAGACGTTGTGG - Intergenic
976187519 4:82457422-82457444 GGGCATCAGGTGAGCCCAGGAGG + Intronic
979966513 4:127083155-127083177 GGGGATCAGATCAGTCCTCGGGG + Intergenic
984704497 4:182837926-182837948 TGGCACCAGGGCAGACCCAGTGG - Intergenic
984772546 4:183450272-183450294 GGGAATCAGGTCAGTCCTACAGG + Intergenic
984896861 4:184548850-184548872 GGGCTTCAGGTCAGACTTGCAGG - Intergenic
985045575 4:185937563-185937585 GGGCAGGAGGACAGACCTAGAGG - Intronic
986248073 5:6029182-6029204 GGGCAGCAGGCCAGAGCAAGGGG + Intergenic
989970648 5:50520831-50520853 TGGCTTCAGGTCTGACCCAGTGG - Intergenic
996667650 5:126079453-126079475 GAGCATCAACTCAGAACTAGGGG + Intergenic
1001527668 5:172440335-172440357 AGGCAGGAGGTCAGACCTGGGGG - Intronic
1002133432 5:177094786-177094808 GGGCCACAGGTCAGCCCCAGGGG + Intronic
1002476127 5:179467391-179467413 AGGCATCAGGTAAGAGCCAGAGG - Intergenic
1013175743 6:107675232-107675254 GGGCAGCAGGTGCCACCTAGAGG + Intergenic
1013944223 6:115703645-115703667 AGGCATCAGGCAAGACCCAGTGG - Intergenic
1015112779 6:129612114-129612136 GGGCATCAGGTATGACTTAGAGG - Intronic
1017871395 6:158489468-158489490 GGCCATCATTTTAGACCTAGAGG - Intronic
1018337533 6:162810119-162810141 GGGCATCAGTGGAGGCCTAGTGG + Intronic
1019374889 7:684117-684139 GGGCATCAGCACACACGTAGAGG - Intronic
1023866643 7:44241602-44241624 GGGGGTCTGGGCAGACCTAGGGG - Intronic
1026044628 7:66898438-66898460 TGGCATCAGGCCAGACACAGTGG - Intergenic
1027054075 7:75038202-75038224 TGGCACCAGGACTGACCTAGTGG - Intronic
1027919693 7:84377191-84377213 TGGCATAAGGTCAGAGATAGGGG + Intronic
1028354233 7:89887024-89887046 GGGCCTTAGGCAAGACCTAGTGG - Intergenic
1029404989 7:100369389-100369411 TGGCATCAGGTCTGAGCTTGGGG - Intronic
1032077876 7:128844651-128844673 GGCCATAAGCACAGACCTAGGGG - Exonic
1037441074 8:18916952-18916974 GGGTATCAGGTCTGGGCTAGAGG - Intronic
1043739616 8:83794104-83794126 GGGCATCATTTCAGAACGAGAGG - Intergenic
1044133338 8:88554655-88554677 GGCCATCAGGTGACACCCAGTGG + Intergenic
1044934111 8:97277348-97277370 GGGCCTCAGGTCATAGCTGGTGG - Exonic
1045958609 8:107939957-107939979 GGGCATCAGTTCAGATCTGTTGG - Intronic
1048461553 8:134625622-134625644 GGGCACCAAGTCAGACTTTGGGG - Intronic
1049592020 8:143466886-143466908 GGGGATCTGGGCAGACCCAGAGG + Intronic
1049612005 8:143560206-143560228 GGGCATCAGGAAAGTCCCAGAGG + Intronic
1052541737 9:29819040-29819062 AAGCATCAGGTCAGACATACGGG + Intergenic
1059660723 9:116397402-116397424 GGGGAACAGGTAAGTCCTAGAGG - Exonic
1061452586 9:130676574-130676596 GGCCAGCAGGTCAGAGCTGGAGG - Intronic
1062140186 9:134951999-134952021 TGGGGTCAGGTAAGACCTAGAGG - Intergenic
1186924947 X:14323279-14323301 GTACAGCAGGTCAGACCCAGGGG + Intergenic
1192221912 X:69203228-69203250 GGGCATCTTGTGAGACCTTGAGG + Intergenic
1192841274 X:74858226-74858248 TGGCTTCAGGTCTGACCCAGTGG + Intronic