ID: 1180204669

View in Genome Browser
Species Human (GRCh38)
Location 21:46251180-46251202
Sequence CAGAATGGCAAGAGCATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 649}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180204663_1180204669 21 Left 1180204663 21:46251136-46251158 CCCAGGAAAAGGGAAGAATTTGC 0: 1
1: 0
2: 2
3: 27
4: 336
Right 1180204669 21:46251180-46251202 CAGAATGGCAAGAGCATGGATGG 0: 1
1: 0
2: 1
3: 39
4: 649
1180204664_1180204669 20 Left 1180204664 21:46251137-46251159 CCAGGAAAAGGGAAGAATTTGCA 0: 1
1: 0
2: 4
3: 34
4: 306
Right 1180204669 21:46251180-46251202 CAGAATGGCAAGAGCATGGATGG 0: 1
1: 0
2: 1
3: 39
4: 649
1180204665_1180204669 -3 Left 1180204665 21:46251160-46251182 CCAAGAAGTTACTGTTACCTCAG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1180204669 21:46251180-46251202 CAGAATGGCAAGAGCATGGATGG 0: 1
1: 0
2: 1
3: 39
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180204669 Original CRISPR CAGAATGGCAAGAGCATGGA TGG Intronic
900464801 1:2820549-2820571 CACAGTGGTAGGAGCATGGAGGG - Intergenic
901010027 1:6195353-6195375 GAGAATGGCATGAACATGGGAGG + Intronic
901041975 1:6369666-6369688 GAGAATGGCATGAACCTGGAAGG - Intronic
901823565 1:11846211-11846233 CAGAATTGCAAGATCCTGAAGGG - Intronic
902005664 1:13229935-13229957 GAGAATGGCAAGAACCTGGGAGG + Intergenic
903494671 1:23757586-23757608 GAGAATGGCATGAACCTGGAAGG - Intronic
903819416 1:26090137-26090159 GAGAATGGCATGAACCTGGAAGG + Intergenic
903852088 1:26313868-26313890 GAGAATGGCATGAACCTGGAAGG - Intronic
903873747 1:26457378-26457400 CAGAATGGCATGAACCTGGGAGG + Intronic
903886728 1:26545257-26545279 GAGAATGGCATGAACCTGGAAGG - Intronic
904133171 1:28290435-28290457 GAGAATGGCTTGAGCCTGGAAGG - Intergenic
904142599 1:28365677-28365699 GAGAATGGCATGAACATGGGAGG - Intergenic
904146401 1:28395727-28395749 CAGAATAGCATGAACCTGGAAGG - Intronic
904450876 1:30610656-30610678 CAGAAGAGCAAGAGCATGGAAGG + Intergenic
904483060 1:30806158-30806180 CAGAATGGCAGGAACAGGGGTGG - Intergenic
905734909 1:40317971-40317993 CTGGATGGCAGGAGCTTGGATGG - Intergenic
906211101 1:44012712-44012734 CAAAATCACAAGAGTATGGAAGG + Intronic
906391790 1:45423465-45423487 GAGAATGGCATGAGCCTGGGAGG + Intronic
906688588 1:47778246-47778268 CAGCAGGGCCAGAGCATGGGTGG - Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907687688 1:56629543-56629565 GAGAATGGCATGAACCTGGAAGG + Intronic
907747217 1:57225062-57225084 CAGAGTGGCAAGATCTTGGGTGG - Intronic
907844282 1:58189824-58189846 CAGGATGGTCAGAGCATGGGAGG - Intronic
907882033 1:58559361-58559383 GAGAATGGCAAGAACCTGGCAGG - Intergenic
908034503 1:60037494-60037516 CAGAAGGGCAAGAGGAGGCAAGG + Intronic
908199159 1:61776813-61776835 GAGAATGGCAAGAACCTGGGAGG - Intronic
908759287 1:67497272-67497294 GAGAATGGCATGAGCCTGGGAGG - Intergenic
910088767 1:83436779-83436801 GAGAATGGCATGAACCTGGAAGG - Intergenic
910329077 1:86048578-86048600 GAGAATGGCATGAGCCTGGGAGG - Intronic
910368094 1:86487742-86487764 CAGTATGGCTAGAGGCTGGATGG - Intronic
910864073 1:91771614-91771636 GAGAATGGCATGAACATGGGAGG + Intronic
911110148 1:94175435-94175457 CAGAAAAGCAGGAGAATGGAGGG - Intronic
911287481 1:96013782-96013804 CAGAATGGCAATGGTTTGGATGG + Intergenic
911821633 1:102430841-102430863 GAGAATGGCATGAACCTGGAAGG + Intergenic
912233387 1:107821753-107821775 CAGGAAGGCAAGAGCAGGAAAGG + Intronic
912598371 1:110902285-110902307 GAGAATGGCAAGAGGAAGGCTGG - Intergenic
912670097 1:111617520-111617542 GAGAATGGCATGAACCTGGAAGG - Intronic
913006001 1:114631690-114631712 GAGAATGGCCAGAACATGGGAGG + Intronic
913083784 1:115415124-115415146 GAGAATGGCATGAACCTGGAAGG - Intergenic
914708819 1:150194260-150194282 GAGAATGGCATGAACCTGGAAGG + Intergenic
914727107 1:150337126-150337148 GAGAATGGCATGAACCTGGAAGG - Intronic
914737646 1:150433532-150433554 GAGAATGGCATGAACCTGGAAGG - Intronic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915805547 1:158845325-158845347 CAGAATGGCATGAACCTGGGAGG - Intronic
916449949 1:164911178-164911200 GAGAATAGCAGCAGCATGGATGG + Intergenic
916744420 1:167673763-167673785 CAAAGTGTCAAAAGCATGGAAGG - Intronic
917421734 1:174870825-174870847 GAGAATGGCGTGAGCCTGGAAGG - Intronic
917473990 1:175352576-175352598 CACCTTTGCAAGAGCATGGAGGG + Intronic
917511537 1:175673158-175673180 CTGAATGGCAAGCTCTTGGAGGG + Intronic
918039534 1:180904933-180904955 CAGAATTGCTTGAGCCTGGAAGG - Intergenic
918168062 1:181969721-181969743 CAGAATGGCATGAACCTGGGAGG - Intergenic
918954480 1:191187752-191187774 GAGAATGGCATGAACCTGGAAGG + Intergenic
919461159 1:197879393-197879415 GAGAATGGCATGAACATGGGAGG - Intergenic
919501019 1:198338175-198338197 CATAATGGCAAAAGCAAAGAAGG + Intergenic
920292973 1:204936908-204936930 CAGCATGGCTGGAGCTTGGAGGG - Intronic
921092975 1:211860435-211860457 CAGAAAAGCAAGAGAAAGGATGG + Intergenic
921131125 1:212220816-212220838 GAGAATGGCATGAACCTGGAAGG + Intergenic
922083772 1:222325251-222325273 GAGAATGGCATGAGCCTGGGAGG + Intergenic
923518343 1:234716382-234716404 TAGAATGGAAAGAGCAGGGAGGG + Intergenic
923575718 1:235157272-235157294 CAGACTGACCAGAGCAGGGAAGG + Intronic
924819914 1:247479355-247479377 GAGAATCGCATGAGCCTGGAAGG - Intergenic
