ID: 1180204139

View in Genome Browser
Species Human (GRCh38)
Location 21:46246876-46246898
Sequence ATGCTGTTGCAGGTGGCCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 472}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180204139_1180204144 6 Left 1180204139 21:46246876-46246898 CCATGGGCCACCTGCAACAGCAT 0: 1
1: 0
2: 3
3: 64
4: 472
Right 1180204144 21:46246905-46246927 CATCAGGAGAGATGCACCATGGG 0: 1
1: 0
2: 0
3: 12
4: 132
1180204139_1180204142 -10 Left 1180204139 21:46246876-46246898 CCATGGGCCACCTGCAACAGCAT 0: 1
1: 0
2: 3
3: 64
4: 472
Right 1180204142 21:46246889-46246911 GCAACAGCATCAAGATCATCAGG 0: 1
1: 1
2: 7
3: 56
4: 380
1180204139_1180204143 5 Left 1180204139 21:46246876-46246898 CCATGGGCCACCTGCAACAGCAT 0: 1
1: 0
2: 3
3: 64
4: 472
Right 1180204143 21:46246904-46246926 TCATCAGGAGAGATGCACCATGG 0: 1
1: 0
2: 0
3: 16
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180204139 Original CRISPR ATGCTGTTGCAGGTGGCCCA TGG (reversed) Exonic
900112464 1:1014288-1014310 TTGCTGCTTCAGGTGGGCCACGG - Exonic
900919742 1:5662693-5662715 CTGCTGCTGCTGGAGGCCCAGGG - Intergenic
901104289 1:6743361-6743383 ATGCCGACGCAGCTGGCCCATGG - Intergenic
901924227 1:12555660-12555682 TGCCTGTTGCAGGTGGGCCAAGG - Intergenic
902176938 1:14657485-14657507 ATGCTGATGCTAGTGGCCCAGGG + Intronic
902271889 1:15310581-15310603 ATGCTGATGCTGCTGGTCCAGGG - Intronic
902397697 1:16141528-16141550 GTGCTGGTTCAGGTGGTCCAGGG + Intronic
902755679 1:18547860-18547882 ACGCTGTTGCAGGAGGCAGATGG + Intergenic
903646230 1:24897852-24897874 AAGCTCTTGCTGGTGGCTCAGGG + Intergenic
904379070 1:30099164-30099186 ACGATGTAGCAGGCGGCCCAGGG + Intergenic
904852425 1:33468885-33468907 AGACTATTGCATGTGGCCCAAGG + Intergenic
904975229 1:34451092-34451114 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
906132891 1:43471837-43471859 ATGCTGATGCTGTTGGTCCAGGG + Intergenic
907520559 1:55020780-55020802 ACTCTGATGCAGGTGGCCCCTGG + Intergenic
907748416 1:57238162-57238184 ATGCTGATACTGCTGGCCCAAGG - Intronic
907841293 1:58160170-58160192 GTGCAGTTGCAGGTAGGCCAGGG + Intronic
908029128 1:59981489-59981511 ATGTTCCTCCAGGTGGCCCAGGG + Intergenic
908394492 1:63713126-63713148 AGGCAGGTGCAGGTGGCCCTAGG - Intergenic
909727615 1:78854423-78854445 ATTCTGTTACAGGTGATCCATGG - Intergenic
910432195 1:87169857-87169879 ATTCTGATGCAGGTGGTCCCAGG - Intergenic
912505530 1:110153096-110153118 GAGCTGTTGCAGGTGGCCAAGGG - Intronic
913109800 1:115647734-115647756 AGGGTGTTGAAGGTGGCACAGGG + Intronic
914351657 1:146845132-146845154 ATGGTTTTGTGGGTGGCCCAGGG - Intergenic
915457080 1:156048150-156048172 ATTCTGATGCAGGTGATCCATGG + Intronic
915674052 1:157514601-157514623 ATGCTGATGCTGCTGGCCCTGGG - Exonic
917657408 1:177140361-177140383 ATTCTGTTACAGGAGGCTCAGGG - Intronic
917672676 1:177287853-177287875 ATGCTGATGCTGCTGGTCCATGG + Intergenic
917679857 1:177354800-177354822 ATCCTGTAGCAGGAGTCCCACGG + Intergenic
918121495 1:181545053-181545075 ATTCTGATGCAGGTGGCTCATGG + Intronic
918154320 1:181830966-181830988 ATGCAGTAGTAGGTGCCCCAGGG - Intergenic
918219780 1:182426356-182426378 CTGGTGTTGGAGGTGGCTCAGGG + Intergenic
918594667 1:186279185-186279207 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
919064873 1:192681892-192681914 ATGATGTTGAAGTTGGCTCACGG + Intergenic
920384744 1:205563025-205563047 ATGCTGCTGCTGGTGGTCCAGGG + Intergenic
921424123 1:214982809-214982831 ACGCTGATGCTGCTGGCCCAGGG - Intergenic
921640095 1:217542975-217542997 ATGCTGGTGCAGGTGGCATCTGG + Intronic
922033091 1:221823362-221823384 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
922034539 1:221835643-221835665 ATTCTGATGCTGGTGGTCCAGGG - Intergenic
923542381 1:234897791-234897813 ATGCTGATGATGCTGGCCCAAGG + Intergenic
924268878 1:242311451-242311473 ATGCTGATGCTGTAGGCCCAGGG + Intronic
1063622749 10:7664428-7664450 ATTCTGATGCAGGTGGTCCATGG - Intronic
1063671659 10:8104253-8104275 AGGCTCTTGCAGGTGTCTCAGGG - Intergenic
1063861640 10:10315120-10315142 ATGCTGTGGCAAGTGGCACCAGG + Intergenic
1064925186 10:20561917-20561939 ATGCTGATGCTGTTGGTCCATGG + Intergenic
1065415973 10:25486680-25486702 ATGCTGATGCTGTTGGTCCATGG + Intronic
1065884598 10:30065853-30065875 ATCCTGGTGTAGGTGGTCCATGG - Intronic
1065917720 10:30366661-30366683 GTACTGCTGCAGGTGACCCAGGG + Intronic
1066604851 10:37154379-37154401 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1066605332 10:37161149-37161171 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1066606045 10:37172240-37172262 ATGCTGCTGCTGGTGGTCCTTGG + Intronic
1066606392 10:37178473-37178495 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1066606829 10:37184043-37184065 ATGCTGCTGCTGGTGGTCCTTGG + Intronic
1066607174 10:37190274-37190296 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1066607594 10:37195789-37195811 ATGCTGCTGCTGGTGGTCCTTGG + Intronic
1067696696 10:48541095-48541117 ATGCTGATGCAGCTGGCCCATGG + Intronic
1067791643 10:49292885-49292907 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1068404740 10:56574383-56574405 GTGCTGCTGCAGGGGGTCCAGGG + Intergenic
