ID: 1180204155

View in Genome Browser
Species Human (GRCh38)
Location 21:46247008-46247030
Sequence CAGGCCTCCAAGGGCACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 1, 2: 4, 3: 26, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180204149_1180204155 17 Left 1180204149 21:46246968-46246990 CCAAAGCTCTCCGTGCACTAAAT 0: 1
1: 0
2: 0
3: 2
4: 64
Right 1180204155 21:46247008-46247030 CAGGCCTCCAAGGGCACAGCTGG 0: 1
1: 1
2: 4
3: 26
4: 283
1180204150_1180204155 7 Left 1180204150 21:46246978-46247000 CCGTGCACTAAATACTGACTGTA 0: 1
1: 0
2: 1
3: 13
4: 134
Right 1180204155 21:46247008-46247030 CAGGCCTCCAAGGGCACAGCTGG 0: 1
1: 1
2: 4
3: 26
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180204155 Original CRISPR CAGGCCTCCAAGGGCACAGC TGG Intronic
900206076 1:1432421-1432443 CAGGACTGCAGGGGCAGAGCAGG - Intergenic
900864833 1:5260787-5260809 CAGGCCCCCAAGGAGACAGGGGG - Intergenic
900933717 1:5752546-5752568 CAGGCCTGCAAGGTGACAGCAGG - Intergenic
901072414 1:6528206-6528228 CAGGGCTCAAAGTGCCCAGCGGG - Intronic
901127976 1:6942755-6942777 CAGGCCTCTCAGGGCAGACCTGG - Intronic
901238040 1:7678091-7678113 CAGGCCTGGAGGGGCACAGCGGG - Intronic
902330609 1:15729472-15729494 CAGGCGTTCAAGGGCACGCCTGG - Intronic
902796358 1:18803220-18803242 CAGGGCGCCCAGGGCACAGAAGG + Intergenic
903232071 1:21927923-21927945 CAGGGTTCCCAGGGCACAGCCGG - Intronic
903258630 1:22119272-22119294 CATGACTGCAAAGGCACAGCCGG + Exonic
903362067 1:22783100-22783122 CAGGACTCCTAGGGCACACTTGG + Intronic
903999740 1:27332162-27332184 CAGGCCTTCTGGGGCACAGGAGG + Intronic
904336360 1:29800731-29800753 CAGACCTTCCAGGCCACAGCTGG - Intergenic
904859705 1:33526610-33526632 CATTCGTCCAAGGACACAGCTGG + Intronic
904923502 1:34027867-34027889 CAGCCCTACATGGGCAGAGCAGG + Intronic
906049492 1:42858604-42858626 CAGGCCTCCAAGAAGACACCAGG + Intergenic
907746870 1:57222451-57222473 CAGGACTCCAAGAGAACAGGGGG + Intronic
915250288 1:154583292-154583314 CATGACTCCAAGAGCAGAGCAGG - Exonic
915364703 1:155308598-155308620 CAGGCAGCCAAAGCCACAGCGGG + Intergenic
915419217 1:155766234-155766256 CTGGCCTCAGGGGGCACAGCAGG + Exonic
916121715 1:161534085-161534107 GTGGCCTCCACTGGCACAGCTGG - Intergenic
916131308 1:161614031-161614053 GTGGCCTCCACTGGCACAGCTGG - Intronic
916594777 1:166233716-166233738 CAAGCCAACAAGGGCAGAGCTGG - Intergenic
917727238 1:177839523-177839545 CAGTTCTACAAAGGCACAGCAGG - Intergenic
919839341 1:201597797-201597819 CAGGACATCACGGGCACAGCAGG - Intergenic
920114255 1:203608844-203608866 CTGGCCTCCCAGGGAACGGCTGG - Intergenic
920377683 1:205518028-205518050 CAGGTCAACAAGGGAACAGCAGG - Intronic
922880330 1:228975670-228975692 CAGGCCTCCAAGAGCACAGCGGG - Intergenic
923386398 1:233469534-233469556 CATAGCTCCAAGGGCACAGTAGG + Intergenic
923816705 1:237387914-237387936 CAGGACTCAGAGGGAACAGCAGG + Intronic