924825420 1:247533129-247533151 CAGAGTGGCAGGAGCAGGGGTGG - Intronic
924903761 1:248430293-248430315 CAGGATGGCTAGAGCAGTGAGGG - Intergenic
1063408805 10:5820722-5820744 CAGAAGGGAAAGAGCATGGCAGG - Intronic
1064204162 10:13309021-13309043 GAGAATGGCTTGAGCCTGGAAGG + Intergenic
1065212743 10:23420229-23420251 CAGAATCGCTTGAGCCTGGAAGG + Intergenic
1065321137 10:24511218-24511240 CAGAGTGCCAGGTGCATGGAGGG + Intronic
1066378730 10:34883472-34883494 CAGAATGGCATGAACCTGGCAGG - Intergenic
1067479633 10:46586454-46586476 GAGAATGGCATGAGCCTGGGAGG + Intronic
1067615103 10:47755343-47755365 GAGAATGGCATGAGCCTGGGAGG - Intergenic
1067831839 10:49614967-49614989 CAGGCTGGCAGGAGCATGGGTGG + Intronic
1068153865 10:53170042-53170064 CAGAAGGGCAAGAGGAGGGAGGG - Intergenic
1068290256 10:54992663-54992685 GAGAATGGCATGAACCTGGAAGG + Intronic
1068388743 10:56364245-56364267 GAGAATGGCATGAGCCTGGGAGG + Intergenic
1069254108 10:66310774-66310796 CAGAATGGCATGAACCTGGGAGG - Intronic
1069524159 10:69152878-69152900 GAGAATGGCATGAACCTGGAAGG + Intronic
1069567302 10:69472355-69472377 CAGAAAGGCAAGATCAGGGAAGG - Intronic
1069647633 10:70015389-70015411 GAGAATGGCATGAGCCTGGGAGG - Intergenic
1070000103 10:72369966-72369988 GAGAATGGCATGAACCTGGAGGG - Intronic
1070129275 10:73645912-73645934 GAGAATGGCATGAACCTGGAAGG - Exonic
1070367721 10:75752299-75752321 GAGAATGGCATGAGCCTGGGAGG - Intronic
1071113710 10:82192600-82192622 CAGGAAGTCAAGAGCAGGGATGG - Intronic
1071420544 10:85492844-85492866 CACAATGGCAAGACCAAGGTTGG + Intergenic
1072136405 10:92550778-92550800 GAGAATGGCATGAACCTGGAAGG + Intronic
1072146131 10:92640519-92640541 GAGAATGGCGTGAGCCTGGAAGG - Intronic
1072977113 10:100068301-100068323 GAGAATGGCATGAGCCTGGGAGG - Intronic
1073151514 10:101314710-101314732 GAGAATGGCATGAGCCTGGGAGG - Intergenic
1075824891 10:125346998-125347020 GAGAATCGCTTGAGCATGGAAGG + Intergenic
1076659555 10:132046364-132046386 CAGAATGGCATGAACTTGGGAGG + Intergenic
1076877399 10:133222871-133222893 CACACTGGGAAGAGCATGGCTGG - Intronic
1077231284 11:1459161-1459183 CAGAATGGAGAGAGGAGGGAGGG - Intronic
1077599696 11:3565854-3565876 CAGAAGGGCAAGCAGATGGATGG + Intergenic
1077637313 11:3852230-3852252 GAGAATGGCATGAACTTGGAAGG - Intergenic
1077754028 11:5006068-5006090 CAGAAGGGGAAGGGCAAGGAAGG - Intergenic
1078225954 11:9391612-9391634 CAGAATGGCATGAACCTGGGAGG + Intronic
1078814513 11:14806356-14806378 GAGAATGGCATGAACCTGGAAGG + Intronic
1078998973 11:16733935-16733957 GAGAATGGCATGAACCTGGAAGG + Intronic
1079274309 11:19019777-19019799 CAAAAGTGCAAGAGCAAGGAGGG - Intergenic
1079372478 11:19863323-19863345 CATAATGGCTGGAGCATGGCAGG - Intronic
1079612152 11:22446531-22446553 CATAGTGGTAAGAACATGGACGG - Intergenic
1079707992 11:23645986-23646008 CAGAATGACAAGAGCAAAGTTGG + Intergenic
1081304095 11:41490347-41490369 TAGAATGGCATGAACCTGGAAGG - Intergenic
1081334062 11:41842558-41842580 GAAAATGGAAAGGGCATGGAAGG - Intergenic
1081342263 11:41942737-41942759 GAGAATGGCATGAACATGGGAGG + Intergenic
1082192712 11:49266793-49266815 TAGACAGGCAAGAGCATGGCAGG + Intergenic
1082560553 11:54615613-54615635 GAGAATGGCGTGAACATGGAAGG - Intergenic
1083023269 11:59528683-59528705 CAGTATGGGCAGAACATGGAGGG + Intergenic
1084196290 11:67524978-67525000 GAGAATAGGAAGAGCAAGGAAGG - Intergenic
1084616638 11:70240779-70240801 CAGCAAGGCAAGAGCTCGGAAGG - Intergenic
1084706638 11:70819745-70819767 CAGCATGGCAGGAGCACAGAGGG - Intronic
1084772504 11:71352890-71352912 CAGCATGGCAAGGGCCTTGAAGG - Intergenic
1084847950 11:71915356-71915378 GAGAATGGCAAGAACCTGGGAGG + Intronic
1084999595 11:73018654-73018676 CAGAATGGCAAAAACATAAATGG - Intronic
1085110392 11:73882690-73882712 AAGAATGGCATGAACCTGGAAGG - Intronic
1085183673 11:74557400-74557422 CAGAATGGCATGAACCTGGGAGG + Intronic
1085426234 11:76406916-76406938 GAGAATGGCAAGAACCTGGGAGG + Exonic
1086281480 11:85194631-85194653 CAGAATAGAAAGAGTATGGGAGG + Intronic
1086551391 11:88056712-88056734 GAGAATGGCGTGAACATGGAAGG + Intergenic
1087458401 11:98416403-98416425 GAGAATGGCATGAGCCTGGGAGG + Intergenic
1087463084 11:98469878-98469900 GAGAATGGCATGAACCTGGAAGG + Intergenic
1087558468 11:99753210-99753232 GAGAATGGCATGAACACGGAAGG - Intronic
1087701403 11:101440455-101440477 AAGAAGGGCCAGAGCATGGACGG - Intergenic
1087838319 11:102897002-102897024 GAGAATGGCATGAACCTGGAAGG + Intergenic
1088509296 11:110558266-110558288 TGAAATGGCAAGAGCAAGGAGGG - Intergenic
1088646338 11:111919515-111919537 CGGAATGGCCAGAGCAGGGCAGG + Intronic
1089140940 11:116283392-116283414 CAGCATGGAGAGAGCGTGGATGG - Intergenic
1089374149 11:117982662-117982684 CAGAATGGCATGAACCCGGAAGG + Intergenic
1089429283 11:118408070-118408092 GAGAATGGCAAGAACCTGGGAGG + Intronic
1089463560 11:118667726-118667748 CAAAATGGCAACAGCATACATGG + Intronic
1089759782 11:120714967-120714989 CAGAGTGGCAAATGCATGGGAGG + Intronic
1090533738 11:127618287-127618309 GAGAATGGCATGAACCTGGAAGG - Intergenic
1091423156 12:361282-361304 GAGAATGGCATGAACCTGGAAGG - Intronic
1091609813 12:1996409-1996431 AAGAATGGCAAAAGCAGGGGCGG - Intronic
1091726477 12:2849761-2849783 CAGTATGTCAAAAGGATGGAAGG - Intronic
1091744905 12:2985293-2985315 GAGAATGGCATGAGCCTGGGAGG + Intronic