1068773618 10:60849048-60849070 ATGCTGATGCGGCTGGTCCATGG + Intergenic
1070494144 10:77006101-77006123 TTGCTGATGCAGGTGGCAGATGG - Intronic
1070553596 10:77511227-77511249 ATGCTGATGCTGTTGACCCAGGG + Intronic
1071120365 10:82269824-82269846 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1071439585 10:85678514-85678536 CTGCTGTAGTTGGTGGCCCAGGG + Intronic
1071460294 10:85887462-85887484 ATGCTGATACTGTTGGCCCATGG - Intronic
1072096026 10:92180793-92180815 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1074113421 10:110438278-110438300 TTCCTGTTGGAGGTGGCCCCAGG + Intergenic
1074143299 10:110695995-110696017 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1074156345 10:110803535-110803557 ATGCTGCTGCTGGTGGTCCTCGG + Intronic
1074310828 10:112321953-112321975 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1075070666 10:119318032-119318054 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1075178200 10:120185283-120185305 ATGCTGATGCAGCTGGTCCAGGG - Intergenic
1076802822 10:132839305-132839327 ATGGCCTGGCAGGTGGCCCAGGG - Intronic
1077426625 11:2482810-2482832 TTGCTGCTGCAGGTGCACCAGGG - Intronic
1077610918 11:3642602-3642624 ATGCTGGAGCACGTGGCCCAGGG - Intergenic
1078475640 11:11627035-11627057 ATGCTGATGCCAGTGGTCCATGG - Intergenic
1080249326 11:30215317-30215339 ATGCTGATCCTGCTGGCCCAGGG + Intergenic
1080758917 11:35228892-35228914 ATGCTTTTGCTGCTGGTCCAGGG + Intronic
1082238733 11:49851253-49851275 AGGCTGATGCCGCTGGCCCAGGG + Intergenic
1082243410 11:49893074-49893096 AGGCTGATGCTGCTGGCCCAGGG - Intergenic
1082657906 11:55873900-55873922 AGGCTGATGCCGCTGGCCCAGGG - Intergenic
1083690690 11:64406724-64406746 AAACTGTCTCAGGTGGCCCAAGG - Intergenic
1083977854 11:66138409-66138431 ATGCTGATGCTGATGGTCCATGG + Intronic
1084480808 11:69419021-69419043 GTGTTGTTGCAAGAGGCCCATGG - Intergenic
1086690686 11:89786608-89786630 AGGCTGATGCCGCTGGCCCAGGG + Intergenic
1086697836 11:89864898-89864920 AGGCTGATGCCGCTGGCCCAGGG - Intergenic
1086708326 11:89979590-89979612 AGGCTGATGCCGCTGGCCCAGGG + Intergenic
1086715115 11:90053052-90053074 AGGCTGATGCCGCTGGCCCAGGG - Intergenic
1087075501 11:94124136-94124158 ATACTGCTGCAGGGGGTCCAGGG - Intergenic
1087618979 11:100520951-100520973 ATTCTGGTGCAGTTGGACCAAGG + Intergenic
1088464435 11:110119323-110119345 ATGCTGTTGCTGTTGGTCCCTGG - Intronic
1088574040 11:111252413-111252435 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1088592017 11:111411686-111411708 ATACCGTTGCTGCTGGCCCATGG + Intronic
1089354294 11:117839877-117839899 CTGCTGTTGGGGGTGGCCCACGG - Intronic
1090428533 11:126627303-126627325 AGGCTGGAGCAGGTGGCCAAGGG + Intronic
1091404838 12:202751-202773 AAGTTGTTGCAGGTCGTCCAGGG + Exonic
1091841516 12:3624736-3624758 AGGCTGATGCTGGTGGTCCAGGG - Intronic
1092378452 12:7975256-7975278 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1093672042 12:21888512-21888534 ATGCTGATGCTGGTGGTCCTTGG - Intronic
1094166333 12:27447424-27447446 AGGCTGTTGCAGCTGGTCCATGG - Intergenic
1094494788 12:30982583-30982605 ATCCTGTTGCGGGAGGCCGAGGG + Exonic
1096002356 12:48140403-48140425 ATTCTGATGCAGGTGATCCAAGG + Intronic
1098701400 12:73632402-73632424 ATGCTGTTGTTGCTGGTCCAGGG - Intergenic
1099377003 12:81904133-81904155 GTGCTGCTGCAGGGGGTCCAGGG - Intergenic
1099931851 12:89084277-89084299 ATTCTGATGCAGGTGCTCCAGGG + Intergenic
1101473812 12:105024724-105024746 ATGCTGATGCTAGTGGTCCATGG + Intronic
1101706718 12:107227405-107227427 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1102202271 12:111065759-111065781 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1102565554 12:113795022-113795044 ATGCTGGTGGAGGTGGCAGAAGG + Intergenic
1102944076 12:116970115-116970137 ATGCTGTGGCACGAGGCCAAAGG - Intronic
1103015924 12:117494471-117494493 ATGCTGATGCTGGGGGTCCAGGG + Intronic
1103065004 12:117890109-117890131 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1103170888 12:118818849-118818871 CTGCTGTTGCATGTTGCTCAAGG - Intergenic
1103786278 12:123435792-123435814 ATGCTGATGCTATTGGCCCAGGG - Intronic
1103939886 12:124495835-124495857 ATGCTGTGGCCTGTGGCCCGTGG - Intronic
1104768139 12:131343849-131343871 ATGGGGTGGCAGGTGCCCCAGGG + Intergenic
1104794692 12:131509336-131509358 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1106473073 13:30075409-30075431 ATGCTGATGCAGCCGGCCCGGGG - Intergenic
1106977153 13:35233271-35233293 ATGCTGTTTCAGGTAGTCCTGGG + Intronic
1107833823 13:44397802-44397824 ATGCAGTTGGAGGAGGCGCAGGG + Intergenic
1108095112 13:46893404-46893426 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1108382687 13:49869234-49869256 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1110416265 13:75256541-75256563 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1110551934 13:76820404-76820426 GTGCTGTTGGAGGTGGGCCTAGG - Intergenic
1110872977 13:80474336-80474358 ATGTTGTTGCTGGTGGTACATGG - Intergenic