924261638 1:242237627-242237649 CAGGGCTGCAAGGGCACTGAGGG - Intronic
924359197 1:243218309-243218331 CAGGCTTGCAATGGCACAGGAGG + Intronic
1063567173 10:7180848-7180870 CAGGCTTCCACTGTCACAGCCGG + Intronic
1065117315 10:22495392-22495414 CTGACCTCCAAGGGCACAGTGGG - Intergenic
1065140895 10:22717065-22717087 CAGTCTGCCAAGGGCACAGAAGG - Intergenic
1065972277 10:30815150-30815172 CAGTCCTGCAAGTGCACAGTGGG + Intergenic
1067078439 10:43201025-43201047 CAGGCCTTCAAGGACAAAGTGGG + Intronic
1067428558 10:46227233-46227255 CAGGCCCCCAGGGGCACTGCAGG - Intergenic
1067467702 10:46513394-46513416 CAGCCCTCCATGTGGACAGCCGG + Intergenic
1067619484 10:47871211-47871233 CAGCCCTCCATGTGGACAGCCGG - Intergenic
1067804407 10:49383028-49383050 CACACCTCCAAGGGCAAGGCAGG + Intronic
1068411732 10:56664118-56664140 CAGGCATGCTAGGGCATAGCTGG - Intergenic
1069581879 10:69572235-69572257 CAGGCCTCCACGGGGGCGGCAGG - Exonic
1069642832 10:69967115-69967137 CGTGTCTCCAAGGGCACAGGGGG - Intergenic
1071532616 10:86401143-86401165 CGGGCCTCCGAGGCCACCGCTGG + Intergenic
1076763649 10:132618699-132618721 GAGGCCTCCAAGGGCTGAGCAGG - Intronic
1076817568 10:132922399-132922421 CGGGGCTCTGAGGGCACAGCAGG - Intronic
1076884315 10:133254682-133254704 CTGCCCTCCAAGGCCACGGCGGG + Intergenic
1077367042 11:2165479-2165501 CAGGCCTCCGAAGGCCCGGCGGG - Intronic
1077556895 11:3230292-3230314 CAGCCCTCCCAGGACACAGGAGG - Intronic
1077610035 11:3638441-3638463 CAGCCCAGCAAGGCCACAGCGGG + Intergenic
1077658006 11:4040840-4040862 CAGGTCTCCCAGGGCCCAACAGG - Intronic
1078849115 11:15148041-15148063 AAGGCCTCCAGGAGCACAGCAGG + Intronic
1083164049 11:60872816-60872838 GGGGCCTCGAACGGCACAGCAGG + Intronic
1083276950 11:61602255-61602277 CAGGGCTCAAAGGGCTCATCAGG - Intergenic
1083311028 11:61783833-61783855 CAGGCCTGCAGGGGCAAAACTGG - Exonic
1083813751 11:65120230-65120252 CTGGACTCTAAGGCCACAGCTGG + Intergenic
1084086600 11:66857839-66857861 CAGGCCTCGGTGGGCACAGAGGG - Exonic
1086461933 11:87014623-87014645 CAGGCATCCAAGGGCCCAAGGGG + Intergenic
1088194666 11:107261429-107261451 GAAACCTCCAAGGGCACAGCTGG + Intergenic
1089443579 11:118534415-118534437 GAGGCCTCCAAGTGCCCAGGAGG + Intronic
1089591792 11:119546541-119546563 CAAGCCTGCAAGGGCAGAGGGGG - Intergenic
1089600902 11:119614288-119614310 CAGCCATGCAAGGGCACAGATGG - Intergenic
1089995451 11:122902672-122902694 CAGGCCTCTTACGGCAGAGCAGG + Intronic
1090950159 11:131465881-131465903 CTGTCCTCCAAAGCCACAGCAGG + Intronic
1091778529 12:3199926-3199948 CAGGCCCCCAAGTGCATAGGGGG + Intronic
1092114084 12:5986110-5986132 CAGGCCTCTAAAGTCACTGCGGG - Intronic
1092198930 12:6568079-6568101 CGGGCCTCCAGGGGGATAGCGGG - Intronic
1092596477 12:10010869-10010891 CACTCCCCCAAGGACACAGCTGG - Intronic
1092700893 12:11229572-11229594 AAGGCCTCTCAGGGAACAGCAGG + Intergenic