1092318939 12:7450627-7450649 AAGAAGGGCAAGACCATGGAGGG + Intronic
1092390755 12:8076302-8076324 CTGAATGGTAAGCTCATGGATGG - Intergenic
1092812964 12:12288459-12288481 CAGAATGGCATGAACCTGGGAGG + Intergenic
1093023340 12:14222637-14222659 GAGAATGGCATGAACCTGGAAGG - Intergenic
1093069166 12:14690629-14690651 GAGAATGGCATGAACATGGGAGG - Intronic
1093081117 12:14812352-14812374 GAGAATGGCATGAGCCTGGGAGG + Intronic
1093754240 12:22834398-22834420 GAGAATGGCATGAGCCTGGGAGG + Intergenic
1094795548 12:33967397-33967419 CTAAATGGCAAGAGAATGGTTGG + Intergenic
1094814039 12:34166607-34166629 CAGAACTGCAAGAGATTGGAGGG + Intergenic
1095108183 12:38260424-38260446 CTAAATGGCAAGAGAATGGTTGG + Intergenic
1095771916 12:45969422-45969444 GAGAACAGCAAGAGCAAGGAGGG - Intronic
1096096243 12:48937597-48937619 GAGGATGGCAGGGGCATGGAGGG + Exonic
1096198451 12:49664153-49664175 CAGAATGGCTTGAGCCTGGGAGG + Intronic
1096715811 12:53490652-53490674 AAGAATGGCATGAACATGGGAGG + Intronic
1096819701 12:54224277-54224299 GAGAATGGCATGAACCTGGAAGG - Intergenic
1097120872 12:56730795-56730817 GAGAATGGCATGAGCCTGGCAGG + Intronic
1097394047 12:59052382-59052404 CAGAATGGCATGAACCTGGGAGG - Intergenic
1098037263 12:66316927-66316949 GAGAATGGCATGAACCTGGAAGG + Intronic
1098269790 12:68758829-68758851 GAGAATGGCATGAACCTGGAAGG - Intronic
1098947709 12:76606878-76606900 CAGAATGGCTGGGGCATGGTGGG - Intergenic
1099205659 12:79723299-79723321 GAGAATGGCGTGAACATGGAAGG - Intergenic
1099888564 12:88561743-88561765 CAGTGTGGCTAGAGCATGGTGGG - Intronic
1100241680 12:92715873-92715895 CAGAATTGCAAGAGACTGCATGG + Intergenic
1100256387 12:92886906-92886928 GAGAATGGCATGAGCCTGGGAGG + Intronic
1101395936 12:104347645-104347667 CATATTGGCAACAGCTTGGATGG + Intronic
1101685751 12:107018495-107018517 AAGAATGGCTTGAGCCTGGAAGG + Intronic
1102372753 12:112395956-112395978 CAGAATGGCGTGAACATGGGAGG + Intergenic
1103082913 12:118039581-118039603 GAGGATGGCAACAGCAGGGAGGG + Intronic
1103092288 12:118105864-118105886 GAGAATGGCATGAGCCTGGGAGG - Intronic
1103202084 12:119096108-119096130 GAGAATGGCATGAACCTGGAAGG - Intronic
1103376320 12:120458948-120458970 GAGAATGGCATGAACGTGGAAGG - Intronic
1103476456 12:121222342-121222364 CAGTAGGGCAAGAGCTGGGATGG - Intronic
1103610228 12:122119479-122119501 GAGAATGGCATGAACCTGGAAGG - Intronic
1103657587 12:122485758-122485780 GAGAATGGCATGAACCTGGAAGG - Intronic
1103759632 12:123239177-123239199 GAGGATGGCTAGAGCCTGGAAGG + Intronic
1104340255 12:127942788-127942810 CAGAATGCGAAGAGGATGGTGGG + Intergenic
1104530387 12:129564838-129564860 CAGGCTGGCATGACCATGGAAGG + Intronic
1105058490 12:133126382-133126404 GAGAATGGCATGAACCTGGAAGG + Intronic
1105681603 13:22733865-22733887 CAGAATGGCTTGAGCCTGGGAGG + Intergenic
1105731618 13:23223186-23223208 GAGAATGGCATGAACCTGGAAGG + Intronic
1105748792 13:23402086-23402108 GAGAATGGCATGAACCTGGAAGG + Intronic
1105992261 13:25633884-25633906 GAGAATGGCTTGAGCCTGGAAGG + Intronic
1107893271 13:44932810-44932832 CAGAGTGGCAAGGGCAGGGTAGG - Intergenic
1108674200 13:52722154-52722176 GAGAATGACCAGAGCAAGGAAGG + Intronic
1109808592 13:67476744-67476766 GAGAATGGCATGAGCCTGGGGGG + Intergenic
1111603266 13:90502080-90502102 CAGAAGGGTAAAAGAATGGAGGG + Intergenic
1111706388 13:91754294-91754316 GAGAATGGGAAGAGATTGGAGGG + Intronic
1111918505 13:94386268-94386290 GAGAATGGCATGAGCCTGGGAGG + Intronic
1112639342 13:101255375-101255397 CACACTGGCAACAGCAGGGAAGG - Intronic
1112685180 13:101816178-101816200 CAGAATGGCATGAACCTGGGAGG + Intronic
1113112341 13:106837105-106837127 CAGAATGTCAAGAGCTCTGAGGG - Intergenic
1113345315 13:109472184-109472206 CACAAGGGCAAGACCAGGGAAGG + Intergenic
1113356883 13:109589576-109589598 GAGAAGGGCAATAGCATGGGAGG + Intergenic
1113982967 13:114291572-114291594 GAGAATGGCAGAAGCAGGGAGGG - Intronic
1114027981 14:18545869-18545891 GAGAATGGCATGAACATGGGAGG + Intergenic
1114166791 14:20226769-20226791 CAGAATCACAAGAACATGAAGGG + Intergenic
1115611446 14:35052309-35052331 AAGAATGGCATGAACCTGGAAGG - Intronic
1115925437 14:38428310-38428332 GAGAATGGCATGAACCTGGAAGG + Intergenic
1115928125 14:38460469-38460491 CAGAGTGTCAGGAGCATTGAAGG - Intergenic
1117525053 14:56592625-56592647 CAGAAAGATAAGAACATGGAAGG + Intronic
1118493504 14:66285309-66285331 AAAACTGGAAAGAGCATGGATGG + Intergenic
1119248773 14:73134615-73134637 CAGAATTGCTTGAGCCTGGAAGG - Intergenic
1119341444 14:73882588-73882610 GAGAATGGCGTGAGCCTGGAAGG - Intronic
1119447304 14:74676884-74676906 GAGAATGGCATGAGCCCGGAAGG - Intronic
1120406349 14:84097882-84097904 GAGAATGGCATGAACCTGGAAGG + Intergenic
1120735957 14:88053123-88053145 GAGAATGGCATGAGCCTGGGAGG - Intergenic
1121349877 14:93164826-93164848 GAGAATGGCATGAACATGGGAGG + Intergenic
1121552033 14:94810105-94810127 CACAATGGCAAGAGCAGGAAAGG - Intergenic
1122250818 14:100438444-100438466 GAGAATGGCAGGAGCACAGAGGG - Intronic
1202889085 14_KI270722v1_random:138429-138451 GAGAATGGCATGAGCCTAGAAGG + Intergenic
1123790211 15:23712109-23712131 GAGAATGGCATGAACATGGGAGG - Intergenic
1123879052 15:24657351-24657373 CAGAAAGGGCAGACCATGGAGGG + Intergenic
1124951020 15:34320817-34320839 GAGAATGGCATGAACCTGGAAGG + Intronic