1112226159 13:97542518-97542540 ACGCTGTTGCAGCTGGTCCATGG + Intergenic
1112365999 13:98756000-98756022 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1113487836 13:110668034-110668056 ATGCTTCTGCAGCTGGTCCAGGG - Intronic
1113899083 13:113786135-113786157 ATGGTGATGATGGTGGCCCATGG - Intronic
1115402326 14:32976163-32976185 ATTCTGTTGCAGGTGACCCCTGG + Intronic
1116190619 14:41660768-41660790 ATTCTGATGCATGTGGCCCATGG + Intronic
1116949168 14:50863213-50863235 ATGCTGGTGCAGCTGATCCAAGG + Intronic
1117237150 14:53790218-53790240 ATGCTGATGCAGGTAGCTCAAGG + Intergenic
1118626998 14:67668829-67668851 ATGCTGATGCAGCTGGTTCATGG + Intronic
1119499838 14:75115717-75115739 ATGCTGATGCTGCTGGTCCATGG - Intronic
1119767824 14:77201550-77201572 ATGCTGATGCCGCTGGGCCAGGG - Intronic
1120004303 14:79339536-79339558 ATGCTAATGCAGGTGGTCCAGGG - Intronic
1120200362 14:81532346-81532368 ATTCTGATGCAGGAGGTCCATGG + Intronic
1120474082 14:84964907-84964929 ATTCTGATGCAAGTGGTCCATGG + Intergenic
1121556627 14:94842783-94842805 ATGCTGATGCTGCTCGCCCATGG + Intergenic
1202875936 14_KI270722v1_random:372-394 ATGCTGTTGCTGCTAGCACAGGG - Intergenic
1124269349 15:28266570-28266592 CTTCTGTTGCAGATGGACCATGG - Intronic
1125333016 15:38600696-38600718 ATTCTGATGCAGGTGGTCTATGG + Intergenic
1125774694 15:42201646-42201668 ATGCTGATGCTGGTGGTTCAAGG + Intronic
1126924063 15:53562492-53562514 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1127804964 15:62510666-62510688 ATGCTGTGGCAGGTGACTGAGGG + Intronic
1127904956 15:63369613-63369635 ATGCTAATGCTGCTGGCCCAGGG + Intronic
1128378223 15:67092428-67092450 ATGCTGACGCTGCTGGCCCAGGG - Intronic
1128941011 15:71787643-71787665 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1129032182 15:72627502-72627524 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129057587 15:72832218-72832240 ATGATCTTCCAGGTGGCCAAAGG + Intergenic
1129217715 15:74109737-74109759 ATGCTGATGCTGTTGGCCCAGGG + Intronic
1129406948 15:75326240-75326262 ATGCTGATGTTGCTGGCCCAGGG - Intergenic
1129470154 15:75749110-75749132 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129734876 15:77954032-77954054 ATGCTGATGCTGCTGGCTCAGGG + Intergenic
1129840715 15:78741959-78741981 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129876346 15:78978065-78978087 GGGCTGTTGCAGGTGGGGCAAGG + Intronic
1129994918 15:79996237-79996259 ATGCTGATGCTGGAGCCCCAGGG - Intergenic
1130109835 15:80954982-80955004 ATGCTGATGCCATTGGCCCATGG - Intronic
1130380481 15:83367932-83367954 ATGCTGATGCTGCTGGCCCCTGG + Intergenic
1131208253 15:90470475-90470497 ATGTTGATGCTGCTGGCCCAAGG + Intronic
1131670055 15:94610340-94610362 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1132250222 15:100330430-100330452 ATGCTGATGCTGCTGGCCCGGGG + Intronic
1133907528 16:10035665-10035687 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1133911513 16:10070309-10070331 ATGCTGATGCTGCTGGCCCATGG - Intronic
1133985391 16:10664446-10664468 ATGCTGATGCTGATGGTCCAAGG + Intronic
1134313326 16:13095964-13095986 ATGCTGTTGCTGCTGGTCCAAGG + Intronic
1134419799 16:14075607-14075629 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1134438335 16:14282115-14282137 ATGCTGCTGCAGCTGGTCCAGGG - Intergenic
1135046318 16:19158913-19158935 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1135916574 16:26610447-26610469 CTGATGTTGCTGGTGGCCCCAGG - Intergenic
1136023989 16:27458363-27458385 ATGCTGATGCAGATGTGCCAGGG + Intergenic
1137415711 16:48276902-48276924 ATGATGTTTTAGCTGGCCCAGGG + Intronic
1137450719 16:48571253-48571275 TGGTTGTTGCTGGTGGCCCACGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1138880062 16:61002259-61002281 ATGCTGTTGCTTCTGGTCCAGGG + Intergenic
1139229818 16:65272881-65272903 ATGCTGATTCAGCTGGTCCAAGG - Intergenic
1139982378 16:70870404-70870426 ATGGTTTTGTGGGTGGCCCAGGG + Intronic
1140584547 16:76274387-76274409 ATCCTGATGCAGCTTGCCCAAGG + Intergenic
1141109335 16:81259075-81259097 GTGATGTTGCAGGTGGGCCTAGG - Intronic
1142374154 16:89698148-89698170 CAGCTGGTGCAGGTGGCCCTGGG - Exonic
1143291153 17:5830170-5830192 AAGCTGCTCCAGGTGGTCCAGGG - Intronic
1143631606 17:8143323-8143345 CTGCTGTTGCAGGAGGCCCTGGG - Exonic
1143945999 17:10592612-10592634 GTGCTGATGCTGCTGGCCCATGG - Intergenic
1143949373 17:10620570-10620592 ATACTGATGCTGGTGGTCCAGGG - Intergenic
1144088587 17:11833067-11833089 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144099389 17:11930585-11930607 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1144146255 17:12401351-12401373 AGGCTGAGGCGGGTGGCCCAAGG + Intergenic
1144146664 17:12405474-12405496 ATGCTGATGCTGCTGGCCCGTGG - Intergenic
1144194243 17:12875213-12875235 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144420011 17:15087917-15087939 ATGCTGTTGTATCTGGTCCAGGG + Intergenic
1146311266 17:31770195-31770217 GTGCTGCTGCAGGGGGTCCAGGG - Intergenic
1146521574 17:33529405-33529427 ATGCTGATGCCGCTGGCCCAGGG - Intronic
1147997109 17:44366250-44366272 ATGCTGTTACTGTTGGCCCAGGG + Intergenic