1093400635 12:18742483-18742505 CATGCCTCCTAAGGGACAGCGGG - Intergenic
1094572816 12:31656475-31656497 CAGACCTTCAATGGTACAGCCGG - Intronic
1095371563 12:41473661-41473683 CAGGTCACCAGGGCCACAGCTGG - Intronic
1096220798 12:49827450-49827472 CACGGCCCCAAGGGCACAGAGGG - Intronic
1096670080 12:53193345-53193367 TAGGCGGCCAGGGGCACAGCTGG + Exonic
1099297645 12:80849566-80849588 CAGACAGCCAAGAGCACAGCAGG - Intronic
1099298871 12:80866835-80866857 CAAGCCTCCAAAGACACAGCTGG - Intronic
1101898660 12:108774768-108774790 CAGGCCTCCAACTGCCCAACGGG - Intergenic
1102248153 12:111368254-111368276 AAGATCTCCAGGGGCACAGCTGG + Intronic
1102587324 12:113932535-113932557 CAGGCGTCCGAGTCCACAGCTGG + Intronic
1114704085 14:24707997-24708019 CAGGCCTCCATGGGCACCCTAGG - Intergenic
1118838433 14:69493307-69493329 CAGGCATCACAGAGCACAGCAGG + Intronic
1119149725 14:72347438-72347460 CAGGCCTAAAAGGGCAGAGGAGG - Intronic
1121338859 14:93093254-93093276 AGGGCCTCCAAGGGCAGAGATGG + Intronic
1121662755 14:95647629-95647651 CAGGCCCACATGGGGACAGCAGG + Intergenic
1121835927 14:97092319-97092341 CAAGCTTCCATGGGCAGAGCTGG + Intergenic
1122365918 14:101194795-101194817 CAGGCCTCCCAGCCCACCGCCGG + Intergenic
1122389056 14:101367925-101367947 ACTGCCTCCATGGGCACAGCAGG + Intergenic
1123074579 14:105661594-105661616 GAGCCCTCCCACGGCACAGCAGG + Intergenic
1202906453 14_GL000194v1_random:76352-76374 CAGGGCTCCTATGGCACTGCAGG + Intergenic
1124463950 15:29919611-29919633 CAGGTCTCCAAGGTCACCTCTGG - Intronic
1125194358 15:37029831-37029853 AAGGCTTCCAAGTTCACAGCTGG + Intronic
1125749950 15:42021285-42021307 CAGGCCTTCAAGGGCACAGTGGG + Intronic
1125769137 15:42153519-42153541 CAGGCCTCCAAGGCCAGTGCAGG + Intronic
1126143377 15:45455235-45455257 GAGCCCACCCAGGGCACAGCTGG - Intergenic
1126480297 15:49111177-49111199 CAGGCCACCAATGCCACTGCTGG + Intronic
1127134026 15:55900198-55900220 CAGGACTCCAAGGTGACAACAGG + Intronic
1128725950 15:69988771-69988793 CTCGCCCCCCAGGGCACAGCAGG + Intergenic
1129974868 15:79813509-79813531 GAAGCCACCAAGGGCATAGCTGG + Intergenic
1130986319 15:88847167-88847189 CAAGGCTCCATGGGCACAGAGGG - Intronic
1132319354 15:100914167-100914189 CTGGCCTCAGAGTGCACAGCTGG - Intronic
1132669492 16:1096796-1096818 TAGGCCTCCCAGGCCTCAGCGGG + Intergenic
1132722240 16:1322161-1322183 ACGGACTCCTAGGGCACAGCAGG - Intronic
1133344346 16:5060072-5060094 CTGGCCTCCCATGCCACAGCAGG - Intronic
1134456547 16:14399536-14399558 CAGGACACCAAGGGCAGGGCAGG - Intergenic
1134750405 16:16620425-16620447 CAGGCCTCAAAGTGTAGAGCAGG + Intergenic
1134995051 16:18733167-18733189 CAGGCCTCAAAGTGTAGAGCAGG - Intergenic
1136428992 16:30186261-30186283 GAGGCTTCCATGGGCACAACTGG - Intronic
1136500699 16:30668605-30668627 CAGGCCTCCAAAGGCCCCGTTGG - Exonic
1137562062 16:49509251-49509273 TAGGCGTCCCAGGGGACAGCAGG - Intronic
1138092689 16:54189234-54189256 CAGGTAGCCAAGGGCAGAGCTGG + Intergenic