1125737960 15:41941772-41941794 CAAAATGCCAAGAGAAAGGAGGG + Intronic
1126060084 15:44772323-44772345 GAGAATGGCATGAGCCTGGAAGG - Intergenic
1126105528 15:45144625-45144647 CAGGAAGGCCAGAGGATGGAGGG - Intronic
1126917721 15:53484225-53484247 GAGAATGGCATGACCCTGGAAGG + Intergenic
1127138718 15:55952242-55952264 GAGAATGGCATGAACCTGGAAGG + Intronic
1127395008 15:58537545-58537567 CAGGCAGGCCAGAGCATGGAGGG - Intronic
1127446896 15:59072541-59072563 CAGAATGGCATGAACCTGGGAGG - Intronic
1127592472 15:60439468-60439490 GAGAATCGCAAGAGCCTGGGAGG - Intronic
1128142906 15:65314931-65314953 CAGAATGGCATGAACCTGGGAGG - Intergenic
1128193304 15:65725585-65725607 GAGAATGGCAAGAACCTGGGAGG + Intronic
1128294644 15:66507373-66507395 CTGAATGAAAAGAGCATGGATGG - Intronic
1128659062 15:69484618-69484640 CAGAATGGAAAGAACCTGGCTGG - Intergenic
1128832258 15:70780174-70780196 GAGAATGGCAAGAACCTGGGAGG + Intergenic
1129913983 15:79251936-79251958 CAGAATGGAAGAAACATGGAAGG - Intergenic
1130192154 15:81747664-81747686 CAGAATGCCAAGAGGAAGCAGGG - Intergenic
1130195224 15:81773066-81773088 CAGAAGGGAAAAAACATGGAAGG + Intergenic
1130509462 15:84576787-84576809 AAGAATGGCATGAACCTGGAAGG - Intergenic
1131161973 15:90111529-90111551 GAGAATGGCATGAGCCTGGGAGG + Intergenic
1131474742 15:92728177-92728199 CAGAATGGCATGAACCTGGGAGG + Intronic
1132810934 16:1796750-1796772 GAGAATGGCATGAACCTGGAAGG - Intronic
1133245170 16:4443774-4443796 GAGAATGGCATGAGCCTGGGAGG - Intronic
1133958238 16:10466163-10466185 CTGAATAGCAACAGCACGGATGG - Intronic
1134879208 16:17729650-17729672 CAGAATGGCAAGAGGCTCCAAGG + Intergenic
1135182803 16:20290277-20290299 GAGAATGGCATGAACCTGGAAGG - Intergenic
1135560878 16:23475838-23475860 GAGAATGGCTAGAGCCTGGGAGG + Intronic
1135644677 16:24151636-24151658 AAGCAGTGCAAGAGCATGGAAGG + Intronic
1135875992 16:26200484-26200506 CAGAATGGCAAGAGGACAGCAGG - Intergenic
1135881052 16:26257888-26257910 CTGAATGTCAAGAGGATGTAGGG + Intergenic
1136083856 16:27870688-27870710 CATGAGGGCAAGAGCATTGAAGG - Intronic
1137649654 16:50108883-50108905 GAGAATGGCATGAGCCTGGGGGG + Intergenic
1137945514 16:52730171-52730193 AAGAATGGCGTGAGCATGGGAGG + Intergenic
1138482536 16:57313134-57313156 CAGAAGGGCAAGGGCATTGAGGG + Intergenic
1138504369 16:57470348-57470370 CAGAAAGGTAAGAGCCTGGTTGG + Exonic
1138644813 16:58416991-58417013 GAGAATGGCTAGAACCTGGAAGG - Intergenic
1140786479 16:78347206-78347228 AAGGATGGAAAGAGAATGGAGGG - Intronic
1140802117 16:78498113-78498135 GAGAATGGCATGAACATGGGAGG + Intronic
1140816206 16:78623128-78623150 CAGCATGGTAAGACCCTGGATGG + Intronic
1141031999 16:80597127-80597149 AAGAATGGCAGATGCATGGATGG + Intergenic
1141349163 16:83276779-83276801 AAGAATGGCATGAACATGGGAGG + Intronic
1141600147 16:85120914-85120936 GAGAATGGCATGAGCCTGGGAGG - Intergenic
1141723914 16:85773524-85773546 GAGAATGGCTTGAGCCTGGAAGG + Intronic
1142021913 16:87788904-87788926 CAGAATCGCTAGAGCCTGGGAGG + Intergenic
1143008427 17:3852128-3852150 CAGAGTGACAAGACCATGCATGG - Intergenic
1143072361 17:4307348-4307370 TAGAATGACAAGAGCCTGGCTGG - Intronic
1143449884 17:7029781-7029803 CAGGAAGGCAAGGGCAGGGAAGG - Intronic
1143467944 17:7150624-7150646 GAGAATGGCATGAGCCTGGGAGG - Intergenic
1143699521 17:8647823-8647845 GAGAATGGCATGAACCTGGAAGG - Intergenic
1144433772 17:15220915-15220937 CCGAATGGCAAATGCATGGAGGG - Intergenic
1144477592 17:15602020-15602042 GAGAATGGCATGATCACGGAAGG + Intronic
1144488898 17:15690727-15690749 GAGAATGGCAAGAACCTGGGAGG + Intergenic
1144535150 17:16081550-16081572 TAGAAGGGAAAGAGCAAGGATGG + Intronic
1144564045 17:16345170-16345192 GAGAATGGCATGAACCTGGAAGG + Intronic
1144637155 17:16917507-16917529 CAGAATGGCAGGAACCTGGCAGG - Intergenic
1144810796 17:17997680-17997702 GGGAGTGGCAAGAGCAGGGAGGG - Intronic
1144920646 17:18761353-18761375 GAGAATGGCATGATCACGGAAGG - Intronic
1145821641 17:27841342-27841364 AAGGATGGCAAGAGGAAGGAGGG - Intronic
1146074482 17:29715333-29715355 GAGAATGGCATGAACCTGGAAGG - Intronic
1146222494 17:31036940-31036962 CAGAATGGCATGAACCTGGGAGG - Intergenic
1146409508 17:32570452-32570474 GAGAATGGCATGAACCTGGAAGG - Intronic
1146772869 17:35585049-35585071 GAGAATGGCATGAACCTGGAAGG - Intronic
1147209461 17:38863685-38863707 GAGAATGGCATGAGCCTGGGGGG - Intergenic
1147363565 17:39946028-39946050 CAGAAAAGCAAGAGCAGAGAAGG + Intergenic
1147392122 17:40116314-40116336 CAGAATGGCATGAACCTGGGAGG - Intergenic
1148263011 17:46200650-46200672 CAGAATGGCATGAACCTGGGAGG + Intronic
1148643790 17:49207301-49207323 CAGGAAGGGAAGAGCAGGGACGG + Intronic
1148948819 17:51290324-51290346 GAGAATGGCTTGAGCCTGGAAGG + Intronic
1149049299 17:52285694-52285716 GAGAATGGCATGAACCTGGAAGG + Intergenic
1149313302 17:55417022-55417044 CAGAATTTCAAAACCATGGAGGG + Intronic
1149469213 17:56902361-56902383 CAGATTGGCAGGAGGATGAATGG + Intronic
1149508415 17:57215720-57215742 CATAATGGGGAGAGAATGGAAGG + Intergenic
1149644013 17:58226202-58226224 AAGAATGGGAGGAGCATGGAAGG - Intronic
1149675554 17:58457768-58457790 CACAATGGCATGAGCCTTGAAGG - Intronic
1150320716 17:64212182-64212204 CGGAATTGCAAGAGGAGGGAAGG - Intronic
1150329653 17:64284630-64284652 CAGAATGGCCAGACCACTGAAGG - Intergenic
1151472058 17:74324832-74324854 CACAATGGCACGATCATGGATGG - Intergenic
