ID: 1180201209

View in Genome Browser
Species Human (GRCh38)
Location 21:46225523-46225545
Sequence CAGGCCCACCCGCAGTTATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 13, 1: 35, 2: 63, 3: 139, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180201206_1180201209 3 Left 1180201206 21:46225497-46225519 CCTCTTGTGGACGGCCTGACATC 0: 1
1: 147
2: 125
3: 45
4: 83
Right 1180201209 21:46225523-46225545 CAGGCCCACCCGCAGTTATCCGG 0: 13
1: 35
2: 63
3: 139
4: 184
1180201205_1180201209 6 Left 1180201205 21:46225494-46225516 CCACCTCTTGTGGACGGCCTGAC 0: 2
1: 224
2: 99
3: 59
4: 74
Right 1180201209 21:46225523-46225545 CAGGCCCACCCGCAGTTATCCGG 0: 13
1: 35
2: 63
3: 139
4: 184
1180201204_1180201209 9 Left 1180201204 21:46225491-46225513 CCTCCACCTCTTGTGGACGGCCT 0: 1
1: 221
2: 99
3: 59
4: 99
Right 1180201209 21:46225523-46225545 CAGGCCCACCCGCAGTTATCCGG 0: 13
1: 35
2: 63
3: 139
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180201209 Original CRISPR CAGGCCCACCCGCAGTTATC CGG Intronic
900125220 1:1066029-1066051 CAGGCCTGCCTGCAGTCATCCGG - Intergenic
900628505 1:3621120-3621142 CAGGCTTGCCCACAGTTATCTGG - Intergenic
900654529 1:3748690-3748712 CAGGCCTGCCCACAGTCATCCGG - Intergenic
900664621 1:3806420-3806442 TAGGCTCGCCCGCAGTTATCCGG - Intergenic
900957242 1:5893647-5893669 CATGCTCGCCTGCAGTTATCCGG - Intronic
901040994 1:6363426-6363448 CAGGCCTGCCCGCAGTTATCCGG + Intronic
901054803 1:6444094-6444116 CAGGCCCATCCCTAGTTACCTGG - Intronic
901234930 1:7662721-7662743 CAGGCCTACCCTCAGCTCTCTGG - Intronic
901834161 1:11912913-11912935 CAGGCCTGCCCGCAGTCATCCGG - Intergenic
902088591 1:13883842-13883864 CAGCCCCCACCGCAGTTCTCAGG - Intergenic
902303714 1:15521364-15521386 CATGCCTGCCCGCAGTCATCCGG + Intronic
904341449 1:29837465-29837487 CAAGCCCACCCCCACTTACCTGG - Intergenic
904466458 1:30710936-30710958 CAGGCCCAGCCTCAGGTATCAGG + Intergenic
904740025 1:32667138-32667160 CAGGCCTGCCCACAGTCATCCGG + Intronic
905708993 1:40085074-40085096 CAGGCCCGCCTGCAGTTATCCGG + Intronic
906086449 1:43139226-43139248 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
906835958 1:49083554-49083576 CAGGGCCCCCCGCTCTTATCTGG - Intronic
907288834 1:53399651-53399673 CAGGCCTGCCCGCAGTCATCTGG + Intergenic
907294977 1:53444949-53444971 CAGGCCCGCCTGCAGGCATCTGG + Intergenic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
909455283 1:75842886-75842908 CAGGCTCGTCCACAGTTATCCGG + Intronic
911958076 1:104263127-104263149 CAGGCTCGCCCGCAGTTTTCCGG - Intergenic
914378850 1:147098344-147098366 CAGGCTCGCCCGCAGTTATCTGG - Intergenic
915481907 1:156192628-156192650 CAGGCCCGCCCGCGGTTATCCGG + Intergenic
916525674 1:165606799-165606821 CAGGCCTGCCCACAGTCATCCGG - Intergenic
923863474 1:237915777-237915799 CAGGCTTGCCTGCAGTTATCCGG + Intergenic
923864004 1:237919475-237919497 CAGGCTTGCCTGCAGTTATCCGG - Intergenic
924759561 1:246971387-246971409 CAGGCCCACCCACAGCTATCCGG - Intronic
1063787533 10:9402441-9402463 CAGGCCTGCCTGCAGTTATCTGG + Intergenic
1063985240 10:11494912-11494934 CAGGCTCGCCTGCAGTTATCCGG - Intronic
1064018804 10:11793142-11793164 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
1065623330 10:27606071-27606093 CAGGGTCACCCGAAGTTATTCGG - Intergenic
1067673350 10:48346630-48346652 CAGGCTCTCCCACAGTTATCCGG + Intronic
1071430499 10:85602857-85602879 ATGGCCAACCCTCAGTTATCTGG + Intronic
1071573093 10:86708638-86708660 CAGGCCCACCTGCCCTTCTCTGG - Intronic
1072068576 10:91894403-91894425 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1072499117 10:95994489-95994511 CAGGCCTGCCTGCAGTCATCCGG - Intronic
1072818999 10:98537793-98537815 CAGGCCTGCCTGCAGTCATCCGG + Intronic
1072863290 10:99029785-99029807 CAGGCTTGCCCGCAGTTATCCGG - Intronic
1073240990 10:102057997-102058019 CAGGCCTACCCGCAGCCAACCGG + Intergenic
1073342885 10:102759064-102759086 CAGGCCTGCCCACAGTCATCCGG - Intronic
1073928384 10:108544490-108544512 CAGGCCCACCCACAGCCATCCGG - Intergenic