1138310481 16:56019393-56019415 GAGGCCTCCAGGGGAACATCTGG - Intergenic
1138514004 16:57526005-57526027 CAGGCCGCCAGGAGCGCAGCCGG - Exonic
1138552296 16:57754457-57754479 CAGGCCCACAAGGCCTCAGCTGG + Intronic
1138597848 16:58038620-58038642 CTGGCCTCACTGGGCACAGCTGG + Intronic
1139655396 16:68384184-68384206 GAGGCCTGGAAGGGCACAGTGGG - Intronic
1139673093 16:68505032-68505054 CTGCCCTGCAAGGGCACACCTGG - Intergenic
1139826712 16:69762630-69762652 CCGGCCGCCAAGGGTGCAGCTGG + Intronic
1140224860 16:73068940-73068962 CTGGCCTCCATGCGCACTGCGGG + Intergenic
1140268959 16:73445790-73445812 CAGGTGTCCAAATGCACAGCAGG + Intergenic
1140326078 16:74005049-74005071 CAGGCTTCCAGGGGCACATGTGG + Intergenic
1141156236 16:81599160-81599182 CACAACACCAAGGGCACAGCTGG + Intronic
1141699885 16:85637569-85637591 GAGCCCGCCAGGGGCACAGCAGG - Intronic
1142065938 16:88062821-88062843 CAGGCCTTCAGGGGTAGAGCAGG - Intronic
1143389090 17:6549569-6549591 CAGGCCTCCACAGGCACACGTGG + Intronic
1143393296 17:6573107-6573129 CAGCACTGCATGGGCACAGCCGG + Intergenic
1144020719 17:11239025-11239047 TAGGCCTGCAAGGGGACAGATGG - Intergenic
1144639986 17:16931756-16931778 CAGGTCTCCAAGGGCTCAGGGGG - Intronic
1145265912 17:21379525-21379547 CAGGGCTCCAAGGGCAGGCCCGG - Intronic
1145966138 17:28919099-28919121 CAGTCCTCAATGGGCATAGCTGG - Intronic
1146018176 17:29250060-29250082 CAGGCATCCCAGGCTACAGCTGG + Intronic
1147057289 17:37844364-37844386 CAGGCCTGCAGGGGCACAGTTGG + Intergenic
1148091536 17:45025177-45025199 CAGGCCCCCAGGGGAACTGCAGG - Intronic
1149773873 17:59342215-59342237 CTGGTCCCCCAGGGCACAGCTGG - Intronic
1152340482 17:79721472-79721494 CAGCCCTCCTGGGGCCCAGCCGG + Intergenic
1153508341 18:5826828-5826850 CAGGCCTCCATGGACACTACAGG + Intergenic
1153966805 18:10189922-10189944 CAGGCCTCCAAGCCCACTGGAGG - Intergenic
1154970218 18:21400714-21400736 CTTGCCTCCATGGCCACAGCTGG - Intronic
1155830747 18:30512972-30512994 CATGCCTCCAAGGGCAAGCCAGG + Intergenic
1156383525 18:36585525-36585547 CAGGCCTCAAAGAGGGCAGCAGG + Intronic
1156447739 18:37249606-37249628 CAAGACTCCACGGGCTCAGCTGG + Intronic
1156608131 18:38693196-38693218 CAGGCATTTCAGGGCACAGCTGG - Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157317035 18:46600995-46601017 CAAGCGTCCAAGGGCCAAGCAGG - Intronic
1157615242 18:48983185-48983207 CAGGCCTGCAGGGGCAGATCTGG - Intergenic
1160197260 18:76766285-76766307 CAGGCCACCATGGGCACTGGGGG - Intergenic
1160561138 18:79756308-79756330 CAGGGCTGCAAGGACACGGCTGG - Exonic
1161000425 19:1907954-1907976 CTGCCCTCCAAGGGCGCGGCGGG + Intronic
1162286596 19:9743549-9743571 CAGGCCTCCAAGAGGGCACCAGG + Intergenic
1163552532 19:17973790-17973812 CTGACCTGCAAGGGCACAGAGGG - Exonic
1165213573 19:34254224-34254246 CAGGCCCCGACGGGCACTGCAGG - Intergenic
1165724689 19:38104509-38104531 CAGGCCTCCCTGGGCTCACCTGG + Intronic
