ID: 1180203858

View in Genome Browser
Species Human (GRCh38)
Location 21:46244801-46244823
Sequence ACGTACCCCCCAGGGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180203849_1180203858 -2 Left 1180203849 21:46244780-46244802 CCAGACCTCCCCAGGTCAAGCAC 0: 1
1: 0
2: 3
3: 30
4: 296
Right 1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 64
1180203844_1180203858 23 Left 1180203844 21:46244755-46244777 CCTGAGACTTGGCTGCAGCCACC 0: 1
1: 0
2: 5
3: 27
4: 285
Right 1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 64
1180203846_1180203858 5 Left 1180203846 21:46244773-46244795 CCACCCACCAGACCTCCCCAGGT 0: 1
1: 0
2: 8
3: 64
4: 782
Right 1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 64
1180203850_1180203858 -7 Left 1180203850 21:46244785-46244807 CCTCCCCAGGTCAAGCACGTACC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 64
1180203851_1180203858 -10 Left 1180203851 21:46244788-46244810 CCCCAGGTCAAGCACGTACCCCC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 64
1180203847_1180203858 2 Left 1180203847 21:46244776-46244798 CCCACCAGACCTCCCCAGGTCAA 0: 1
1: 0
2: 2
3: 14
4: 168
Right 1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 64
1180203848_1180203858 1 Left 1180203848 21:46244777-46244799 CCACCAGACCTCCCCAGGTCAAG 0: 1
1: 0
2: 2
3: 21
4: 247
Right 1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180203858 Original CRISPR ACGTACCCCCCAGGGGTGGA AGG Exonic
901879987 1:12188213-12188235 ACATACCCACAGGGGGTGGAAGG + Intronic
903259214 1:22122260-22122282 ATGAAGCCCCCAGTGGTGGAGGG - Intronic
903273971 1:22209091-22209113 ATGTGCCCAGCAGGGGTGGATGG + Intergenic
903296337 1:22345424-22345446 ACGGATGCACCAGGGGTGGATGG - Intergenic
904696590 1:32335047-32335069 ACTTATCCCCCAAGGGTGAAGGG - Exonic
907937746 1:59057701-59057723 GCCTTCCCCCCAGTGGTGGATGG + Intergenic
920100126 1:203512132-203512154 CCCCACCCCCCAGGGGTGGGTGG + Intergenic
922203880 1:223430093-223430115 AAGTCCCTCTCAGGGGTGGATGG - Intergenic
922350545 1:224731677-224731699 ACGTACATCCTAGTGGTGGAGGG + Intronic
924253588 1:242159639-242159661 CCCTACCCTCCAGGGTTGGAGGG + Intronic
1070628157 10:78065991-78066013 AGGTGCCCCCCAGGAGAGGAAGG + Intergenic
1072547223 10:96449009-96449031 AAGTGCCCCCCAGTGATGGAGGG + Intronic
1078619515 11:12893996-12894018 ACCTACCCCCCAGGGCAGGCTGG - Intronic
1078922486 11:15843465-15843487 ATGTAACCACCAGGGCTGGAAGG - Intergenic
1079407490 11:20159084-20159106 GCATAACCCCGAGGGGTGGACGG + Intronic
1081426740 11:42933842-42933864 ATGTAACCCCCAGTGTTGGAGGG - Intergenic
1084544037 11:69805069-69805091 TCCTGCCTCCCAGGGGTGGAAGG - Intergenic
1086580996 11:88398230-88398252 ACATATCCCCCAGGGATGAAAGG - Intergenic
1091285412 11:134405904-134405926 ACCAAGCCACCAGGGGTGGAAGG - Intronic
1101997141 12:109533557-109533579 AGGTACCCCCACGGGGTGGGTGG + Exonic
1106259862 13:28056917-28056939 ACGTACCTCACAGGATTGGAAGG - Intronic
1113893697 13:113749662-113749684 ACGGGGCCCCCAGGGGTGCAGGG - Intergenic
1117868109 14:60170382-60170404 ACTTCCCACCCAGGGATGGAGGG + Intergenic
1122643746 14:103177685-103177707 AGGGACCCCCCTGGGGTGGGTGG - Intergenic
1122929831 14:104928140-104928162 ACATTACCCCCAGGGGTGGAAGG - Intronic