1074976763 10:118587449-118587471 CAGGCCCACCAGCTGTTCTCTGG - Intergenic
1076316909 10:129548722-129548744 CAGTCCCACCTGCAGCTTTCGGG + Intronic
1076419632 10:130321746-130321768 CAGGCTCACCCGCAGTTATCCGG + Intergenic
1076526074 10:131113000-131113022 CACGCTCACCCACAGTTACCCGG - Intronic
1076729799 10:132432547-132432569 CAAGCCCACCCGCCCTTAGCAGG + Intergenic
1076894786 10:133305090-133305112 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1076896304 10:133314195-133314217 CAGGCCCGCCCGCAGCCATCTGG + Intronic
1076897766 10:133322251-133322273 CAGGCCTGCCCACAGTCATCCGG + Intronic
1076906997 10:133367644-133367666 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1076912298 10:133397044-133397066 CAGGCCTGCCCGCAGTTATCCGG + Intronic
1076927155 10:133497360-133497382 CAGGCCCACCCACAGTTATTCGG - Intergenic
1077006772 11:361865-361887 CAGACCTGCCCGCAGTTATCCGG - Intergenic
1077264994 11:1644175-1644197 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1077388335 11:2286367-2286389 CAGGCTCACCCGCAGTTATCCGG - Intergenic
1077520089 11:3027947-3027969 CAGGCTCGCCCGCAGTTATCCGG + Intronic
1077706652 11:4493221-4493243 CAGGCCCACCCACAGCCATCTGG - Intergenic
1077929108 11:6711931-6711953 CAGGCCCGCCCGCAGTTATCTGG + Intergenic
1079882336 11:25943869-25943891 CAGGCCCACCCCCAGCCTTCAGG + Intergenic
1080070894 11:28085334-28085356 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1080643077 11:34169295-34169317 CAGGCCGGCTCGCAGATATCAGG + Intronic
1080784739 11:35464443-35464465 CAGGCCCCACAACAGTTATCTGG - Intronic
1082580070 11:54855444-54855466 CAGGCTTGCCCGCAGTTATCCGG + Intergenic
1082954145 11:58850816-58850838 CAGGCCCACCCACAGTTATCTGG + Intronic
1083349422 11:62016798-62016820 CAGGACTGCCTGCAGTTATCTGG + Intergenic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1084202792 11:67572996-67573018 CAGGCCTGCCCGCAGCCATCCGG + Intergenic
1084217717 11:67659393-67659415 CAGGCCCACCTACAGCCATCTGG - Intergenic
1091593163 12:1857369-1857391 CAGGCCCATCAGCAGTGATGTGG + Intronic
1092224925 12:6742021-6742043 CAGGCTGGCCCGCGGTTATCCGG + Intergenic
1092444164 12:8538191-8538213 CAGGCTTGCCCGCAGTTATCCGG + Intronic
1094477346 12:30851413-30851435 CAGGCCCGCCCGCAGCCATCCGG + Intergenic
1097089955 12:56497080-56497102 CAGGCTTGCCCGAAGTTATCGGG + Intergenic
1097090552 12:56501190-56501212 CAGGCTTGCCCGAAGTTATCGGG - Intergenic
1097175363 12:57139324-57139346 CACCCCCACCCGTAATTATCAGG + Intronic
1097591697 12:61582660-61582682 CAGGCTCGCCTGCGGTTATCCGG - Intergenic
1098677995 12:73315528-73315550 CAGGCCCACCTCCAGGAATCTGG - Intergenic
1098935366 12:76472850-76472872 CAGGCCTGCCCACAGTTATCTGG - Intronic
1101390331 12:104294145-104294167 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1101776514 12:107799444-107799466 CAGACTCGCCTGCAGTTATCAGG - Intergenic
1103844678 12:123893104-123893126 CAGGCCCACACGCTGCTCTCTGG + Intronic
1104771651 12:131367726-131367748 CAGGCCCACCTGCAGACATCAGG + Intergenic
1104795843 12:131516898-131516920 CAGGCCTGCCCGCAGTCATCCGG - Intergenic
1104871492 12:132001521-132001543 CAGGCCCACGCACAGTTATCCGG - Intronic
1104878249 12:132051731-132051753 CAGGCCCGCCCGCAGTTATCCGG - Intronic
1104885148 12:132102997-132103019 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1104913758 12:132253252-132253274 CAGGCCTGCCCGCAGTCATCCGG - Intronic
1105019940 12:132809326-132809348 CAGGCCTGCCCGCAGTTATCCGG - Intronic
1105020158 12:132810816-132810838 CAGGCCCGCGCACAGTTATCCGG + Intronic
1105043094 12:132977269-132977291 CAAGCCCGCCCGCAGTCATCCGG + Intergenic
1105287122 13:19013533-19013555 CAGGCCCACCCACAGTTATCCGG + Intergenic
1105581991 13:21706762-21706784 CAGGCTCAGCCACGGTTATCTGG - Intergenic
1105856344 13:24375888-24375910 CAGGCTTGCCTGCAGTTATCCGG + Intergenic
1105876139 13:24555037-24555059 CAGGCCCACCCGCAGTTATCTGG - Intergenic
1106715889 13:32387594-32387616 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1110703081 13:78572179-78572201 CAGGCCCATGCCCAGTGATCTGG + Intergenic