1165896216 19:39142754-39142776 CAGGCAGCCAAGGGTAGAGCTGG - Intronic
1166388080 19:42393121-42393143 CTGGCCTTCAAGGAAACAGCAGG - Intergenic
1167034675 19:46988084-46988106 CAGGCATCCGAGGCCAGAGCTGG + Intronic
1167619956 19:50555261-50555283 CAGCCCTCCAGCAGCACAGCCGG + Intronic
925019780 2:559113-559135 CAGGCTCCAAAGGGCAAAGCCGG - Intergenic
925272261 2:2620298-2620320 CAGGTCCACAAGGGCACAGCAGG + Intergenic
925357204 2:3250211-3250233 CAGGCAGCCATGGGGACAGCTGG + Intronic
925742770 2:7020198-7020220 CAGGGCTCCAAGGGCATTCCAGG + Intronic
928113064 2:28525902-28525924 CAGGACTGAAAGGCCACAGCAGG + Exonic
928442542 2:31304080-31304102 GAGGCCTCCCAGGCCCCAGCAGG - Intergenic
929905365 2:46041122-46041144 CAGGTCTTCAAGTTCACAGCAGG + Intronic
930957122 2:57216898-57216920 CTGGCCTCCAAAGGAACAGGAGG - Intergenic
933989211 2:87621633-87621655 CAGGCCTCCCAGGAGATAGCAGG + Intergenic
934761910 2:96861161-96861183 CGGGCCTCCAAGGTCACCGACGG + Exonic
935509700 2:103956316-103956338 AAGGGCTCCCAGGACACAGCTGG + Intergenic
936304632 2:111329193-111329215 CAGGCCTCCCAGGAGATAGCAGG - Intergenic
937925757 2:127166260-127166282 GAGGCCTCCAGGGCCACAGAAGG + Intergenic
938062198 2:128262681-128262703 CAGGGCTCCAAGGACACCCCTGG - Intronic
940203608 2:151177866-151177888 CAGGCCACCCAAGGCAAAGCTGG + Intergenic
941342947 2:164329710-164329732 CATGCCACCAAGGCCACAGGAGG - Intergenic
942936187 2:181559493-181559515 AAGGGCTACAAGGGCCCAGCAGG + Intronic
944512472 2:200478008-200478030 CAGGCCACCAACGTCACAGCCGG - Exonic
946629280 2:221648627-221648649 CAGGCCCCGAATGGCACACCTGG + Intergenic
948056542 2:235012908-235012930 CAGGCCTCCAGGAGCAGGGCTGG + Intronic
948427061 2:237895043-237895065 CCAGCCACCAAGGGCCCAGCAGG + Intronic
948667142 2:239543472-239543494 CAGGTCTCTAATAGCACAGCAGG - Intergenic
948698968 2:239748826-239748848 CAGGCAGCCAAGGGCAGAGCTGG + Intergenic
948982074 2:241499502-241499524 CTGGCCTCCTAGGGCACAGCAGG + Intronic
1168892824 20:1305872-1305894 CAGGCCACCGTGGGCACGGCCGG - Exonic
1171143766 20:22764571-22764593 CAGGTCTGCAAGTGGACAGCAGG - Intergenic
1171216499 20:23356340-23356362 GCGGCCTCCAAGGGCACAGCGGG + Intergenic
1171881733 20:30622296-30622318 CAGGGCTCCTATGGCACTGCAGG - Intergenic
1172229839 20:33329183-33329205 CAGGCCCCCAAGGTCAAATCTGG + Intergenic
1172595917 20:36151111-36151133 CAGACCCCCAAGGTCACTGCGGG - Intronic
1172644345 20:36460883-36460905 CAGGCCTCCAGAGGCGGAGCCGG + Intronic
1173927736 20:46793196-46793218 CTGACCTCCATAGGCACAGCAGG + Intergenic
1173994102 20:47324614-47324636 CAGGTCACCAGGGGCACTGCAGG - Intronic
1175293879 20:57895676-57895698 GAGGCTTCCAAGTTCACAGCTGG - Intergenic
1176255953 20:64153074-64153096 AATGCCACCAAGGGCACAGGGGG - Intronic
1176625798 21:9091151-9091173 CAGGGCTCCTATGGCACTGCAGG + Intergenic
1178769808 21:35492630-35492652 CAGGCATGAAAGAGCACAGCTGG - Intronic
