ID: 1180201656

View in Genome Browser
Species Human (GRCh38)
Location 21:46228457-46228479
Sequence CTTCCAGGCCGGTCTGCTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180201653_1180201656 -10 Left 1180201653 21:46228444-46228466 CCCAGGGCGTAGGCTTCCAGGCC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 82
1180201650_1180201656 -5 Left 1180201650 21:46228439-46228461 CCAGCCCCAGGGCGTAGGCTTCC 0: 1
1: 0
2: 1
3: 26
4: 169
Right 1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 82
1180201652_1180201656 -9 Left 1180201652 21:46228443-46228465 CCCCAGGGCGTAGGCTTCCAGGC 0: 1
1: 0
2: 2
3: 14
4: 97
Right 1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 82
1180201646_1180201656 17 Left 1180201646 21:46228417-46228439 CCGCGGAAGCAACTTACGGTGTC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180201656 Original CRISPR CTTCCAGGCCGGTCTGCTCG CGG Exonic