1148473042 17:47907380-47907402 ATGGGGTTGCAGGTGCCCGATGG - Intronic
1148874587 17:50679418-50679440 ATGGTGATGCAACTGGCCCATGG - Intronic
1151429963 17:74055750-74055772 ATGCTGATGCGATTGGCCCATGG + Intergenic
1152913831 17:83022326-83022348 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913839 17:83022373-83022395 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913855 17:83022467-83022489 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913863 17:83022514-83022536 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913871 17:83022561-83022583 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913879 17:83022608-83022630 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913887 17:83022655-83022677 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913895 17:83022702-83022724 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913904 17:83022749-83022771 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913913 17:83022796-83022818 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913921 17:83022843-83022865 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913937 17:83022937-83022959 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913945 17:83022984-83023006 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913953 17:83023031-83023053 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913961 17:83023078-83023100 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913969 17:83023125-83023147 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152913985 17:83023219-83023241 ACGCTGGTGCAGGTGGGCCGGGG - Intronic
1152914009 17:83023360-83023382 ATGCTGGTGCAGGTGGGCCGGGG - Intronic
1153334768 18:3911929-3911951 ATGCTGCTGCTGTGGGCCCAGGG - Intronic
1153555595 18:6310081-6310103 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1153689131 18:7573918-7573940 ATGCTGATGCTGCTGGCTCAAGG - Intronic
1154477587 18:14778760-14778782 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1154478509 18:14792208-14792230 ATGCTATTGCTGGTGGTCCTAGG + Intronic
1154480251 18:14815429-14815451 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1154482151 18:14841363-14841385 ATGCTGTTGCTGGTTGTCCTTGG + Intronic
1156038196 18:32789522-32789544 TTGCAGTTGCAGCTGGCCAAGGG + Intergenic
1156367183 18:36440169-36440191 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1156526411 18:37771830-37771852 ATGTTGTGGCAGATGGCCCCTGG + Intergenic
1157190652 18:45578560-45578582 ATACTGTTGAAGGTGGCATAGGG - Intronic
1157226318 18:45868253-45868275 ATGCTGATGCTGCTGTCCCAGGG + Intronic
1157710435 18:49846357-49846379 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1157987680 18:52458235-52458257 ATGGTGGTGGAGGTGCCCCAGGG - Intronic
1159219267 18:65438646-65438668 ATGCTCTTACAGGAGGCACAAGG - Intergenic
1160351685 18:78187601-78187623 ATGCTGAGGCAGGTGGATCAAGG - Intergenic
1160472665 18:79151535-79151557 TTGCTGTTGCAGGTGTGCCTAGG + Intronic
1161171116 19:2812967-2812989 GTGCTGATGCAGGCGGCCCCCGG + Intronic
1161524021 19:4742507-4742529 AGGCTGTTGCACGTGGCCTTGGG + Intergenic
1162039929 19:7964453-7964475 CTGCCGTTGCTGGTGTCCCAGGG - Intronic
1163092149 19:15027736-15027758 CTGCTGTTGCTGGTTTCCCAGGG + Intergenic
1163450079 19:17371926-17371948 ATCCTTTTGCAGTTGGCCCTGGG + Intronic
1164947099 19:32305080-32305102 ATGCTTATGCAGCTGGTCCATGG - Intergenic
1165908795 19:39211010-39211032 ATGCTGATGCTGTTGGTCCAGGG - Intergenic
1165990528 19:39809656-39809678 AAGCTGTTGGAGGCAGCCCACGG - Intergenic
1166068485 19:40374167-40374189 ATGCTGTTGCCGCTGGATCAGGG + Intronic
1166168582 19:41010124-41010146 CTCATGTTGCAGGTGGGCCAGGG + Exonic
1202674729 1_KI270710v1_random:32438-32460 ATGCTGTTGCTGCTAGCACAGGG + Intergenic
925997926 2:9307051-9307073 CTGCTGGTGCAGCTGGCCCAGGG - Intronic
928125353 2:28611786-28611808 ATGCTGTTGTAGAGGGTCCAGGG + Intronic
928446978 2:31341246-31341268 ATGTTGTGGCAGGTGGCCCCAGG + Intronic
930804742 2:55479161-55479183 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
931700122 2:64902545-64902567 ATGCCGATGCTGCTGGCCCAGGG + Intergenic
932371232 2:71189893-71189915 CTGCTGTTGCAACTGTCCCATGG + Exonic
932416745 2:71578200-71578222 ATGCTGATGCTGCTGGTCCAGGG + Intronic
932712471 2:74077362-74077384 ATGCTGATGCTGCTGGCCCTGGG + Intronic
932753751 2:74390696-74390718 ATGCTAATGCTGCTGGCCCATGG - Intronic
933600284 2:84321937-84321959 ATGCTGATGCTGCTGGGCCATGG + Intergenic
933891845 2:86779027-86779049 ATGCTGATGCTGCTGGTCCATGG - Intergenic
934118422 2:88817055-88817077 ATGATGTCCCAGGTGGCACAGGG - Intergenic
934588393 2:95525993-95526015 AGGCTGATGCCGCTGGCCCAGGG + Intergenic
934733420 2:96673737-96673759 ATGCGGATGCTGCTGGCCCAGGG - Intergenic
935557493 2:104526258-104526280 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
936095247 2:109526248-109526270 CTGCTGTTGCCTGTGGCCCTGGG + Intergenic
937867180 2:126761275-126761297 AGGCTGTTGCAGGGGGCCTTGGG - Intergenic
938590325 2:132729615-132729637 ATGCTGATGATGCTGGCCCATGG + Intronic