1179118470 21:38519355-38519377 CAGGCCTACAAGGGCAAGGGAGG + Intronic
1180070368 21:45432833-45432855 CAGGCCTCCCTCGGTACAGCCGG + Intronic
1180204155 21:46247008-46247030 CAGGCCTCCAAGGGCACAGCTGG + Intronic
1181002168 22:19992922-19992944 CAGTACTCCAAGGCCACAGTGGG + Intronic
1181510474 22:23386624-23386646 CAGGGCTCCAAGGCCCCAGGAGG - Intergenic
1181547169 22:23608676-23608698 GAGACCTCCAGGGGCAAAGCTGG + Exonic
1182116497 22:27759510-27759532 CAGGCCTCCAAGCTCAGAGTTGG - Intronic
1183109862 22:35641114-35641136 CAGTCCTCCATGAGCAAAGCAGG - Intergenic
1184091933 22:42297494-42297516 GCACCCTCCAAGGGCACAGCTGG + Intronic
1184572430 22:45334367-45334389 CTGGTCTCCAAGTTCACAGCTGG - Intronic
1184860670 22:47171667-47171689 CAGCCCACCAAGGGCAGGGCAGG - Intronic
1185105485 22:48867196-48867218 GAGGCCTGCAACGGCACAGGGGG + Intergenic
1185291030 22:50027852-50027874 CAGGCCCTCGAGGGCACGGCCGG - Intronic
949921573 3:9007388-9007410 CAGGCCTCAAAGGTCAAATCAGG - Intronic
950440087 3:13005430-13005452 CAGTCCTCCAAGGCAGCAGCTGG + Intronic
950644810 3:14370873-14370895 CAGGCCTCCTGGGGCAGGGCAGG - Intergenic
952207159 3:31191644-31191666 CAGGCCTCCAAAGCCACGTCAGG + Intergenic
958755455 3:98245706-98245728 CAGGCCTCCAAGAGGGCACCAGG + Intergenic
960173183 3:114487253-114487275 ATGGTCTCCAAGGGCACTGCTGG + Intronic
961176097 3:124836081-124836103 CAGGCCTCAGAGAGCACATCTGG - Intronic
961694954 3:128698260-128698282 CAGGCTTCCCAGGGCCCAGAAGG + Intergenic
962271333 3:133980004-133980026 CAGCCCTCACAGGGCACAGGAGG - Intronic
964721920 3:159775684-159775706 CAGGCCAACACTGGCACAGCTGG - Intronic
966550646 3:181200561-181200583 CAGGCCACCAAGGTCTCAGGTGG - Intergenic
968486877 4:867126-867148 CAGGCCTGCGGGGGTACAGCTGG + Exonic
968540788 4:1167376-1167398 CAGGCGGCCGAGGGCACAGGGGG - Exonic
968872098 4:3247383-3247405 CATGACTCCAAGGGCAGAGGTGG - Intronic
968914050 4:3489464-3489486 CAGGCCACCATGCGCCCAGCTGG - Intronic
968977087 4:3827677-3827699 CAGGGCTCCCAGGTCACTGCAGG - Intergenic
969398656 4:6939232-6939254 CAGGCCTGCAGGAGGACAGCAGG - Intronic
969568689 4:7995417-7995439 CATGCCTCCAGGGGCAAGGCAGG + Intronic
971302848 4:25456176-25456198 CATGCATCCATGGGCACCGCAGG + Intergenic
971792492 4:31186504-31186526 TAGGCCTAGAAGGGCACAACTGG + Intergenic
976098864 4:81539126-81539148 CTTGCCTCCAAGGCCTCAGCAGG + Intronic
976466039 4:85369883-85369905 CAGGACTCCCAGTGCCCAGCAGG + Intergenic
979728835 4:123997303-123997325 CAGGACACACAGGGCACAGCCGG + Intergenic
980714342 4:136612004-136612026 CAGGCCTCCAAGAGGGCACCAGG + Intergenic
981082005 4:140645104-140645126 CAGGCCTTTAGGAGCACAGCTGG + Intronic
981681735 4:147407426-147407448 CAGGCCTCCAAGGGAGCAGCAGG - Intergenic
983229172 4:165112599-165112621 CAGGCCTCCCCGGGCACAGGCGG + Intronic
983930601 4:173449468-173449490 CTGGTCTCCCAGGGCATAGCTGG + Intergenic
