ID: 1180201656

View in Genome Browser
Species Human (GRCh38)
Location 21:46228457-46228479
Sequence CTTCCAGGCCGGTCTGCTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180201646_1180201656 17 Left 1180201646 21:46228417-46228439 CCGCGGAAGCAACTTACGGTGTC 0: 1
1: 0
2: 0
3: 2
4: 27
Right 1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 82
1180201652_1180201656 -9 Left 1180201652 21:46228443-46228465 CCCCAGGGCGTAGGCTTCCAGGC 0: 1
1: 0
2: 2
3: 14
4: 97
Right 1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 82
1180201653_1180201656 -10 Left 1180201653 21:46228444-46228466 CCCAGGGCGTAGGCTTCCAGGCC 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 82
1180201650_1180201656 -5 Left 1180201650 21:46228439-46228461 CCAGCCCCAGGGCGTAGGCTTCC 0: 1
1: 0
2: 1
3: 26
4: 169
Right 1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG 0: 1
1: 0
2: 0
3: 4
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180201656 Original CRISPR CTTCCAGGCCGGTCTGCTCG CGG Exonic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900838020 1:5021139-5021161 CTTCCAAGCCTGTCTGCTCAGGG - Intergenic
901064655 1:6489076-6489098 GTTCCAGGCCCGTCTGCTGTCGG - Intronic
903803821 1:25989973-25989995 CATCCAGGCCACTCTGCTCTAGG + Intronic
904751553 1:32743676-32743698 CTTCCAGGCTGGTCTCCCAGAGG - Intronic
906204172 1:43978535-43978557 CTTCTAGGCCCGTTTGCTCAGGG + Intergenic
915164228 1:153939670-153939692 CTTCATGGCCTGTCTGCTCAAGG - Exonic
924273736 1:242363148-242363170 CTTCCAGGCAGGTGTGCCCCAGG - Intronic
1064919823 10:20504290-20504312 CTTCAAGGAGGGTCTGGTCGTGG - Intergenic
1069597348 10:69681090-69681112 CTTCCAGGCTGGTCTCCTTGAGG - Intergenic
1069828860 10:71270686-71270708 CTTCCAGTCCGTGCTGCTGGAGG - Intronic
1070752786 10:78973888-78973910 TTTCCAGGCCGGCCGGCCCGAGG + Intergenic
1071480617 10:86062229-86062251 CTTCCAGGCCTCTCTGCCTGCGG - Intronic
1073082799 10:100870615-100870637 CCTCCAGGCCGGGCTGCTGCAGG + Intergenic
1077367688 11:2167727-2167749 CTGCCAGGCAGCTCTGCTCCAGG - Intronic
1082810495 11:57476566-57476588 CTTCCAGGCGTGTCCGCCCGCGG + Exonic
1083616438 11:64028752-64028774 CTGCCAGGCCTGGCTGCTGGGGG + Intronic
1084757924 11:71251282-71251304 CCTCCAGGCGGGTCTGCGTGCGG - Intronic
1088648417 11:111936894-111936916 CTTGCAGGCGGGTGTGCCCGTGG - Intronic
1104733331 12:131121112-131121134 TTTCCAGGCGGGTCCACTCGAGG + Intronic
1114647664 14:24264487-24264509 CTTCCAGGCAGGTCAGCCAGAGG + Intergenic
1119601472 14:75979806-75979828 CCTCCAGGCCGGTGGGCACGGGG - Intronic
1121989892 14:98546458-98546480 CTTCCAGGCAGTTCTGTTCCAGG - Intergenic
1122533210 14:102443636-102443658 CTTCCTGGCAGGTCTGAGCGTGG + Exonic
1122728319 14:103775775-103775797 CTTCCAGGCGGATCTGCTTCAGG - Intronic
1122791817 14:104187265-104187287 CTCCCAGGCCTGTGGGCTCGGGG - Intergenic
1122883779 14:104701569-104701591 GGTCCAGGCCGCTCTGCTCCAGG - Exonic
1125134522 15:36326483-36326505 CTTTCATGCCTGTCTGCTCTGGG + Intergenic
1129205372 15:74034374-74034396 CTTGCAGGCCAGTCGGCTGGGGG - Intronic
1131156869 15:90080980-90081002 CTGCCCGGCCAGGCTGCTCGGGG - Exonic
1131300947 15:91199361-91199383 CCTCCAGGCCAGTGTGCTCCGGG + Intronic
1132640213 16:974758-974780 CTGCCAGGCCGGGGTGCTGGGGG - Intronic
1136383943 16:29911228-29911250 CATCCAGGCCCGTCTTCTGGGGG - Intronic
1136418279 16:30116676-30116698 CTTCCAGCCCGGAGTGCTGGAGG - Exonic
1139647118 16:68339414-68339436 CTCCGAGGCTGGTCTGCACGTGG - Exonic
1141974721 16:87507962-87507984 ATTCCAGCGCAGTCTGCTCGGGG - Intergenic