1111108493 13:83675916-83675938 CAGGCCTGCCCACAGTCATCCGG - Intergenic
1112014121 13:95317290-95317312 CAGGCCTGCCCGCAGTCATCTGG + Intergenic
1112038718 13:95523809-95523831 CAGCCCCAACAACAGTTATCTGG - Intronic
1113775395 13:112942126-112942148 CAGGCCCACCCGCAGTTATCTGG + Intronic
1113856777 13:113450862-113450884 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1113880322 13:113621845-113621867 CAGGCTCGCCTGCAGTTATCTGG + Intronic
1114165781 14:20216963-20216985 CAGGCTTGCCCGCAGTTATCTGG - Intergenic
1114658119 14:24328313-24328335 CAGGCTCACCCACAGTTATCCGG + Intronic
1115176030 14:30562669-30562691 CAGGCCCACCCGCAGTTACCTGG + Intronic
1115546171 14:34466546-34466568 CAGTCCCACCCCCAGCTCTCTGG + Intergenic
1115821279 14:37214948-37214970 CAGGCCCACCCGCAGTTATCCGG + Intronic
1116561464 14:46384749-46384771 CAGGCCTGTCCGCAGTCATCCGG - Intergenic
1117632584 14:57709088-57709110 TGGGCCTGCCCGCAGTTATCTGG - Intronic
1121034896 14:90693742-90693764 CATTCCCACCAGCAGTTATGAGG - Intronic
1121631911 14:95427383-95427405 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1122756004 14:103980596-103980618 TAGGCCCGCCCGCAGTTATCCGG - Intronic
1123193251 14:106591716-106591738 CAGACCCGCCCGCACTTATCCGG - Intergenic
1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG + Intergenic
1125760268 15:42091648-42091670 TAGGCTCGCCCGCAGTTACCTGG + Intronic
1125785801 15:42316667-42316689 CAGGCCTGCCAGCAGTCATCTGG - Intronic
1126061220 15:44784670-44784692 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1127752157 15:62056644-62056666 CAGGCTTGCCCGCAGTTATCCGG + Intronic
1127877585 15:63123912-63123934 CAGGCTTGCCCGCAGTTATCCGG - Intronic
1129468074 15:75735071-75735093 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1129921127 15:79319972-79319994 CAGGCCCACCCGCAGTTATCCGG - Intronic
1130011487 15:80156016-80156038 CAGGCCTGCCCGCAGTCATCTGG - Intronic
1132966820 16:2660741-2660763 CAGGCTTGCCCGTAGTTATCCGG - Intergenic
1132967952 16:2670008-2670030 CAGGCTTGCCCGTAGTTATCCGG - Intergenic
1133010325 16:2907028-2907050 CAGGCTTGCCCACAGTTATCCGG - Intergenic
1133108153 16:3527610-3527632 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1133934681 16:10259119-10259141 CAGGCCTGCCCACAGTCATCTGG + Intergenic
1134400475 16:13905204-13905226 CAGGCTTGCCCGCAGTTATCCGG + Intergenic
1136319188 16:29471494-29471516 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1136433759 16:30210838-30210860 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1136584023 16:31172101-31172123 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1136711779 16:32243396-32243418 CAGGCCTGCCCGTAGTCATCCGG + Intergenic
1136756137 16:32686011-32686033 CAGGCCTGCCCGTAGTCATCCGG - Intergenic
1136811976 16:33184362-33184384 CAGGCCTGCCCGTAGTCATCCGG + Intergenic
1136818452 16:33294442-33294464 CAGGCCTGCCCGTAGTCATCCGG + Intronic
1136825016 16:33350975-33350997 CAGGCCTGCCCGTAGTCATCCGG + Intergenic
1136830082 16:33449746-33449768 CAGGCCTGCCCGTAGTCATCCGG + Intergenic
1138591976 16:58005220-58005242 TAGGCCCGCCCGCAGTTATCTGG - Intronic
1139068878 16:63355881-63355903 CAGGCCTGCCCGCAGCCATCCGG - Intergenic
1140570869 16:76104663-76104685 CAGACTTGCCCGCAGTTATCCGG + Intergenic
1140761326 16:78111641-78111663 CAGGCCTGCCCACAGTCATCCGG + Intronic
1141601238 16:85127633-85127655 CAGGCACACAGGCAGTCATCAGG - Intergenic
1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG + Exonic
1142384297 16:89752955-89752977 CAGACTCGCCCGCAGTTATCCGG + Intronic
1142389994 16:89793081-89793103 CAGGCTCACCCACAGTTATCCGG - Intronic
1142393714 16:89819085-89819107 CAGGCCTGCACGCAGTCATCCGG + Intronic
1202990554 16_KI270728v1_random:7332-7354 CAGGCCTGCCCGTAGTCATCCGG + Intergenic
1203058275 16_KI270728v1_random:946363-946385 CAGGCCTGCCCGTAGTCATCCGG - Intergenic
1142546632 17:708545-708567 CAGGCCTGCCCACAGTCATCCGG - Intronic
1142741451 17:1934210-1934232 CAAGCCCACCCACAGCTGTCCGG + Intergenic