1202762880 4_GL000008v2_random:127008-127030 CAGGGCTCCTATGGCACTGCGGG - Intergenic
985578304 5:683876-683898 CCGGCCTCCACAGGCTCAGCTGG + Intronic
986044241 5:4022411-4022433 CAGGCCCACAAGGGCAGCGCTGG - Intergenic
986115523 5:4770177-4770199 CTGGCCTCCATGGGCATAGAAGG - Intergenic
986164130 5:5258730-5258752 CAGGCCTAGAAGGGCAAGGCTGG + Intronic
986305199 5:6509238-6509260 CAGGCATTCCAGGGCAGAGCAGG - Intergenic
986458303 5:7942504-7942526 CAGGCTTCCCAGGGCACAGGAGG - Intergenic
986496240 5:8344586-8344608 CAGGCCTGCCAGTGCACAGAAGG - Intergenic
990984357 5:61627006-61627028 CAGGCCTCCATGGGGCCAGTGGG + Intergenic
992869701 5:80993895-80993917 TTGGCCTCCAGGGGCACAGATGG + Intronic
998394464 5:141809826-141809848 CAGGCCTGGAAGGGCAGAGGCGG - Intergenic
999179507 5:149659189-149659211 CAGTTCTCCAAAGGCACATCAGG + Intergenic
1002008681 5:176258438-176258460 CAGGTTTCCAAGGGAACATCAGG + Intronic
1002218041 5:177653813-177653835 CAGGTTTCCAAGGGAACATCAGG - Intergenic
1002466377 5:179410862-179410884 CAGGCCTCCAACGTCTGAGCTGG - Intergenic
1002566239 5:180113901-180113923 CAGGCCTCCCAAAGCACAGCAGG - Intronic
1002669019 5:180850088-180850110 CAGGCCTCAAAGTCCACAGGAGG - Exonic
1002792703 6:447493-447515 CAGGCTTCCAGGGGCACCGGAGG - Intergenic
1005012646 6:21350346-21350368 CAGGCCCCAAAGGGGACAGGAGG + Intergenic
1006340584 6:33444219-33444241 CATGCCTCCAAGCCCCCAGCTGG - Intronic
1006826028 6:36937075-36937097 CAAGCCACCAATGGCAGAGCTGG + Intergenic
1008625949 6:53316630-53316652 GGGCCCTCCAAAGGCACAGCAGG + Intronic
1008817874 6:55590829-55590851 CAGTTCTCCAAGGGCAGAGGAGG + Intergenic
1010037442 6:71342569-71342591 GAGGCCTTCAAAGGGACAGCAGG - Intergenic
1010991499 6:82484975-82484997 CAGGCCTCCAAGGCCACCCTGGG - Intergenic
1017194694 6:151686808-151686830 CAGGTATCCAAGGGCACCTCTGG - Intronic
1017673891 6:156794500-156794522 CAGGCCTCCCAGGCCAAGGCAGG - Intronic
1018420939 6:163640770-163640792 CAGGCCTCGAAGGGCAGGGAGGG - Intergenic
1018892251 6:167990411-167990433 GAGGCCGCCAAGGGCACCGGCGG - Intergenic
1018995546 6:168707122-168707144 CAGGGATCCAAGGGCAGATCTGG - Intergenic
1019265627 7:116084-116106 CAGGCCTCCATGTCCAGAGCAGG - Intergenic
1019478564 7:1255644-1255666 CAGCCCCTCCAGGGCACAGCAGG + Intergenic
1019538250 7:1539839-1539861 CAGGCGTGCAGGGGCACCGCTGG + Intronic
1019663914 7:2241955-2241977 CAGGTCTCCAGGGGCAGGGCCGG - Intronic
1019700119 7:2470758-2470780 CAGGGCTGCAAGAGCCCAGCAGG + Intergenic
1019880972 7:3860691-3860713 CAGGCCTCCAAGGGGAGAGGAGG - Intronic
1020261489 7:6532863-6532885 CAGGTCTCCGTGGGCACAGTGGG + Intronic
1024565317 7:50675585-50675607 CCGGCCTCCAAGGGGAAAGATGG + Intronic
1025025689 7:55514560-55514582 CAGGCCCTGAAGGGCACAGAAGG + Intronic
1028075851 7:86514583-86514605 CAGGCATGCATGGGCACAGCTGG + Intergenic
1032123589 7:129174579-129174601 CAAGCCTGCAAGGGCAGGGCAGG + Intergenic