1123021037 14:105398174-105398196 GCGTGCTCCCAAGGGGTGGACGG - Intergenic
1126709968 15:51444085-51444107 TCATACTACCCAGGGGTGGAGGG + Intergenic
1135293601 16:21260889-21260911 AGGTACCCTTCAGAGGTGGAGGG - Intronic
1137596463 16:49727380-49727402 GCTTACCCCTCAGGGGTGGGAGG - Intronic
1146819371 17:35972360-35972382 ACCTACCCCCCAGTGTTGAAAGG - Intergenic
1148858208 17:50590697-50590719 ACCTATTCCCCTGGGGTGGAGGG + Intronic
1150229826 17:63543885-63543907 ATGCAACCCCCAGGGGTGTATGG + Intronic
1150354437 17:64471046-64471068 AATTACCCCCTAGGGATGGATGG - Intergenic
1162403108 19:10457819-10457841 AGGGAGCCTCCAGGGGTGGAAGG + Intronic
1162746368 19:12801060-12801082 ACGTACTTCCCTGGGGAGGAGGG + Exonic
934946673 2:98547423-98547445 ACCCAGCCCCCAGGGGTGGGAGG + Intronic
948138871 2:235658571-235658593 ACGTGCCCAGCAGGGGTGGAGGG + Intronic
948318324 2:237047544-237047566 GTGAACCCCCCAGGGATGGAAGG + Intergenic
1172290555 20:33773130-33773152 ACCTACCTCCCAGGGCTGCAGGG - Intronic
1174873651 20:54206084-54206106 AAGTGGACCCCAGGGGTGGAGGG - Intergenic
1180203858 21:46244801-46244823 ACGTACCCCCCAGGGGTGGAAGG + Exonic
1180253470 21:46605716-46605738 ACCTTCCACCCTGGGGTGGAGGG - Intergenic
1181971931 22:26697416-26697438 TCTAACCCACCAGGGGTGGAAGG - Intergenic
1183047655 22:35233094-35233116 CTGTACCCCCCAGGTGTTGAGGG - Intergenic
1185210747 22:49569314-49569336 ACTTACACTCCAGGGGAGGATGG - Intronic
950018415 3:9769790-9769812 ACGCAGCGCCCAGGGGTGCAGGG + Intronic
953404952 3:42655418-42655440 AGGTACCCCTCAGGTGTAGAAGG + Intronic
961713086 3:128842048-128842070 CCGTACACCCCAGGTGAGGAAGG - Intergenic
961929669 3:130519698-130519720 ACCTACCTCACAGGGGTGTATGG + Intergenic
962796818 3:138856544-138856566 CCCTACCCCACAGGGATGGATGG + Intergenic
992002628 5:72450668-72450690 ACCTACCGCCCAGGTGTGAATGG - Intronic
999258156 5:150221421-150221443 ACGGGCCCCCCAGAGGTGGGTGG + Intronic
1001818860 5:174694077-174694099 ACGTCACCTCCTGGGGTGGAGGG - Intergenic
1003298444 6:4854777-4854799 ATGTACACCCCTGGGGTGGCTGG - Intronic
1006220688 6:32487942-32487964 AAGTTCCCTCCAGGGGTGGAGGG - Intergenic
1009296042 6:61948952-61948974 AGGTAGCTCCCATGGGTGGATGG - Intronic
1018579533 6:165296726-165296748 GCGTACCTCTCAGGGGTGGTAGG - Intronic
1024237737 7:47410511-47410533 AGGGACCCCGCAGGCGTGGATGG + Intronic
1026264452 7:68784010-68784032 ACTTACCCCTGAGGGGTGGAGGG + Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035708319 8:1694648-1694670 ACACACCCCCCGGGGTTGGATGG - Intronic
1036396106 8:8372554-8372576 CCGTACCCGCCTGGGTTGGAGGG + Intronic
1036691316 8:10946523-10946545 ACGCCACCCCCAGGGGTGGGAGG - Intronic
1043863722 8:85352164-85352186 ACCTAACCTCAAGGGGTGGATGG + Intronic
1045332498 8:101167441-101167463 ATGTACACCTCAAGGGTGGATGG - Intergenic
1049306545 8:141907109-141907131 AGGTAGCCCCCAGGGCTGGAGGG - Intergenic
1049550974 8:143259549-143259571 CCGTGCACCCCAGGGCTGGATGG - Intronic
1058803266 9:108565618-108565640 TCTTACAACCCAGGGGTGGATGG + Intergenic
1062560217 9:137138333-137138355 ACGCACACTCCAGGGGTGGAGGG + Intergenic
1186611003 X:11138800-11138822 ACGGTCCCCCCTGGGCTGGAGGG + Exonic
1187412295 X:19062002-19062024 AAGGACCCCCCAGGCCTGGATGG - Intronic