1142032659 16:87846273-87846295 CTTCCAGGCTGGCCTGCCTGTGG - Intronic
1142501650 17:336477-336499 CTGCCAGGTCTGCCTGCTCGGGG + Intronic
1145413570 17:22694622-22694644 CTGCCAGGCCGGTCAGCGCAGGG + Intergenic
1145414587 17:22704157-22704179 CTGCCAGGCCGGTCAGCGCTGGG - Intergenic
1145998055 17:29115673-29115695 CTCCCAGGCCACTCTCCTCGGGG + Exonic
1148767688 17:50048779-50048801 CTGCCATGCAGGTGTGCTCGTGG + Intergenic
1151332082 17:73415967-73415989 CTGCCTGGCCGGGCTGCCCGTGG - Exonic
1163297345 19:16420926-16420948 CTGCCAGGCCACTCTGCTAGAGG + Intronic
1163411760 19:17159262-17159284 CTTCTAGGCCTGGCTGCTGGGGG + Intronic
1166189733 19:41168304-41168326 TTTTCAGGCAGGTCTCCTCGGGG - Intergenic
1166966403 19:46531743-46531765 CTTCCAGACAGATCTGCTCCAGG - Intronic
1167300140 19:48673234-48673256 CTCCTAGGCCAGGCTGCTCGGGG - Intergenic
931359197 2:61563955-61563977 CTTCTAAGCCCTTCTGCTCGTGG - Intergenic
931666170 2:64610797-64610819 CTTTCTGGCTGGTCTGCTTGGGG + Intergenic
948652358 2:239456270-239456292 CTCCCAGGCTGTTCTGCTCCAGG + Intergenic
1175919227 20:62442260-62442282 AGTCCAGGCCAGTCTGCTCATGG + Intergenic
1176307010 21:5128846-5128868 CTTCCATGACTGTCTCCTCGCGG + Intergenic
1179628656 21:42663576-42663598 CTGCCAGGCCTGTCTGCTGTGGG - Intronic
1179850049 21:44133184-44133206 CTTCCATGACTGTCTCCTCGCGG - Intergenic
1180036261 21:45251944-45251966 CTCCCAGGCCCGTCTCCTCAGGG - Intergenic
1180201656 21:46228457-46228479 CTTCCAGGCCGGTCTGCTCGCGG + Exonic
954779182 3:53046372-53046394 CTTCCGGGCCGTTCCGCTCGGGG - Intronic
954852702 3:53617036-53617058 ATTCCAGGCAGGTGTGCTGGGGG - Intronic
962368980 3:134805189-134805211 CCTCCAGGGCTGTCTGCTCCTGG + Intronic
985783597 5:1883015-1883037 CGGCCAGGCCGGGCTGCGCGAGG - Intronic
986253598 5:6083239-6083261 CTTCTAAGCTGATCTGCTCGCGG + Intergenic
986269431 5:6218146-6218168 CTTCCAGGCCCTTCTGCACAGGG - Intergenic
1000039344 5:157473597-157473619 CTGCCAGGCTGGAGTGCTCGGGG - Exonic
1001906313 5:175476506-175476528 TTTCCAGGCCAGCCTGCTGGAGG + Intergenic
1006950764 6:37819761-37819783 ATTCCAGGCCGGTCAGCTGGAGG - Exonic
1024465054 7:49703482-49703504 CTTCCTGCCCTGTCTGCTGGAGG + Intergenic
1025875582 7:65477535-65477557 CTCCCAGGAAGGTCTTCTCGGGG - Intergenic
1031063233 7:117075602-117075624 CTTCCAGGCCTGTCTGTGTGAGG + Intronic
1031512249 7:122665173-122665195 CTTCCACGCCTGTCTGCATGTGG + Intronic
1033125987 7:138707776-138707798 CCTCCAGGCCTCTCTGCTTGTGG + Intronic
1035414674 7:158673050-158673072 CTCCCTGGCCGGTCTTCTCTTGG - Intronic
1036221172 8:6922772-6922794 CTTGCAGGCCGCTGTGCTCTGGG + Intergenic
1039455195 8:37701178-37701200 CTTCCTGGCCGCGCTCCTCGTGG + Intergenic
1040600474 8:48878833-48878855 CTTCCAGGCAGCCCTGCTGGAGG - Intergenic
1048001087 8:130380108-130380130 CTTCCAGGCTGGGCTTCTGGGGG - Intronic
1054971976 9:71098682-71098704 CTTCCAGGCCAGTGTGGTCAGGG - Intronic
1057170610 9:92960972-92960994 CTTCCAGGCCTCTCTCCTAGTGG + Intronic
1186470978 X:9822138-9822160 TTCCCAGGCCTGTCTGCTCCTGG - Intronic
1189988656 X:46574948-46574970 CTTCCTGACCGGTGCGCTCGAGG + Exonic
1190063150 X:47223638-47223660 CATCCAGGCCTATCTGCTCAGGG - Exonic
1190230269 X:48576344-48576366 CATGCAGGCAAGTCTGCTCGGGG + Exonic
1192190924 X:68990769-68990791 CTCCCAGGCAGGGCTGCTGGAGG - Intergenic
1192947661 X:75983513-75983535 CTTCCAGATCTGTCTGCTCCTGG + Intergenic
1198983759 X:142427034-142427056 CTTCCAGGCCCGCCTCCTCCAGG - Intergenic
1200092857 X:153643964-153643986 TTTCCTGGTCGGTCTCCTCGCGG - Intronic