1143452975 17:7047250-7047272 CAGGCCTCCCCGCAGTCATCCGG - Intergenic
1143464465 17:7126764-7126786 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
1143499984 17:7333061-7333083 CAGGCCTCCCCGCAGTCATCCGG - Intergenic
1145223460 17:21107914-21107936 CAGGCTTGCCCGCAGTTGTCCGG - Intergenic
1145732004 17:27197926-27197948 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1146103813 17:30012287-30012309 CAGGCTCGCCCGCAGTTGTCTGG + Intronic
1146356098 17:32135538-32135560 CAGGCTCACCCGCAGTTATCGGG - Intergenic
1146761245 17:35481318-35481340 CAGGCCTGCCCGCAGCCATCTGG + Intronic
1147820049 17:43236021-43236043 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147821363 17:43243420-43243442 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147822160 17:43247903-43247925 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147823084 17:43253349-43253371 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147823854 17:43257949-43257971 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147824613 17:43262389-43262411 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147825770 17:43268872-43268894 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147827789 17:43280213-43280235 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147828897 17:43286374-43286396 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147829992 17:43292517-43292539 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147834980 17:43323622-43323644 CAGGCCGGCCCGCAGTCATCCGG - Intergenic
1147838333 17:43351251-43351273 CAGGCCTGCCCGTAGTCATCTGG - Intergenic
1148401131 17:47362580-47362602 CAGGCCTGCCCGCAGTTATCCGG + Intronic
1152682487 17:81676253-81676275 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1152740619 17:82016866-82016888 CAGACCCACCGGCACTTACCTGG - Exonic
1152745900 17:82038956-82038978 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1152874332 17:82777763-82777785 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1153163097 18:2230683-2230705 CAGGCCTGCCCACAGTTATCGGG - Intergenic
1153649802 18:7229883-7229905 CAGGTCCACCCGCCTTGATCAGG + Intergenic
1155011675 18:21784885-21784907 CAGGCCCGCCCGCAGCCATCCGG + Intronic
1155443965 18:25891377-25891399 CAAGCCCACCCGGAGTTTCCAGG + Intergenic
1157517843 18:48323527-48323549 CAGGCCCACCCTCAGCTTTAAGG - Intronic
1161834079 19:6633209-6633231 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1161870938 19:6869416-6869438 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1161894076 19:7067136-7067158 CAGGCTCGCCTGCAGTTATCTGG - Intergenic
1162224172 19:9205884-9205906 CAGGCCTGCCTGCAGTTATGCGG + Intergenic
1162292559 19:9791127-9791149 CAGGCCTGCCCGCAGCCATCCGG - Intronic
1162638554 19:11988884-11988906 CAGGCCCACCCGCAGCCATCCGG - Intergenic
1162729954 19:12712409-12712431 CAGGTTTGCCCGCAGTTATCCGG + Intronic
1163075660 19:14888850-14888872 CAGGCCCGCCGGCAGCCATCCGG - Intergenic
1163456287 19:17407726-17407748 CAGGCTCGCCCGCGGTTATCTGG - Intronic
1163471355 19:17499036-17499058 CAGGCTTGCCCACAGTTATCCGG - Intronic
1163639371 19:18452662-18452684 CAGCCCCACCAGCAGTGATGAGG - Intronic
1163881825 19:19930386-19930408 CAGGCCTGCCTGCAGTTATCCGG - Intronic
1163885191 19:19959170-19959192 CAGGCCTGCCTGCAGTTGTCTGG - Intergenic
1163992120 19:21008419-21008441 CAGGCCCGCCTGCAGCCATCTGG + Intergenic
1164083496 19:21880735-21880757 CAGGCTCACCCGCAGTTATCCGG - Intergenic
1164389087 19:27802312-27802334 CAGGCTCGCCCACAGTTATCCGG - Intergenic
1164955194 19:32377091-32377113 CAGGCCCGCCCGCAGTTATCTGG - Intronic
1164967444 19:32497570-32497592 CAGGCCCTCCCACAGTCATCCGG - Intergenic
1165381963 19:35488117-35488139 GAGGCCCACCCGCACTTAGAAGG - Intronic
1165541198 19:36493088-36493110 CAGGCCCGCCCGCAGTTATCTGG - Intergenic
1165915799 19:39258736-39258758 CAGGCCTGCCCGCAGTCATCTGG - Intergenic
1166140043 19:40800606-40800628 CAGGCTCTCCCTCAGTTACCAGG + Exonic
1166282021 19:41800487-41800509 CAGGTCCACTCGCAGTTATCCGG + Intronic