1152021385 17:77781710-77781732 CAGAATGGGAAGGGAAGGGAGGG - Intergenic
1152694475 17:81737069-81737091 GAGAATGGCAAGAACCTGGGAGG - Intergenic
1152971801 18:168985-169007 GAGAATGGCATGAGCCTGGGAGG + Intronic
1153726914 18:7966288-7966310 CACAATGGTAATAACATGGATGG - Intronic
1155356317 18:24957241-24957263 GAGAATGGCATGAACCTGGAAGG + Intergenic
1155364958 18:25040483-25040505 CTGCATGGCAACAGTATGGATGG + Intergenic
1155665742 18:28306462-28306484 GAGAATGGCATGAACCTGGAAGG + Intergenic
1156270229 18:35523871-35523893 CAGAACAGGAAGAGCAAGGATGG - Intergenic
1156695076 18:39755828-39755850 GAGAATGGCAAGAACCTGGGAGG + Intergenic
1156992768 18:43429856-43429878 GAGAATGGCATGAACCTGGAAGG + Intergenic
1157226415 18:45868963-45868985 GAGAATGGCGAGAACCTGGAAGG + Intronic
1157630500 18:49090685-49090707 CAGAGGGTGAAGAGCATGGAGGG - Intronic
1158407833 18:57176198-57176220 GAGAATGGCATGAACCTGGAAGG - Intergenic
1158619792 18:59023047-59023069 CAGAATGCTGAGAGCCTGGATGG + Intergenic
1159447786 18:68561250-68561272 GAGAATGGCATGAACCTGGAGGG + Intergenic
1159483052 18:69015942-69015964 GAGAATGGCATGAACATGGGTGG - Intronic
1160837786 19:1132736-1132758 CAGCAGGGAAAGAGCAGGGAGGG - Intronic
1161022747 19:2018422-2018444 GAGAATGGCATGAACCTGGAAGG - Intronic
1161040293 19:2107168-2107190 CAGAATGGCATGAGCCCGGGAGG + Intronic
1162295225 19:9808841-9808863 CTGAGTGGGAAGAGCATGGGAGG + Intergenic
1162899267 19:13785029-13785051 CAGAAAGGCAAGGGCCAGGACGG + Intergenic
1163620195 19:18355056-18355078 GAGAATGGCATGAACCTGGAAGG - Intronic
1163919017 19:20271323-20271345 CACAATAGCAAAGGCATGGACGG + Intergenic
1164596687 19:29534779-29534801 CAGATTGGCAACAGCAGGGGCGG + Intronic
1164902294 19:31938497-31938519 AACCATGGCAAGAGCCTGGAGGG - Intergenic
1165187072 19:34031468-34031490 GAGAATGGCAAGAACCTGGGAGG + Intergenic
1165244012 19:34487587-34487609 CAGAATGGAAAGTCCATAGATGG + Intronic
1166088257 19:40491283-40491305 CAGAGTGGCTAGAGAATGGGAGG + Intronic
1166220665 19:41362298-41362320 GAGAATGGCATGAACCTGGAAGG + Intronic
1166498259 19:43321513-43321535 AAGAATAGCAAGAGGAAGGATGG - Intergenic
1167122387 19:47525824-47525846 GAGAATGGCATGAACCTGGAAGG + Intronic
1167178414 19:47882457-47882479 CACAATGGGAAGAACATGGAAGG + Intronic
1168383628 19:55944838-55944860 GAGAATGGCATGAGCCTGGGAGG - Intergenic
1168601065 19:57718951-57718973 GAGAATGGCAAGAACCTGGGAGG + Intronic
925267469 2:2576192-2576214 CAGAATGGGACGAGCATGCAGGG + Intergenic
925577775 2:5378406-5378428 CATTAAGGCATGAGCATGGAAGG - Intergenic
925901580 2:8512977-8512999 CAGCAGGGCAAGGGCAGGGAGGG - Intergenic
926250582 2:11153467-11153489 CAGAAGGGGAAGAGGAGGGAGGG + Intergenic
926686010 2:15698088-15698110 CAGAATGGCATGAACCTGGGAGG + Intronic
928127835 2:28628492-28628514 GAGAATGGCAAGAGCATAGGAGG - Intronic
928363598 2:30685193-30685215 CAGAATGGCAAGATTCTGCATGG - Intergenic
928408242 2:31031842-31031864 CAGAGGGGCAAGAGCATGGCTGG + Intronic
928552809 2:32390258-32390280 GAGAATGGCATGAACATGGGAGG - Intronic
928597871 2:32873386-32873408 GAGAATGGCATGAACCTGGAAGG + Intergenic
930184791 2:48402548-48402570 CAGAATGGCATGAACCTGGGAGG + Intergenic
930286560 2:49436379-49436401 GAGAATGGCATGAACCTGGAAGG + Intergenic
930742046 2:54841680-54841702 GAGAATGGCATGAGCCTGGGAGG - Intronic
930939924 2:57000356-57000378 AAGAATGGGAACAGCATGAAGGG + Intergenic
931384998 2:61790823-61790845 TACAATGGTGAGAGCATGGAAGG + Intergenic
932079185 2:68695989-68696011 TAGCATGGCGAGAGCATGGAAGG + Intronic
932417656 2:71583564-71583586 CAGAAGGGCCAGAGCAGGGGTGG - Intronic
932593304 2:73079844-73079866 CAGACAGGGGAGAGCATGGAGGG + Intronic
932707914 2:74040936-74040958 CAGAAGGGCATGAGAATTGAGGG + Intronic
933370063 2:81403341-81403363 CACCATGGGAAGATCATGGAGGG + Intergenic
933432543 2:82202051-82202073 GAGAAAGGCAGGAGAATGGATGG + Intergenic
933447188 2:82396618-82396640 GAGAATGGCATGAACCTGGAAGG - Intergenic
933456457 2:82525643-82525665 GAGAAGAGCAAGAGAATGGAGGG + Intergenic
934089219 2:88537014-88537036 GAGAATCGCTTGAGCATGGAAGG - Intergenic
934952929 2:98591578-98591600 CAGAATGGCATGCGGAGGGAGGG - Intronic
935086448 2:99850320-99850342 GAGAATGGCAAGACCAAGGAAGG + Intronic
935129186 2:100248568-100248590 GAGAATAGCTTGAGCATGGAAGG - Intergenic
935169053 2:100596253-100596275 GAGAATGGCAAGAACCTGGAAGG - Intergenic
935941274 2:108241835-108241857 GAGAATGGCATGAGCCTGGGAGG + Intergenic
936069645 2:109357269-109357291 GAGAATGGCATGAGCCTGGGAGG - Intronic
936246275 2:110830621-110830643 GAGAATGGCATGAGCCTGGGAGG - Intronic
936696346 2:114954168-114954190 GAGAATGGCAAGAACCTGGGAGG - Intronic
936809291 2:116377240-116377262 CAGAATGGCTAGAACAATGATGG - Intergenic
937002055 2:118476980-118477002 CAGAATGGCAAGAGCCTGTTGGG + Intergenic
937028683 2:118720341-118720363 CAGAATAGCTGGAGCAGGGAGGG - Intergenic
937184208 2:120024544-120024566 CAGAATGGCATGAACCTGGGAGG - Intronic
937673997 2:124568956-124568978 AAGAATGGCATGAGCCTGGGAGG + Intronic
938321650 2:130370226-130370248 CAGAGGGGACAGAGCATGGAGGG + Intronic
938411622 2:131069581-131069603 GAGAATGGCCAGAACCTGGAAGG - Intronic
938452373 2:131433371-131433393 GAGAATGGCATGAACCTGGAAGG + Intergenic