1034179449 7:149126294-149126316 CTGGCCCCCAAAGGCAGAGCCGG + Exonic
1035814995 8:2529462-2529484 CAGGGCTTCCAGGGCACAGCAGG - Intergenic
1037219800 8:16504752-16504774 CAGGCCTGCATTAGCACAGCTGG + Intronic
1037629373 8:20639498-20639520 CAGACTTCCCAAGGCACAGCAGG - Intergenic
1037743381 8:21624703-21624725 CAGGTCCCCAAGGCCAAAGCTGG + Intergenic
1039418297 8:37414563-37414585 CTGGCCTCCAAGGGCCCAAGAGG - Intergenic
1039843151 8:41307961-41307983 CAGCCCTCCGAGGGCAGAGCTGG + Intronic
1039972383 8:42331211-42331233 CAGCCCTCCGTGGGCACTGCCGG + Exonic
1042042443 8:64607018-64607040 AAGTCCTCCCAGGGCCCAGCTGG - Intronic
1045020004 8:98034210-98034232 CACTCCACCAAGGGAACAGCAGG + Intronic
1045382776 8:101643729-101643751 CAGGCCACCCAGGCCTCAGCTGG + Intronic
1045504907 8:102771508-102771530 CAGGCCTCCAAACACACAGTGGG + Intergenic
1046212055 8:111089334-111089356 CCTGTCTCCAAGGGCACAGATGG - Intergenic
1047773405 8:128049139-128049161 CAGGCCTCCATGTGCAGGGCTGG + Intergenic
1049053318 8:140215910-140215932 CTGGCCTCCAAGGGCAGACGGGG + Intronic
1049222737 8:141435313-141435335 CAGGCCTCCATGGGCACTGGAGG + Intergenic
1049542704 8:143215682-143215704 AAGGACACCAAGGACACAGCCGG - Intergenic
1049795721 8:144496512-144496534 CAGGGCACCAAGGGCACAGGCGG - Exonic
1050655492 9:7823830-7823852 CTGGCCTCCAGGGAAACAGCTGG - Intronic
1051182452 9:14425459-14425481 CAGGGCATCAAGTGCACAGCTGG - Intergenic
1053092530 9:35292261-35292283 TGGGCCTCCAAGCACACAGCAGG - Intronic
1055936025 9:81604999-81605021 CAAGCCCCCAAGGGCAGAGAAGG + Intronic
1058644466 9:107118038-107118060 CAGTTATCCAAAGGCACAGCTGG + Intergenic
1058759085 9:108112543-108112565 CAGAGCTCCAATGGCACAGCAGG + Intergenic
1061193330 9:129094639-129094661 CAGTGCCCCAAGGTCACAGCTGG + Intergenic
1062206712 9:135341643-135341665 AAGGACGCCAAGGCCACAGCGGG + Intergenic
1062309915 9:135930077-135930099 CATGCCTCCAAGGGCAGCGAAGG + Intergenic
1062422094 9:136487667-136487689 CAGGCCCCCAGGGCCACAGGAGG + Intergenic
1203748971 Un_GL000218v1:61572-61594 CAGGGCTCCTATGGCACTGCAGG + Intergenic
1203543643 Un_KI270743v1:111889-111911 CAGGGCTCCTATGGCACTGCGGG - Intergenic
1186078679 X:5907507-5907529 TAGGCGTCCAAGTGCACATCTGG + Intronic
1190416932 X:50189433-50189455 CAGTCCTCCCTGAGCACAGCTGG - Intergenic
1190937148 X:55007428-55007450 CAGGCCTCCATTGGTTCAGCTGG - Exonic
1190979231 X:55441245-55441267 CAGGCATGCAAATGCACAGCGGG + Intergenic
1192429165 X:71101037-71101059 CTGGCCTCAAGGGGGACAGCCGG - Exonic
1195741713 X:108071618-108071640 GAGGCCTCCAAGACCACAGCAGG - Intronic
1197639776 X:128954838-128954860 CAGGGCACCAAGTACACAGCAGG + Intergenic
1200089023 X:153625788-153625810 CAGGCCCCCAGAGGCCCAGCAGG + Intergenic
1201162330 Y:11176578-11176600 CAGGGCTCCTATGGCACTGCAGG + Intergenic
1202381823 Y:24280522-24280544 CAGGCCTGGCAGGGCACACCAGG - Intergenic