1166433977 19:42751653-42751675 CAGGTCCACCCGCAGTTATCTGG - Intronic
1166446832 19:42865429-42865451 CAGGTCCACCTGCAGTTATTTGG - Intronic
1166472157 19:43087724-43087746 CAGGTCCACCCGCAGTTATCTGG - Intronic
1166483297 19:43191674-43191696 GAGGTCCAACCACAGTTATCCGG - Intronic
1166780727 19:45341081-45341103 CAGGCTCACCCGCAGTCACAAGG - Intronic
1167227775 19:48260090-48260112 CAGGCCCGCCCGCAGTTATCCGG - Intronic
1167318555 19:48781168-48781190 CAGGCCTGCCCACAGTCATCCGG - Intergenic
1167519043 19:49941395-49941417 CAGGCTCGCCTGCAGTTATCCGG + Intronic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167895528 19:52577792-52577814 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1167927750 19:52835224-52835246 CAGGCCTGCCCGCAGTCATCCGG - Intronic
1167970299 19:53185105-53185127 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1167971399 19:53189692-53189714 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1167990986 19:53360497-53360519 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1168084730 19:54037213-54037235 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1168131503 19:54322865-54322887 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1168215120 19:54919622-54919644 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1168480920 19:56719008-56719030 CAGGCTCGCCCACAGTTATCCGG - Intergenic
1168603399 19:57738701-57738723 CAGGCCCACCCGCAGTTATCCGG + Intronic
1168680328 19:58310735-58310757 CAGGCTCGCCCACAGTTATCCGG - Intronic
1168726382 19:58584662-58584684 TAGGCCTGCCCGCAGTCATCTGG + Intergenic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
927210203 2:20634490-20634512 CAGGCCCATGCGCAGTGGTCGGG + Intronic
927428609 2:23007981-23008003 CAGCCCCACCCACAGCTATCAGG - Intergenic
928365504 2:30697589-30697611 TAGGCCTGCCCGCAGTTATCTGG + Intergenic
930115717 2:47716700-47716722 CAGGCCCACCCGCAGTTATCCGG + Intronic
931116662 2:59173255-59173277 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
932342809 2:70977308-70977330 CAGGCCCGCCCACAGTTATCTGG - Intronic
932672982 2:73754256-73754278 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
934136345 2:88999764-88999786 CAGGCCTGCCCACAGTCATCCGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935881853 2:107573242-107573264 CAGGCTCACCCGCAGTTATCTGG + Intergenic
939345732 2:140964321-140964343 CAGGCTCGCCCGCAGTTATCCGG - Intronic
940357113 2:152755374-152755396 CAGGCCCGCCTGCAGTTATCCGG + Intronic
941928211 2:170916459-170916481 CAGGCTCGCCCACAGTTATCTGG + Intergenic
941968818 2:171328091-171328113 CACTCCCACCTGCAGTTCTCAGG - Intronic
945779599 2:214153012-214153034 CAGGCTTGCCCGCAGTTATCCGG - Intronic
946240897 2:218355024-218355046 CAGGCCTGCCCGCAGCCATCCGG + Intergenic
946416562 2:219543081-219543103 CAGGGCCATCGGAAGTTATCGGG + Intronic
947606599 2:231490024-231490046 CAGGCCCGCCTACAGTTATCCGG - Intergenic
947974354 2:234352209-234352231 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
948813119 2:240495328-240495350 CAGGCCCGCCCACAGTTATCCGG + Intronic
949019348 2:241732548-241732570 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
949046739 2:241875772-241875794 CAGGCTCGCCCACAGTTATCCGG - Intergenic
1168882172 20:1216456-1216478 CAGGCGGGCCCGCAGTCATCCGG + Intergenic
1168966482 20:1901591-1901613 CAGGAACACCAGCAGTTAACAGG - Intronic
1169295527 20:4394103-4394125 CAGACTGGCCCGCAGTTATCTGG - Intergenic
1170934689 20:20799425-20799447 CAGGCCCAACTGCAGGTACCAGG - Intergenic
1172537724 20:35687220-35687242 CAGGCCTGCCCGCAGTTATCTGG + Intronic
1176007432 20:62874037-62874059 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
1176076618 20:63251343-63251365 CAGGCCCGCCCGCAGTTATCCGG - Intronic
1176154952 20:63614592-63614614 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1176386038 21:6138913-6138935 CAGGCCCACGCGTAGTAACCCGG - Intergenic
1177173268 21:17677044-17677066 CAGGCCTGCGCGCAGTCATCCGG - Intergenic
1179275980 21:39891975-39891997 CAGGCCTGCCTGCAGTCATCCGG - Intronic