938923920 2:136021488-136021510 ATGCTGTTGCTGCTGATCCACGG + Intergenic
939508828 2:143081718-143081740 TTGCTGTTGCTGTTGGTCCAGGG - Intergenic
939834115 2:147107083-147107105 ATGGTAGTACAGGTGGCCCATGG - Intergenic
939986346 2:148833161-148833183 CTGCTGGTGCTGCTGGCCCATGG + Intergenic
940702136 2:157058703-157058725 ATTCTGACGCAGGTGGCCCAAGG + Intergenic
940900770 2:159124436-159124458 ATGCTGTTGCTGTTGGTCCAGGG + Intronic
941200649 2:162504814-162504836 ATGCCATTCCATGTGGCCCAAGG - Intronic
941291037 2:163675418-163675440 ATGCTGTTGCTGCTGGTCCAGGG - Intronic
941531360 2:166675240-166675262 CTGCTGTTCAAGATGGCCCAGGG - Intergenic
941746761 2:169095196-169095218 ATGCTGATGCTGCTGGTCCAGGG - Intronic
941920535 2:170846456-170846478 ATGCCCTGGCAGATGGCCCATGG + Intronic
942232424 2:173872865-173872887 ATGTTGTTGCTGTGGGCCCAAGG - Intergenic
942282734 2:174383095-174383117 ATGCTTTTGAAGTTGACCCACGG - Intronic
943394636 2:187318732-187318754 ATGCTGATGCACCTGGACCAGGG - Intergenic
944483253 2:200178493-200178515 CTGCTGCTGCCTGTGGCCCATGG + Intergenic
944985475 2:205170664-205170686 ATGCAGTAGCAGATGGCCCGAGG - Intronic
945435825 2:209816631-209816653 ATGCTGATGCTGCTGGTCCAGGG + Intronic
945446254 2:209941738-209941760 ATGCTGATGCTGCTGGCCCAGGG - Intronic
945860294 2:215113530-215113552 ATGCTGATGCAGCTGGTCCATGG + Intronic
947861093 2:233357867-233357889 ATGCTGATGCTGCTGGTCCATGG + Intronic
948409794 2:237750259-237750281 AAGGAGCTGCAGGTGGCCCAGGG - Intronic
949063710 2:241976331-241976353 TGGCTGCTGCAGGTGGACCATGG - Intergenic
1168850203 20:971325-971347 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1168953690 20:1819672-1819694 GTGCCGGTGCAGGTGGCCCATGG + Intergenic
1169252448 20:4071066-4071088 AGGCTGCTGCAGTAGGCCCAGGG + Intronic
1169316314 20:4593415-4593437 AGGCTGCTGCATGTGGTCCAGGG - Intergenic
1169675354 20:8147132-8147154 ATGCTGATGCTGTTGGTCCAGGG - Intronic
1169748384 20:8965935-8965957 ATGCTGTTGCTGCTGGTCCAGGG - Intronic
1169847726 20:10013775-10013797 ATGCTGTTGCTGCTGGTCCAAGG - Intronic
1169981406 20:11388741-11388763 ATCCAGTTGGAGTTGGCCCATGG + Intergenic
1169998181 20:11582979-11583001 ATGCTGATGTTGGTAGCCCAAGG - Intergenic
1170009274 20:11703788-11703810 ATGCTGATGCAGCTGGTCCAGGG - Intergenic
1171377675 20:24704491-24704513 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1171425418 20:25045636-25045658 GTGCTGTGGCACGAGGCCCATGG + Intronic
1173300454 20:41797766-41797788 TTGCTGATGCCGCTGGCCCAGGG + Intergenic
1174418293 20:50382458-50382480 TTGCAGTTGCATGTGTCCCAGGG - Intergenic
1174540860 20:51288347-51288369 ATTCTGTGCTAGGTGGCCCAAGG - Intergenic
1174687917 20:52473218-52473240 AGGCTTTTCCTGGTGGCCCACGG - Intergenic
1174708668 20:52682844-52682866 AAGCAGTTGCAGGTGGGGCATGG + Intergenic
1175362637 20:58425692-58425714 CTGCTGCTGCTGCTGGCCCAGGG - Intronic
1175621742 20:60453289-60453311 AAGCTGATGCACGTGGCCCGTGG - Intergenic
1176637209 21:9257742-9257764 ATGCTGTTGCTGCTAGCACAGGG - Intergenic
1176798452 21:13395261-13395283 ATGCTGTTGCTGGTGGTCCTTGG - Intergenic
1176800293 21:13420860-13420882 ATGCTGATGCTGGTGGTCCTTGG - Intergenic
1179798943 21:43801770-43801792 ATGCTCATGCTGGCGGCCCAAGG - Intronic
1180094672 21:45550401-45550423 ACGGGGTGGCAGGTGGCCCATGG - Intergenic
1180204139 21:46246876-46246898 ATGCTGTTGCAGGTGGCCCATGG - Exonic
1181277617 22:21696471-21696493 CTGCTGATGCAGCTGGCCCAAGG - Intronic
1181344550 22:22209039-22209061 ATGCTGATGCATGCTGCCCATGG - Intergenic
1181395519 22:22618533-22618555 ATGCTGCTTCCTGTGGCCCAGGG - Intergenic
1181856787 22:25787408-25787430 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1181913165 22:26256682-26256704 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1182077532 22:27505171-27505193 ATGCTGTTGCTGATGGTCCAGGG - Intergenic
1183026577 22:35070001-35070023 ATTCTGATGTTGGTGGCCCAAGG + Intronic
1183093110 22:35536838-35536860 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1184375011 22:44106246-44106268 ATGCTGATGTAGGTGGTCCCAGG + Intronic
1184403637 22:44287754-44287776 ATGCTGGGGCAGGTGTCCCCGGG + Intronic
1184508564 22:44918614-44918636 CTGCTGTCCCAGGTGGCTCACGG - Intronic
949371295 3:3337410-3337432 ATGTTGATGCTGCTGGCCCAGGG + Intergenic
949607763 3:5673074-5673096 ATTCTGTGGCAGGTGGTCCATGG + Intergenic
949830002 3:8204117-8204139 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
949898987 3:8794153-8794175 ATGCCAGTGCAGCTGGCCCATGG - Intronic
949961712 3:9317773-9317795 ATGCTGATGCTGCTGGTCCAGGG + Intronic
950010096 3:9716879-9716901 ATGCTGATGCTGCTGGCTCATGG - Intronic
950019333 3:9776010-9776032 ATGCTGTTGCTGGCAGTCCAGGG + Intronic
950400006 3:12762715-12762737 ATGCTGTAGCAGCTGGTCCGGGG - Intronic
950858780 3:16129065-16129087 ATGCTGATGCAGTGGGTCCAGGG - Intergenic
951041152 3:17990006-17990028 TTCCTGTTGCAGGTGGTTCATGG + Intronic
951068044 3:18290537-18290559 ATGCTGTTGCTGCTGGTCCAGGG + Intronic
951412314 3:22379893-22379915 GTGCTTTTGCTGGTGGTCCAGGG + Intergenic
951689572 3:25381704-25381726 ATGCTGATGCTGCTGGTCCAAGG - Intronic