938606965 2:132904196-132904218 GAGAATGGCATGAACATGGGAGG + Intronic
939118027 2:138083655-138083677 AAGAAAGGCAAGAACATGGATGG - Intergenic
939489203 2:142856503-142856525 GAGAATGGCATGAGCCTGGGAGG + Intergenic
939635295 2:144575111-144575133 CAGAATGGTAGGAGCATGCATGG + Intergenic
939750883 2:146044855-146044877 GAGAATGGCATGAACCTGGAAGG - Intergenic
939968139 2:148631041-148631063 GAGAATGGCATGAACCTGGAAGG - Intergenic
940068926 2:149662703-149662725 TAGAATGGCAAGACCAAGCAAGG - Intergenic
940516047 2:154685104-154685126 CAGAATGGTAAGAGAAGGGGTGG - Intergenic
940640953 2:156343320-156343342 CAGAATTGCCTGAGTATGGAAGG - Intergenic
941481416 2:166019998-166020020 GAGAATGGCATGAGCCTGGGAGG - Intronic
941538868 2:166757600-166757622 AAGAATGGCTTGAGCATGGGAGG + Intergenic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
941726996 2:168871500-168871522 CAGAATTTCAAGAGAATGTAAGG - Exonic
942770257 2:179509034-179509056 GAGAATGGCATGAGCCTGGGAGG - Intronic
943349837 2:186784646-186784668 GAGAATGGCATGAACCTGGAAGG + Intergenic
944136636 2:196406680-196406702 CAGAGTGGCTGGAGCATGGCGGG - Intronic
944442386 2:199755409-199755431 CAGAATGGCAAGGTGAGGGAAGG + Intergenic
945075844 2:206038741-206038763 CAGGATGGCTTGAGCCTGGAAGG + Intronic
945654568 2:212607470-212607492 AAGAATGGCTGAAGCATGGAAGG - Intergenic
946176977 2:217928164-217928186 AAGAATGCCAAGGCCATGGAGGG + Intronic
946380371 2:219344189-219344211 GAGAATGGCAAGAACCTGGGAGG - Intergenic
947180423 2:227406446-227406468 CAGCCTGGCAGGAGCTTGGAGGG + Intergenic
947282217 2:228468282-228468304 GAGAATGGCATGAACCTGGAAGG - Intergenic
947739574 2:232479017-232479039 CAGAATGACAAGAGCTGGGCTGG + Intergenic
948472442 2:238192608-238192630 CAGAATGGCATGAACCTGGGAGG + Intronic
948648081 2:239421436-239421458 GAGAATGGCATGAACATGGGAGG + Intergenic
948968654 2:241406216-241406238 GAGAATGGCATGAACCTGGAAGG + Intronic
1168842926 20:921260-921282 CAACATGGCAAGAGCCTGGTGGG + Intergenic
1169401080 20:5281316-5281338 CAAAATGGTAAGAGCATAGTTGG + Intergenic
1169735554 20:8833878-8833900 AGGATGGGCAAGAGCATGGAAGG - Intronic
1170205065 20:13789563-13789585 GAGAATGGCATGAACCTGGAAGG - Intronic
1170217318 20:13905401-13905423 CAGAATGGCATGAACCTGGGAGG - Intronic
1170364260 20:15582412-15582434 GAAAATGCCAAGAGCTTGGAAGG - Intronic
1170937094 20:20819850-20819872 GAGGATGGCATGAGCCTGGAAGG + Intergenic
1172001448 20:31781353-31781375 GAGAATGGCATGAACCTGGAAGG - Intronic
1172055036 20:32148758-32148780 GAGAATGGCATGAACCTGGAAGG - Intronic
1172346744 20:34207877-34207899 GAGAATGGCATGAACCTGGAAGG - Intronic
1173185596 20:40837508-40837530 CAGCATGGCTGGAACATGGAGGG - Intergenic
1173381457 20:42546781-42546803 GAGAATGACAGGAGAATGGATGG + Intronic
1173567952 20:44055328-44055350 GAGAGTGGAAAGAGCAGGGACGG + Intronic
1173837168 20:46133583-46133605 GAGAATGGCATGAACCTGGAAGG - Intergenic
1174119732 20:48254278-48254300 CAGAATTGCTTGAGCCTGGAAGG + Intergenic
1174307660 20:49625851-49625873 CATAATAGCAATAACATGGAAGG - Intergenic
1174493939 20:50925557-50925579 CACAATGGGCAAAGCATGGACGG + Intronic
1174578368 20:51553583-51553605 GAGAATGGCATGAACCTGGAAGG + Intronic
1174631877 20:51965387-51965409 GAGAATGGCATGAACCTGGAAGG + Intergenic
1174665067 20:52250416-52250438 GAGAATGGCATGAACCTGGAAGG - Intergenic
1174861774 20:54098022-54098044 CTGAGTGCCAAGAGCAGGGAAGG + Intergenic
1175097687 20:56554454-56554476 GAGAATGGCTTGAGCATGGGAGG + Intergenic
1175287378 20:57845911-57845933 GGAAATGGCAAGGGCATGGATGG + Intergenic
1176792482 21:13335122-13335144 GAGAATGGCAAGAACCTGGGAGG - Intergenic
1177649468 21:23941707-23941729 GAGAATGGCATGAACCTGGAAGG + Intergenic
1178027002 21:28479409-28479431 CAAAATGTCAAGACCAAGGATGG - Intergenic
1178082727 21:29081461-29081483 GAGAATGGCATGAGCCTGGGAGG + Intronic
1178550388 21:33533347-33533369 CAGAATGGCATGAACCTGGGAGG + Intronic
1178786153 21:35655595-35655617 GAGAATGGCAAGAACCTGGGAGG + Intronic
1178956067 21:37023102-37023124 CAGAATGGCATGAACCTGGGAGG - Intergenic
1179137461 21:38692739-38692761 GAGAATGGCATGAGCCTGGGAGG + Intergenic
1180150250 21:45943635-45943657 CAAAATGGGATGATCATGGAAGG + Intergenic
1180204669 21:46251180-46251202 CAGAATGGCAAGAGCATGGATGG + Intronic
1180226689 21:46397697-46397719 GAGCATGGCAAGACCATGGGAGG - Intronic
1180452106 22:15472924-15472946 GAGAATGGCATGAACATGGGAGG + Intergenic
1181263846 22:21618473-21618495 GAGAATGGCATGAGCCTGGGAGG + Intronic
1181422726 22:22812879-22812901 CAGGATGGCAAAAACATGTAAGG - Intronic
1181715847 22:24727558-24727580 CACAATGACATGAGCTTGGAAGG + Intronic
1182953934 22:34403191-34403213 CAGTATGGCTAGAGCATAGCGGG - Intergenic
1183567379 22:38625297-38625319 GAGAATGGCAAGAACCCGGAAGG + Intronic
1183916958 22:41128595-41128617 GAGAATGGCATGAACCTGGAAGG - Intronic
1184364559 22:44041793-44041815 GAGAATGGCTTGAGCATGGAAGG + Intronic
1185130239 22:49034898-49034920 CAGGATGGGGAGAGCATGGCAGG + Intergenic
1185303867 22:50101303-50101325 GAGAATGGCATGAACCTGGAAGG - Intronic
949479157 3:4477040-4477062 AAGGATGCCAAGAGGATGGAGGG - Intergenic
949812798 3:8025108-8025130 GAGAATGGCATGAACCTGGAAGG + Intergenic
950071095 3:10153186-10153208 GAGAATGGCATGAACCTGGAAGG + Intergenic
950222114 3:11204506-11204528 GTGTATGGCCAGAGCATGGAAGG + Intronic