1179737435 21:43399339-43399361 CAGGCCCACGCGTAGTAACCCGG + Intergenic
1179916157 21:44479580-44479602 CAGACTCGCCCACAGTTATCCGG - Intergenic
1179970240 21:44832815-44832837 CCGGCCTGCCCGCAGTCATCCGG + Intergenic
1180011690 21:45055371-45055393 CAGGCCCACCCGGAACTCTCAGG + Intergenic
1180112003 21:45662977-45662999 CAGGCCTGCCCACAGTTATCTGG + Intronic
1180200978 21:46224001-46224023 CAGACCTGCCCGCAGTTATCCGG + Intronic
1180201209 21:46225523-46225545 CAGGCCCACCCGCAGTTATCCGG + Intronic
1180830800 22:18905143-18905165 CAGGCTTGCCTGCAGTTATCCGG - Intergenic
1181259655 22:21588326-21588348 CAGGACCATTCTCAGTTATCGGG + Intronic
1181598045 22:23930408-23930430 CAGGCCCGCCTGCAGTTATCCGG + Intergenic
1181729894 22:24837486-24837508 CAGGCTCGCCCGCAGTTATCTGG - Intronic
1181837836 22:25625628-25625650 CAGGCTCGCCCACAGTTATCCGG + Intronic
1183642198 22:39099601-39099623 AAGGCACACCCACAGTTCTCAGG + Intronic
1184133430 22:42531597-42531619 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1184351636 22:43947979-43948001 CAGGCTCGCCCACAGTTATCTGG - Intronic
1185112446 22:48908146-48908168 CAGGCCTGCCCGCAGTCATCCGG - Intergenic
1185350490 22:50334157-50334179 CAGGCCCGCCCGCAGCCATCCGG - Intergenic
1185355658 22:50368209-50368231 CAGGCCCGCCCGCAGCCATCTGG - Intronic
1185386533 22:50534314-50534336 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1203280889 22_KI270734v1_random:130414-130436 CAGGCTTGCCTGCAGTTATCCGG - Intergenic
950401300 3:12771101-12771123 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
950415738 3:12868228-12868250 CAGTCCCGCCCGCAGCCATCCGG + Intronic
952912480 3:38202989-38203011 CAGGCCTGCCTGCAGTCATCCGG + Intronic
953059771 3:39417721-39417743 CAGGCCTGCCTGCAGTTATCCGG + Intergenic
953171844 3:40514114-40514136 CAGGCCCACCCGCAGCCATCCGG + Intronic
953900140 3:46835498-46835520 CAGGCCTGCCTGCAGTCATCCGG - Intergenic
960593401 3:119387019-119387041 CAGGCTCGCCCGCAGTTATCTGG - Intronic
962299394 3:134224522-134224544 CAGGCCCGCCCGCAGCCATCTGG - Intronic
963326967 3:143873978-143874000 CAGGCCTGCCTGCAGTCATCTGG - Intergenic
963405156 3:144854074-144854096 CAGGCCTGCCCGCAGTCATCTGG - Intergenic
964101402 3:152992407-152992429 CAGGCTTGCCCGCAATTATCCGG + Intergenic
964767363 3:160191677-160191699 CAGGCTCACCTGCAGTTCTAGGG - Intergenic
966815554 3:183887028-183887050 CAGGCTTTCCCGCAGTTATCCGG + Intergenic
966962632 3:184955178-184955200 TAGGCCTGCCCGCAGTCATCTGG + Intronic
968050847 3:195654004-195654026 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
968104977 3:195994334-195994356 CAGGCTCGCCTGCAGTTATCCGG - Intergenic
968108562 3:196022433-196022455 CAGGCCCGCCTGCAGTTATCCGG + Intergenic
968303272 3:197631921-197631943 CAGGCTCGCCTGCAGTTATCCGG - Intergenic
968350909 3:198051172-198051194 CAGGCCCACCCGCAGTTATCCGG + Intergenic
968404725 4:330061-330083 TAGGCCTGCTCGCAGTTATCTGG - Intergenic
968559136 4:1267928-1267950 TAGGCCCGCCCGCAGTTATCTGG - Intergenic
968729873 4:2264642-2264664 CAGGCCCACCTGCAGCCATCTGG - Intergenic
968846817 4:3047724-3047746 CAGGCCCGCCCACAGCCATCCGG + Intergenic
969642423 4:8406884-8406906 CAGGCTTGCCCGCAGTTATCCGG - Intronic
971588076 4:28431830-28431852 CAGGCCAACCCTCAGCTCTCAGG + Intergenic
973266810 4:48219399-48219421 CAGGCCTGCCTGCAGTCATCCGG + Intronic
973960924 4:56108952-56108974 CAGGCCTGCCTGCAGTCATCCGG - Intergenic
974240082 4:59235702-59235724 CGGGCTCGCCCGCAGTTATCTGG - Intergenic
974493391 4:62595632-62595654 CAGGCTCGCCCGCAGCTATCTGG + Intergenic
975377817 4:73665921-73665943 CAGGCCCACCCACAGTTATCCGG - Intergenic
975387472 4:73774053-73774075 CAGGCCTGCCCACGGTTATCCGG - Intergenic
976254425 4:83085193-83085215 CAGGCCTGCCCACAGTTATCCGG + Intergenic
978308110 4:107354293-107354315 CAGGCCCGCCCGCAGTTATCCGG - Intergenic
978502541 4:109424423-109424445 CAGGCCTGCCCGCAGTCATCTGG + Intergenic
982395117 4:154907791-154907813 CAGGTCCACCCGCAGTCATCCGG - Intergenic