951766365 3:26204066-26204088 ATGCTGATGCTGTTGGACCAGGG + Intergenic
952329635 3:32352376-32352398 ATGCTGATGCTGCTGGCTCAGGG - Intronic
953143375 3:40249905-40249927 ATGCTGAGCCAGGTGGCCCCGGG + Intronic
953199999 3:40770064-40770086 ATGCTGATGCTGCTGGCCCTGGG - Intergenic
953417404 3:42730869-42730891 GTGCTGTGGCAGGTGGCTCTTGG + Intronic
954713938 3:52517899-52517921 GTGCTTTTGCAGGTGGCATATGG - Exonic
955531157 3:59874511-59874533 ATGCTGATGCTGCTGGTCCAGGG + Intronic
955837061 3:63067662-63067684 ATGCTGATGTTGCTGGCCCATGG - Intergenic
956826410 3:73001319-73001341 AGGCTGAGGCAGGTGGCCCAGGG + Intronic
956841288 3:73142455-73142477 ATTCTGGTGCAGGTGCGCCACGG + Intergenic
957840042 3:85655871-85655893 ATGCTGTTGCAGCTGGTCCAAGG + Intronic
958428622 3:94009995-94010017 ATGCTGATGCAGGTGGTCCATGG - Intronic
958882737 3:99691471-99691493 ATGCTGATGCTGCTGGTCCATGG - Intronic
960171095 3:114461701-114461723 ATGCTGATGCTGCTGGCCCAAGG - Intronic
960639412 3:119811925-119811947 ATGCTGATGCTGCTGACCCAGGG - Intronic
960998875 3:123358967-123358989 AGCCTGTTGCAGTGGGCCCATGG - Intronic
962364067 3:134765778-134765800 ATGCTGATGCTGCTGGCCAAAGG - Intronic
962732549 3:138296960-138296982 ATGCTGTTTCAGGAAGCACAAGG - Intronic
962942676 3:140140139-140140161 ATGCTGATGCTGATGGTCCAGGG + Intronic
964503263 3:157371491-157371513 ATGCTGATGCCGCTGGTCCAGGG - Intronic
965296942 3:166959035-166959057 ATTTTGTTGTAGGTGGCCTATGG - Intergenic
965507466 3:169532272-169532294 ATGCTGATGCTGCTGGCCCAGGG + Intronic
965641006 3:170829018-170829040 ATGCTGATGCTGCTGGTCCAGGG - Intronic
966748342 3:183299288-183299310 ATTCTGGTGCAGGTGGTGCAGGG - Intronic
967113196 3:186313571-186313593 ATGCTGATGCTGCTGGTCCAGGG - Intronic
967319567 3:188182234-188182256 ATACTGATGCTGCTGGCCCAAGG - Intronic
967874640 3:194259272-194259294 ATGCTGATGCTGCTGGCCCATGG + Intergenic
968073204 3:195800965-195800987 ATTCTGATGCAGGTGGTCCGTGG + Intronic
968121961 3:196132085-196132107 ATGCTGAGGCAGGTGGGCCCTGG + Intergenic
1202749685 3_GL000221v1_random:147277-147299 ATGCTGTTGCTGCTAGCACAGGG + Intergenic
969954726 4:10877168-10877190 ATGCTGATGCTGCTGGCCCAAGG - Intergenic
970559378 4:17267951-17267973 ATCCTGTTGCATGATGCCCAGGG - Intergenic
971257757 4:25030237-25030259 AGTCTGATGCAGGTGGCCCGTGG + Intronic
971725536 4:30307193-30307215 ATGCTGATGCAGTTGGCACTGGG - Intergenic
975195858 4:71522295-71522317 TTTCTGTGGCAGGTGGCTCAGGG + Intronic
975441213 4:74413038-74413060 TTACTGATGCAAGTGGCCCAAGG - Intergenic
975837826 4:78442858-78442880 ATGCCATTGCTGCTGGCCCAAGG + Intronic
975995579 4:80309952-80309974 ATGCTGTTGCTGCTGGTCCTGGG - Intronic
976164713 4:82242014-82242036 ATGCTGATGCTGATGGCCCAAGG - Intergenic
976688094 4:87838143-87838165 ATGATGCTGCTGATGGCCCAGGG - Intronic
977152409 4:93529368-93529390 GTGCTGATGCAGCTGGACCAGGG - Intronic
978203263 4:106048149-106048171 ATTCTAAAGCAGGTGGCCCATGG + Intronic
978985269 4:115004431-115004453 CTGCTTTTGCAGCTGGCTCATGG + Intronic
980878647 4:138687323-138687345 GTGTTGATGCACGTGGCCCAGGG - Intergenic
981015520 4:139969983-139970005 ATGCTGTTGAATATTGCCCAAGG - Intronic
983128256 4:163981559-163981581 AGGCTGCTGCAAGTGGCTCAGGG + Intronic
983198744 4:164837929-164837951 ATGCTGATGCAGTTGGTCTAGGG - Intergenic
983905507 4:173177229-173177251 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1202752102 4_GL000008v2_random:16169-16191 ATGCTGTTGCTGCTAGCACAGGG - Intergenic
985649407 5:1100365-1100387 AGGCGGCTGCGGGTGGCCCAGGG - Intronic
986327140 5:6684802-6684824 AGGCTGTTGCAGGTGGTCCTGGG + Intergenic
986775974 5:11014025-11014047 GTGCTCAGGCAGGTGGCCCAAGG - Intronic
991318377 5:65338694-65338716 TGTCTGCTGCAGGTGGCCCATGG - Intronic
992714627 5:79497863-79497885 ATGCTGATGCTGCTGGTCCAGGG - Intronic
992890037 5:81195636-81195658 ATGCTGATGCTGCTGGCCCGGGG - Intronic
992948455 5:81832842-81832864 ATGCTGATGCAGCGGGTCCAGGG + Intergenic
994231025 5:97310769-97310791 ATGCGGTAGTAGGTGCCCCAGGG + Intergenic
994351762 5:98753830-98753852 ATGCTGTTGCTGTTGGACCAGGG + Intergenic
995653889 5:114402776-114402798 AGGCTGCTGCAGGTGGCCTATGG - Intronic
996465639 5:123799434-123799456 ATGCTGATACTGCTGGCCCAGGG + Intergenic
996577247 5:124988975-124988997 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
997073016 5:130640467-130640489 ATGCGGTAGTAGGTGCCCCAGGG - Intergenic
997747938 5:136316009-136316031 ACTCTGATGCAGGTGGCCCATGG - Intronic
998416580 5:141950559-141950581 AAGATTTTGCAGGTTGCCCAAGG + Intronic
998531449 5:142888998-142889020 ATTCCATTGCAGGGGGCCCAAGG + Intronic
998849520 5:146339879-146339901 GGCCTGGTGCAGGTGGCCCATGG - Exonic
998884987 5:146684783-146684805 ATTCTGGTGCAGGTGGTCCCTGG - Intronic
999004532 5:147961337-147961359 ATGATAATGCAGGTTGCCCAAGG - Intergenic
999513714 5:152279450-152279472 TTGCTGATGCATGTGCCCCATGG + Intergenic
999626678 5:153528582-153528604 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1000013420 5:157255588-157255610 ATGCTATTGCTGCTGGTCCAGGG - Intergenic
1000670035 5:164049967-164049989 ATGCTGTTGCTGGAGGTCCAGGG + Intergenic