950959356 3:17088777-17088799 CAAAATGTCAAGAGCAAAGAGGG + Intronic
951225205 3:20112691-20112713 CAGAATGGCATGGGGAAGGAAGG - Intronic
951670156 3:25172298-25172320 CAGAGGGGCAAGAGCAGAGAAGG + Intergenic
952053958 3:29421021-29421043 GAGAATGGCATGAACCTGGAAGG + Intronic
952833991 3:37588860-37588882 CAGAAAGGCAAGAGCAGGACAGG - Intronic
953495546 3:43383362-43383384 GAGAATGGCGTGAACATGGAAGG + Intronic
954057365 3:48038548-48038570 GAGAATGGCATGAACCTGGAAGG - Intronic
954241354 3:49296236-49296258 CAGAATGGCATGAACCTGGGAGG + Intronic
954387366 3:50251204-50251226 CAGAAGGGCAAGAGGGTGGAGGG - Intronic
954605350 3:51905018-51905040 CAGAATGGCATGAACCTGGGAGG + Intergenic
954967588 3:54625024-54625046 CAGGATGCCAAGTGCATGGCAGG - Intronic
955774661 3:62420531-62420553 CAGATTGGGGAGAGCATGGCAGG + Intronic
957091465 3:75734520-75734542 GAGAATGGCATGAACCTGGAAGG - Intronic
957797050 3:85022687-85022709 CAGAATTCAAAGAGCAGGGAGGG - Intronic
959087485 3:101866905-101866927 CACATTGGCAGGATCATGGATGG - Intergenic
959728944 3:109578256-109578278 CAGAAGGGTGAGAGCATGGGAGG - Intergenic
960537538 3:118829927-118829949 CAGAATGGCATAAGCTTAGAAGG + Intergenic
960697166 3:120407407-120407429 CCAAATTCCAAGAGCATGGAAGG + Intronic
962314195 3:134348836-134348858 CAGAAGGGCAAGACCAGGGTGGG - Intergenic
962356984 3:134703204-134703226 GAGAATGGCATGAACCTGGAAGG + Intronic
963164214 3:142184169-142184191 GAGAATGGCATGAGCCTGGAAGG + Intronic
963220922 3:142811179-142811201 GAGAATGGCATGAACCTGGAAGG + Intergenic
963512285 3:146262598-146262620 CAGAATGGAGAGGTCATGGAAGG - Intergenic
964055495 3:152451380-152451402 CAGAATGATAGGAGGATGGATGG - Intronic
964719200 3:159755143-159755165 GAGAATGGCAAGAACCTGGGAGG + Intronic
965672662 3:171162332-171162354 GAGAATGGCATGAACCTGGAAGG + Intronic
965759726 3:172062770-172062792 CAAAATGAGAAGAGGATGGATGG - Intronic
966261847 3:177987702-177987724 CATAATTGAAAGAGCATGGATGG - Intergenic
966680191 3:182633690-182633712 CAGAAAGAAAAGAGCCTGGAGGG + Intergenic
966937584 3:184722531-184722553 GAGAATGGCATGAACATGGGAGG + Intergenic
967791827 3:193558061-193558083 CAGAGTGACAATAACATGGAAGG + Intronic
968015868 3:195332042-195332064 GAGAATGGCAAGAACCTGGGAGG + Intronic
968099790 3:195956830-195956852 CTGAATTGCAAGATCATGGGTGG + Intergenic
968247231 3:197164305-197164327 GAGAATTGCTAGAGCCTGGAAGG + Intronic
968700529 4:2055230-2055252 GAGAATGGCATGAACATGGGAGG + Intergenic
970497566 4:16642158-16642180 CAGAAAGCCAAGTGCTTGGAGGG + Intronic
970536151 4:17031448-17031470 GAGAATGGCATGAGCCTGGGAGG + Intergenic
970757073 4:19439232-19439254 GAGAATGGCATGAGCCTGGGAGG + Intergenic
970831086 4:20340688-20340710 GAGAATGGCATGAACCTGGAAGG - Intronic
970925639 4:21448689-21448711 CAGAAGGCCAAGGGTATGGAGGG + Intronic
972506309 4:39723456-39723478 CAGAATGGCATGAACCTGGGAGG - Intronic
972584592 4:40425937-40425959 CTGAATGGCAGCAGCAGGGAAGG + Exonic
973157615 4:46976515-46976537 AAGCATGGCAAAAGCATGGTAGG - Intronic
973230543 4:47835776-47835798 CACAATAGCAACAGCATAGAAGG - Intronic
973672439 4:53235035-53235057 CAGAATGGCAGGAGCAGGAGTGG - Intronic
973894744 4:55400525-55400547 GAGAATGGCGTGAGCCTGGAAGG - Intronic
974533731 4:63147187-63147209 CAGAATGGCATGAACCTGGAAGG - Intergenic
974863760 4:67554547-67554569 GAGAATGGCATGAGCCTGGGAGG + Intergenic
974879272 4:67734004-67734026 TAGAATGGCAAGAGTAAGGCAGG + Intergenic
976143619 4:82019545-82019567 CAGAAAGGAAAGAGAAAGGAGGG + Intronic
976264587 4:83178569-83178591 GAGAATGGCATGAACCTGGAAGG - Intergenic
977127327 4:93186556-93186578 TAGAGTGGGAAGAGCATGTAGGG - Intronic
978315334 4:107429395-107429417 CACAATGGCAAGTGCCTGCAAGG + Intergenic
978852185 4:113352318-113352340 CAGAATGGACAGACCAAGGAGGG - Intronic
978883946 4:113743928-113743950 GAGAATGGCATGAACCTGGAAGG - Intronic
980138979 4:128893630-128893652 GAGAATGGCATGAGCCTGGGAGG - Intronic
980884889 4:138751862-138751884 GAGAATGGCATGAACCTGGAAGG + Intergenic
981326699 4:143456365-143456387 GAGAATGGCATGAGCCTGGGAGG + Intronic
981370659 4:143955317-143955339 CAGAAGTGCAGGAGGATGGAGGG - Intergenic
981380425 4:144065251-144065273 CAGAAGTGCAGGAGGATGGAGGG - Intergenic
983427790 4:167609217-167609239 CAGAGGGGCAAGAGCATACAGGG - Intergenic
983518501 4:168681435-168681457 AAGAATGGCAACAGAATGGTTGG + Intronic
983525348 4:168755141-168755163 GAGAATGGCATGAGCCTGGGAGG + Intronic
983964975 4:173798926-173798948 AAAATTGGCAACAGCATGGATGG - Intergenic
983974128 4:173911824-173911846 TGGAATGGCAAGAGCAGAGATGG + Intergenic
984418472 4:179489804-179489826 GAGAATGGCATGAACCTGGAAGG + Intergenic
984570271 4:181383658-181383680 CAGATTGTAAAGAGCAAGGATGG - Intergenic
984800898 4:183716207-183716229 AAGAATGGCATGAGTATGGCCGG - Intergenic
985095885 4:186413044-186413066 GAGAATGGCATGAACCTGGACGG - Intergenic
985201703 4:187490771-187490793 GAGAATGGCAAGAACCTGGGAGG + Intergenic
986727275 5:10608389-10608411 CTGAAGGGGAAGAGCAAGGAAGG + Intronic
987388502 5:17353063-17353085 GAGGATGGCATGAGCCTGGAAGG + Intergenic
988158228 5:27482831-27482853 CAAAATGGCAAATGCATAGAGGG + Intergenic
988572024 5:32377064-32377086 GAGAATGGCAAGAACCTGGGAGG + Intronic
988955239 5:36309853-36309875 GAGAATTGCATGAGCCTGGAAGG - Intergenic