982763403 4:159315906-159315928 CAGGCTCGCCCGCAGTTATCCGG - Intronic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
985291360 4:188391340-188391362 CAGGCCTGCCCACAGTTATCTGG - Intergenic
987500140 5:18698560-18698582 CAGGCCCGCCCACAGCCATCGGG - Intergenic
989361436 5:40606063-40606085 CAGGCCCACCCTGTGCTATCAGG - Intergenic
989431603 5:41361348-41361370 CAGGCAGACCCGCAGTTTTTTGG + Intronic
993547459 5:89230042-89230064 CAGGCCCACCCCCATATTTCTGG - Intergenic
997971977 5:138410990-138411012 CAGGCTTGCCCGCAGTTATCCGG - Intronic
998539329 5:142965253-142965275 CAGGCTTGCCCACAGTTATCCGG - Intronic
1001559087 5:172657772-172657794 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1001816417 5:174673015-174673037 CTTGCCCATCCGCAGTTATATGG + Intergenic
1002205778 5:177561636-177561658 CAGGCCAGCCCACGGTTATCCGG + Intergenic
1002550841 5:179990503-179990525 CAGGCCCACCCGCAGTTATCTGG - Intronic
1002635798 5:180608058-180608080 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1005576527 6:27194930-27194952 CAGGCCTGCCCACAGTCATCCGG - Intergenic
1005709733 6:28491548-28491570 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1006368723 6:33631647-33631669 CAGGCCTGCGCGCAGTCATCCGG - Intronic
1006484521 6:34327698-34327720 CAGGCCTGCCCACAGTCATCTGG - Intronic
1006652126 6:35560193-35560215 CAGGCTTGCCCGCAGTTATCCGG - Intergenic
1007742802 6:44023076-44023098 CAGGCCATAACGCAGTTATCAGG + Intergenic
1008216632 6:48797809-48797831 CAGGCTTGCCCACAGTTATCTGG - Intergenic
1008586966 6:52959263-52959285 CAGCCACAGCCGCAGATATCAGG - Intergenic
1013470275 6:110457960-110457982 CAGGCCTGCCTGCAGTTATCTGG + Intronic
1018023854 6:159789252-159789274 CCAGCCCACCCGCCGTTCTCTGG - Intronic
1019423211 7:961164-961186 CAGGCCTGCCCGCAGTCATCCGG - Intronic
1022705759 7:32800836-32800858 CAGGCCCACCAGCAGTTATCTGG + Intergenic
1023021798 7:36017807-36017829 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1023788734 7:43735088-43735110 CAGGCCTGCCCGCAGTCATCCGG - Intergenic
1023827704 7:44020540-44020562 CAGGCCCGCCCACAGTTACCCGG + Intergenic
1024456542 7:49614918-49614940 CAGACCTGCCCGCAGTCATCCGG + Intergenic
1026731780 7:72918161-72918183 CAGGCTTGCCCGCAGTTATCTGG - Intronic
1026870115 7:73845841-73845863 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1029381459 7:100217932-100217954 CAGGCCCGCCCACAGCCATCCGG - Intronic
1029400891 7:100345245-100345267 CAGGCCCGCCCACAGCCATCCGG - Intronic
1029562161 7:101309704-101309726 CAGGCTTGCCCGCAGTTATCTGG - Intergenic
1029699680 7:102238114-102238136 CAGGCTTGCCCGCAGTTATCTGG - Intronic
1029756007 7:102573964-102573986 CAGGCCCGCCCACAGTTACCCGG + Intronic
1029773949 7:102673036-102673058 CAGGCCCGCCCACAGTTACCCGG + Intergenic
1030606626 7:111644959-111644981 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
1033574036 7:142662847-142662869 CAGGCCCGCCCGCGGTTATCCGG + Intergenic
1033785669 7:144727221-144727243 CAGGTTTGCCCGCAGTTATCTGG + Intronic
1034274481 7:149818048-149818070 CATGCCCACCCTCAGTGGTCAGG + Intergenic
1035156805 7:156920868-156920890 CAGGCCTGCCCGCAGTCATCTGG - Intergenic
1035324374 7:158055477-158055499 CAGGCCCACCCGCAGTTATCCGG + Intronic
1036991955 8:13608119-13608141 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1037057232 8:14457509-14457531 CAGGCTTGCCTGCAGTTATCCGG + Intronic
1037076992 8:14732523-14732545 CAGTCCCACCTGCAGCTGTCAGG + Intronic
1037802944 8:22044900-22044922 CAGGCCCAACCTCAGCCATCTGG - Intronic
1039555514 8:38472240-38472262 CAGGCCCCCAACCAGTTATCAGG - Intergenic
1039704867 8:39996201-39996223 CAGGCCTGCCTGCAGTCATCTGG + Intronic
1041596914 8:59665850-59665872 CAGGCCTGCCCGCAATCATCTGG + Intergenic
1041650196 8:60294688-60294710 CAGGCCTGCCCGCAGTCATCTGG + Intergenic
1042849501 8:73202654-73202676 CAGGCCCAACAGCTTTTATCTGG - Intergenic
1043978313 8:86608533-86608555 CAGGCTCACCCGCAGTTATCCGG + Intronic
1046067487 8:109213901-109213923 CAGGCTTGCCTGCAGTTATCTGG + Intergenic
1046413871 8:113884671-113884693 CAGGCCTGCCTGCAGTCATCCGG - Intergenic