1000789319 5:165585978-165586000 ACTCTGTTGCAGGTGTTCCAGGG - Intergenic
1000931760 5:167261054-167261076 ATGCTGATGCAGCTGGTCCTGGG - Intergenic
1001005437 5:168045667-168045689 GTGCAGCTGCAGCTGGCCCAAGG + Intronic
1001279603 5:170377349-170377371 ATCCTGATGCTGCTGGCCCAGGG + Exonic
1001528763 5:172447778-172447800 GTGCTGCTGCAGGTGTCTCAGGG - Intronic
1001780475 5:174364625-174364647 ATGCTGATGCTGCTGGCCCAGGG - Intergenic
1002102693 5:176865182-176865204 CTGCTGTGGCAGGTCCCCCAGGG + Intronic
1002699260 5:181111023-181111045 ATGCTGCTCAAGGTGGGCCAAGG - Intergenic
1003120590 6:3316123-3316145 ATGCTGATGCTGCTGGCCCAGGG + Intronic
1003279046 6:4676171-4676193 ATTCTGATGGAGGTGGCACAGGG + Intergenic
1003328538 6:5110880-5110902 ATGCTGATGCTGCTGGTCCACGG + Intronic
1003333646 6:5150606-5150628 ATGCTTTTCAAGGTGGCCAAAGG - Intronic
1003444708 6:6173965-6173987 ATGCTGATGCAGCTGGCTCATGG + Intronic
1003633172 6:7807238-7807260 ATGCTGATGCTGCTGGTCCATGG - Intronic
1004319729 6:14622874-14622896 ATGCAGTTGCTGCTGGACCAGGG - Intergenic
1004532074 6:16462962-16462984 GTGCTGCTGCAGGGGGTCCAGGG - Intronic
1004609936 6:17230368-17230390 ATGCTGTTTAAGGTGGACTATGG + Intergenic
1011714321 6:90088625-90088647 AGGCTGATGCAGCTGGTCCAGGG - Intronic
1011739996 6:90350000-90350022 ATGCTGCTGCTGCTGGTCCAGGG + Intergenic
1013076257 6:106774408-106774430 GTGCTGTTGCTGTTGGCTCAAGG + Intergenic
1013309919 6:108884263-108884285 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1013765430 6:113568802-113568824 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1015864061 6:137709972-137709994 ATCCTGTTACAGGTTGCCCCAGG - Intergenic
1016356377 6:143223188-143223210 ATGCTGATGCTGCTGGCACAGGG - Intronic
1020976559 7:15013792-15013814 ATGCTGTTGCACGAGGAACAAGG - Intergenic
1021571568 7:22070843-22070865 ATTCTGATGTAGATGGCCCATGG + Intergenic
1021622143 7:22559570-22559592 ATGCTGTTGCTGCTGCCCCAGGG + Intronic
1022128499 7:27380468-27380490 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1022798142 7:33749197-33749219 ACTCTGATGTAGGTGGCCCATGG - Intergenic
1022799402 7:33761400-33761422 ATGCTGATGCTGCTGGACCAGGG + Intergenic
1023044841 7:36201962-36201984 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1023125646 7:36951636-36951658 ATGCTGTTGGTGTTGGTCCAAGG + Intronic
1023185682 7:37530583-37530605 ATGCTGATGCTGCAGGCCCAAGG + Intergenic
1023558065 7:41443889-41443911 ATGCTGTTGCAGGAGTGCCCAGG - Intergenic
1023760655 7:43462438-43462460 ATCCTGATGCTGCTGGCCCAGGG - Intronic
1023951784 7:44852013-44852035 ATGCTGATGCTGGTGGTCTAAGG - Intergenic
1024305946 7:47929683-47929705 ATGCTGATGCTGCTGGCCCTGGG - Intronic
1025621082 7:63171557-63171579 ATTCTGATGCAGGTGGCCAGTGG - Intergenic
1025790827 7:64685471-64685493 GTGCTGCTGCAGGAGGTCCAGGG - Intronic
1026059253 7:67011457-67011479 ATGCTGATGCTGCTGGCTCAGGG - Intronic
1026421095 7:70238264-70238286 ATACTGTTGGGGGTGGCCCCTGG - Intronic
1026575664 7:71569611-71569633 ATGCTGATGCAGTTGGTCCCTGG + Intronic
1026718842 7:72813590-72813612 ATGCTGATGCTGCTGGCTCAGGG + Intronic
1027791747 7:82643978-82644000 ATGCGGTGGTAGGTGCCCCAGGG - Intergenic
1028655933 7:93207082-93207104 ATCTTGATGCAGATGGCCCAAGG + Intronic
1028838493 7:95400335-95400357 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1029269082 7:99365753-99365775 ATCCTGTTTCAGGTGGGGCAGGG + Intronic
1029695381 7:102209678-102209700 ATGGAGTTGCAGGTGGTCCTTGG + Intronic
1032798053 7:135293437-135293459 ATGCTAAGGCAGGTGGTCCAGGG + Intergenic
1032890108 7:136185284-136185306 ATGCTGTTGCTGGAAGCCTATGG + Intergenic
1033158538 7:138976935-138976957 ATGTTGATGCAGGAGGCCTAGGG + Intronic
1033275058 7:139965562-139965584 ATTCTGATGCAGGTGGTCCCTGG + Intronic
1034714505 7:153228727-153228749 ATGCTGTTCCACGTGGCTGAGGG + Intergenic
1035749580 8:1986934-1986956 AGGCTGATGCAGGAGGACCAGGG + Intronic
1036694588 8:10966261-10966283 ATGCTGATGCCGCTGGTCCATGG + Intronic
1039072926 8:33662488-33662510 ATGCTGATGTTGCTGGCCCAGGG + Intergenic
1039335148 8:36581030-36581052 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1039593759 8:38771938-38771960 ATGCTGATGTTGCTGGCCCAGGG + Intronic
1039596511 8:38794855-38794877 ATGCTGTTGAAGGAGCCACATGG - Intronic
1040101881 8:43513038-43513060 TGGCTGCTGCTGGTGGCCCACGG - Intergenic
1041002655 8:53467300-53467322 GTGCTGTTGCAGGGGGTCCGGGG - Intergenic
1042404547 8:68388859-68388881 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1042804895 8:72760496-72760518 ATGCTGTTGCTGCTGGTCCAGGG - Intronic
1042819684 8:72916468-72916490 ATGCTGCTGCAGGGCCCCCATGG - Intronic
1044369497 8:91391756-91391778 ATTCTGATGCAGGGGGCTCAAGG + Intronic
1044608030 8:94064051-94064073 ATGCTGTTGCTCCTGGTCCAGGG - Intergenic
1045250953 8:100483193-100483215 GTTCTGATGCAGGTGGTCCAAGG + Intergenic
1045697592 8:104827727-104827749 ATCCTGATGCTGGTGGGCCAGGG - Intronic
1046019167 8:108643301-108643323 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1047403225 8:124563196-124563218 ATGCTTTTCCAGGTGACCCAGGG + Intronic