1046638887 8:116703423-116703445 CAGGCCTGCCCGCAGCCATCCGG + Intronic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1047972553 8:130097669-130097691 CAGGCCCACGGGCAGTTTTCAGG + Intronic
1048042744 8:130746933-130746955 CAGGCCTGCCCACAGTCATCTGG + Intergenic
1049458746 8:142710257-142710279 CAGGCTCGCCCGCAGTTATCTGG - Intergenic
1049516241 8:143058617-143058639 CAGACCGGCCCGCAGTTATCCGG - Intronic
1049516430 8:143060302-143060324 CAAGCCCGCCCGCAGTTATCTGG + Intergenic
1049561677 8:143315175-143315197 CAGGCTCGCCCGCAGTTATCCGG + Intronic
1049635033 8:143683553-143683575 CAGGCCTGGCCGCAGTCATCCGG + Intergenic
1049666223 8:143844322-143844344 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
1049881355 8:145066302-145066324 CAGGCCCACCCGCAGTTATCCGG + Intergenic
1050227429 9:3475769-3475791 CAAGCCTGCCCACAGTTATCTGG - Intronic
1052718723 9:32148923-32148945 CAGGCCCGCCCACAGTTATCCGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055438879 9:76319707-76319729 CAGACCTGCCCGCAGTCATCCGG + Intronic
1055476249 9:76666340-76666362 CAGGCTTGCCCGCAGTTATCCGG + Intronic
1057697978 9:97340871-97340893 CAGGCTTGCCCACAGTTATCCGG + Intronic
1058159228 9:101549495-101549517 CAGGCTCGTCCGCCGTTATCCGG - Intronic
1058294935 9:103294541-103294563 GAGGCCCGCCCGCAGTCATCCGG - Intergenic
1061039207 9:128129944-128129966 CAGGCTCGCCCGCAGTTATCTGG - Intergenic
1061048768 9:128181851-128181873 CAGGCTTGCCCGCAGTTATCAGG + Intronic
1061066296 9:128279714-128279736 CAGGCCGGCCCGCAGTCATCCGG - Intronic
1061535378 9:131245097-131245119 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1061682975 9:132252571-132252593 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1061785526 9:133025662-133025684 CTGACCCGCCCACAGTTATCCGG + Intergenic
1061787816 9:133041278-133041300 CAGACCTGCCCGCAGTTATCCGG + Intronic
1061835873 9:133329313-133329335 CAGGCCTGCCCGCAGTTATCTGG - Intergenic
1062173869 9:135150052-135150074 CAGGCTTGCCCGCAGTCATCCGG - Intergenic
1062183924 9:135206317-135206339 CAGGCCTGCCTGCAGTTATTCGG - Intergenic
1062309684 9:135929150-135929172 TGGGCCCACCCCCAGTTATGTGG + Intergenic
1062531766 9:137004647-137004669 CAGACCTGCCCGCAGTTATCCGG + Intergenic
1062557204 9:137119056-137119078 CAGACCCGCCCGCAGTTATCCGG + Intergenic
1062557589 9:137121820-137121842 CAAGCCCGCCCGCAGCCATCCGG + Intergenic
1062639359 9:137510265-137510287 CAGACCTGCCCACAGTTATCCGG + Intronic
1062642334 9:137525728-137525750 CAAGCCCGCCCGCAGCCATCCGG - Intronic
1062645493 9:137546002-137546024 CAGGTTCGCCCGCAGTTATCCGG + Intronic
1062647971 9:137559483-137559505 CAGACCTGCCCGCAGTTATCCGG + Intronic
1203488194 Un_GL000224v1:77849-77871 CATTCCCACCTGCAGTTATCTGG + Intergenic
1203500815 Un_KI270741v1:19745-19767 CATTCCCACCTGCAGTTATCTGG + Intergenic
1185619679 X:1445987-1446009 CAGACCCGCCCGCAGTTATCCGG + Intronic
1187672972 X:21686896-21686918 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1188212534 X:27442376-27442398 CAGGCCTGCCCACAGTTATCCGG - Intergenic
1190511482 X:51177791-51177813 CAGGCCTGCCCGCAGTCGTCTGG - Intergenic
1191881670 X:65848874-65848896 CAGCCCCACCTACAGTTCTCTGG + Intergenic
1193611372 X:83635245-83635267 CATGCCCACCCACAGCCATCTGG - Intergenic
1196634777 X:117989927-117989949 AAGGCCCAACCTCAGTTCTCAGG - Intronic
1197077941 X:122375565-122375587 CAGGCTTGCCCGCAGTTATCCGG - Intergenic
1198272331 X:135066524-135066546 CAGGCCCGACCGCAGCCATCCGG + Intergenic
1198521276 X:137455228-137455250 CAGTCCCACCCTCAGTTCTTAGG - Intergenic
1198998671 X:142606666-142606688 CAGGTCCACCCGAAGTTGTCCGG - Intergenic
1200412665 Y:2876970-2876992 CAGGTTCGCCCGCAGTTATCCGG + Intronic
1201423539 Y:13825174-13825196 CAGGCCTGCTCGCAGTTATCTGG + Intergenic
1201541757 Y:15112382-15112404 CAGGCCTGCCCACAGTCATCTGG - Intergenic
1201543787 Y:15138331-15138353 CAGGCCCACCTGCAGCTACCCGG + Intergenic
1201708150 Y:16959439-16959461 CAGGCCCACCCACAGGTATCTGG + Intergenic
1201748382 Y:17405392-17405414 CAGGACCACCCGCAGTTATTTGG + Intergenic