1047692657 8:127372116-127372138 ATGTTGATGCTGCTGGCCCAGGG + Intergenic
1049710173 8:144059851-144059873 ATCCTGGAGCAGGTGGGCCAGGG - Exonic
1050728104 9:8675635-8675657 ATGATGTTGAAGGAGGCACAGGG - Intronic
1051125578 9:13800864-13800886 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1051677337 9:19571551-19571573 ATGCTGATGCTGTTGGTCCAAGG - Intronic
1052720056 9:32163545-32163567 ATTCTGTTGTAAATGGCCCAGGG - Intergenic
1053469916 9:38339030-38339052 ATGCTATGGCTGATGGCCCAGGG + Intergenic
1053575705 9:39356253-39356275 TTTCTGGTGCAGGTGGCTCAGGG + Intronic
1054097275 9:60914958-60914980 TTTCTGGTGCAGGTGGCTCAGGG + Intergenic
1054118681 9:61190587-61190609 TTTCTGGTGCAGGTGGCTCAGGG + Intronic
1054589076 9:66991977-66991999 TTTCTGGTGCAGGTGGCTCAGGG - Intergenic
1055296317 9:74837350-74837372 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1055715531 9:79113588-79113610 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1057396154 9:94682357-94682379 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1057902007 9:98956748-98956770 ATGCTGATGCTGCTGGTCCATGG - Intronic
1057929641 9:99182536-99182558 ATTCTAGTGTAGGTGGCCCATGG - Intergenic
1058233555 9:102461499-102461521 GTGCTGTTGCTGGTGGGGCAGGG + Intergenic
1058623658 9:106911572-106911594 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1058981674 9:110176180-110176202 ATGCTGCTGCTGCTGGTCCAGGG + Intergenic
1059529285 9:115021000-115021022 ATGCTGTTGCCGTTGGCCCCAGG + Exonic
1059799670 9:117737581-117737603 CTGCTGTTCCAGGCAGCCCAGGG - Intergenic
1059933432 9:119283938-119283960 ATGCTGCTGGTGGTGGTCCAAGG - Intronic
1060149276 9:121277405-121277427 ATGCTGATGTAGCTGGTCCAGGG + Intronic
1061647637 9:132018669-132018691 ATGCTGTAGCAGGGACCCCAGGG - Intronic
1061670101 9:132183765-132183787 AGGCTGGTCCAGGTGGTCCAGGG - Intronic
1061682371 9:132249343-132249365 ATGATGGAGCAGGTGGCCCTTGG + Intergenic
1203718328 Un_KI270742v1:177365-177387 ATGCTGTTGCTGCTAGCACAGGG + Intergenic
1203532888 Un_KI270743v1:857-879 ATGCTGTTGCTGCTAGCACAGGG - Intergenic
1186610004 X:11129784-11129806 ATGCTGATGCTGCTGGGCCAGGG + Intergenic
1186763523 X:12747684-12747706 AGGCTGATGCTGCTGGCCCAGGG + Intergenic
1186996404 X:15128225-15128247 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1187305355 X:18090429-18090451 ATGCTGTTGCTGCTGGTTCAGGG + Intergenic
1187420685 X:19131074-19131096 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1187424886 X:19168170-19168192 ATCCTGATATAGGTGGCCCAAGG + Intergenic
1187566501 X:20454718-20454740 ATGCTGTTGTTGCTGGACCATGG + Intergenic
1187675826 X:21715648-21715670 ATGCTGTTGCTATTGGTCCATGG + Intronic
1188254428 X:27943017-27943039 ATGCTGCTGCTGGTGGTCTAGGG - Intergenic
1188350678 X:29127376-29127398 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1188538722 X:31225753-31225775 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1188768729 X:34127642-34127664 ATGCTGCTGCATGAAGCCCAAGG + Intergenic
1188835181 X:34946666-34946688 ATGCTGTTGCATGAAGCCCAAGG - Intergenic
1189007825 X:37013425-37013447 ATGCTGCTGCATGAAGCCCAAGG - Intergenic
1189040647 X:37539106-37539128 ATGCTGCTGCATGAAGCCCAAGG + Intronic
1189124036 X:38426443-38426465 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1189166562 X:38866675-38866697 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1189617429 X:42798279-42798301 TTGCTGTTGCTGGTGGTCCCAGG + Intergenic
1189862892 X:45291592-45291614 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1189871109 X:45383792-45383814 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1190021952 X:46886624-46886646 ATACTGATGCTGCTGGCCCATGG - Intergenic
1190129436 X:47733455-47733477 GTGCTGTTGGTGGTGGTCCAGGG - Intergenic
1190455766 X:50626517-50626539 ATGCTGATGCAGCTGGTCCTGGG - Intronic
1190827605 X:54031957-54031979 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1191790738 X:64969597-64969619 ATGCTGCTGCTGGTGGTGCAGGG - Intronic
1194004456 X:88473138-88473160 ATGCTGATGCCTGTGGCCTATGG - Intergenic
1194403621 X:93467836-93467858 GGGCTGTGGCAGCTGGCCCAGGG - Intergenic
1194644236 X:96439120-96439142 ATGCTGATGCCGGTGGCCTTGGG + Intergenic
1194997730 X:100610258-100610280 ATTCTGGTGCAAGTGGCCCAAGG + Intergenic
1195865848 X:109432043-109432065 ATGCTGATGCAGCTGGTCCAGGG - Intronic
1195981240 X:110580757-110580779 ATGCTGGTGCTGCTGGTCCATGG + Intergenic
1196595790 X:117544069-117544091 ATGCTGTAGCAGGTGCACCAAGG - Intergenic
1197306196 X:124844881-124844903 ATTCTGATGTAGGTGGTCCATGG - Intronic
1197311642 X:124912520-124912542 ATGGTGTTGCAGGTGGGCTCTGG - Intronic
1197514059 X:127402374-127402396 ATGGGGTAGCAGGTGCCCCAGGG - Intergenic
1197981636 X:132223535-132223557 ACACTGTTGCTGCTGGCCCAGGG + Intergenic
1198312946 X:135438076-135438098 AAGCTGTTGTAGCTGGCCCTCGG - Intergenic
1198567766 X:137922380-137922402 ATTCTGATGCAGATAGCCCATGG + Intergenic
1201172479 Y:11282215-11282237 ATGCTGTTGCTGCTAGCACAGGG + Intergenic
1201515486 Y:14815353-14815375 ATGCTGCTGCAAGGGGTCCAGGG + Intronic