989019964 5:36992830-36992852 GAGAATGGCATGAGCCCGGAAGG - Intronic
990376638 5:55176879-55176901 CAGTATAGCGAGAGCATGGATGG + Intergenic
991473909 5:66999544-66999566 CAGAATGGGAAGAGAATGCAAGG - Intronic
991504449 5:67309479-67309501 CAGAAGAGCAAGCACATGGATGG - Intergenic
992728517 5:79634064-79634086 GAGAATGGCATGAACCTGGAAGG + Intronic
993040728 5:82811574-82811596 CAGAATGGCAAGACGATGAGAGG - Intergenic
993375464 5:87145091-87145113 GAGAATGGCATGAACCTGGAAGG - Intergenic
994639802 5:102393370-102393392 CAGAATGTAATGAGCATGGAGGG - Intronic
994734638 5:103537618-103537640 GAGAATGGCAAGAACCTGGGAGG - Intergenic
994951746 5:106472149-106472171 GAGAATGGCATGAACCTGGAAGG + Intergenic
995026487 5:107429354-107429376 AAGAATGGCACGAACCTGGAAGG + Intronic
996051856 5:118943459-118943481 GAGAATGGCATGAACCTGGAAGG + Intronic
996259967 5:121455395-121455417 GAGAATGGCATGAACATGGGAGG - Intergenic
996753616 5:126914071-126914093 GAGAATGGCAAGAACCTGGATGG - Intronic
997062064 5:130518460-130518482 GAGAATGGCATGAGCCTGGGAGG - Intergenic
997179040 5:131808971-131808993 CAGAATCGCTGGAGCCTGGAAGG + Intronic
998055793 5:139075968-139075990 CAAGATACCAAGAGCATGGATGG - Intronic
998271260 5:140708738-140708760 CAGAATGGCATGAACCAGGAAGG - Intergenic
998293253 5:140937820-140937842 GAGAATGGCATGAACCTGGAAGG + Intronic
1000038126 5:157464274-157464296 CAGAATGGCAGGAGCAGGAGGGG + Intronic
1001088293 5:168717748-168717770 CAGAATGGCATGAACCTGGGAGG - Intronic
1001209242 5:169794831-169794853 CAGAATGGCATGAACCTGGGAGG + Intronic
1001560815 5:172667884-172667906 CAGAATGGTGGGAGCAAGGAGGG - Intronic
1002082546 5:176746072-176746094 CAGATGGGCAAGAGAGTGGAAGG + Intergenic
1003884802 6:10512156-10512178 CAGACTTGGAAGAGCAAGGAAGG + Intronic
1003954209 6:11146986-11147008 CAGAGTGGCAACACCATGTAAGG + Intergenic
1004738706 6:18434709-18434731 CAGAATGGCATGAACCTGGGAGG - Intronic
1004947162 6:20628716-20628738 GAAAATTGCAAGAGCATGGAAGG - Intronic
1005262414 6:24075566-24075588 GAGAATGGCATGAGCACGGGAGG - Intergenic
1006452131 6:34111492-34111514 CAGGATGGCAAGATCAGGGGTGG - Intronic
1007743826 6:44030011-44030033 AAGAAAGGCAAGAGCAAGGCGGG - Intergenic
1007849773 6:44791947-44791969 CAGAGTGGGTAGAGCAGGGAGGG - Intergenic
1008405051 6:51109713-51109735 CAGAATGGCATGAACCTGGGAGG - Intergenic
1008558378 6:52697818-52697840 CAGAATGGCAACAGTAAGGCTGG + Intergenic
1008683076 6:53895005-53895027 GAGAATGGCATGAACCTGGAAGG - Intronic
1009796786 6:68479525-68479547 GAGAATGGCGGGAGCATAGAAGG + Intergenic
1010866407 6:80981325-80981347 CATTATTGCAAGGGCATGGAGGG - Intergenic
1011145580 6:84211435-84211457 CAGAATGGCATGAGCCCGGGAGG + Intronic
1011247128 6:85331386-85331408 CAGAATGGCATGAACCTGGGAGG - Intergenic
1011409303 6:87050246-87050268 CAGAATGTCAGGAGCCAGGAAGG + Intergenic
1011976168 6:93302196-93302218 CTGAATAGCAACAGCTTGGAGGG - Intronic
1012204729 6:96446692-96446714 CAAACTGGCAAGTGCATTGAAGG + Intergenic
1012272927 6:97236859-97236881 GAGAATGGCAAGAACCTGGGAGG + Intronic
1012492215 6:99794834-99794856 AAAAATGGGAAGAGAATGGAAGG + Intergenic
1012899983 6:104994092-104994114 GAGAATGGCATGAACCTGGAAGG - Intronic
1013492114 6:110658141-110658163 CAGCAAGACAGGAGCATGGATGG + Intronic
1013702239 6:112786603-112786625 CATAATTGGAAGAGCTTGGAAGG + Intergenic
1013783594 6:113755139-113755161 GAGAATGGCAAGAACCTGGGAGG + Intergenic
1013880645 6:114895635-114895657 CAGAATGGCATGAACCTGGGAGG - Intergenic
1014104983 6:117551467-117551489 CAGAATGGCATGAACCTGGGAGG - Intronic
1014863796 6:126504263-126504285 GAGAATGGCATGAGCCTGGGAGG - Intergenic
1015630887 6:135230818-135230840 AGGAATGGGAAGAGGATGGAAGG - Intergenic
1016435510 6:144033119-144033141 CAAAATGGGAAGAGCATGCTAGG + Intronic
1017079074 6:150649920-150649942 CAGAATGGCGTGAGCCTGGGAGG + Intronic
1017535012 6:155337840-155337862 CAGAATGGCATGAACCCGGAAGG + Intergenic
1017959979 6:159213169-159213191 CAGCAAGGCCAGAGCCTGGAAGG + Intronic
1019174726 6:170154265-170154287 CAGAAGAGCACGACCATGGAGGG - Intergenic
1019284479 7:216575-216597 CAGGCTGGAAAGAGCAGGGAGGG - Intronic
1019328457 7:451149-451171 CAGGAGGGCAGGAGCATGGGAGG - Intergenic
1019420889 7:950394-950416 GAGAATGGCATGAGCCTGGGAGG + Intronic
1020093190 7:5352807-5352829 CAAAATGGCGTGAGCATGGCGGG - Intronic
1020117548 7:5484379-5484401 GAGAATGGCATGAACCTGGAAGG + Intronic
1020274605 7:6616434-6616456 CAGGAAGGCAATAGAATGGAAGG + Intronic
1021045908 7:15923194-15923216 GAGAATGGCATGAACATGGGAGG + Intergenic
1021529389 7:21626838-21626860 AAGAATGGCATGAACCTGGAAGG - Intronic
1021720296 7:23498356-23498378 AAGAATGGCATGAACCTGGAAGG + Intergenic
1021747872 7:23761508-23761530 CAGAATGGCACGAACCCGGAAGG - Intronic
1021839924 7:24714121-24714143 CAGAAGGTCAAGAGAATGAAAGG + Intronic
1022045166 7:26616947-26616969 CAGGAAGGCAGGAGCATGGGTGG + Intergenic
1023313850 7:38915176-38915198 CAGAATGGCATGAGCCTGGGAGG + Intronic
1023730447 7:43186577-43186599 GAGAATGGCATGAACCTGGAAGG + Intronic
1024329927 7:48145481-48145503 CAGAATTGGAAGGGCCTGGAAGG - Intergenic
1024549445 7:50549562-50549584 CAGAATGGCATGAACCTGGGAGG + Intronic
1025220308 7:57102312-57102334 GAGAATGGCAAGAACCTGGGAGG - Intergenic
1025631088 7:63273897-63273919 GAGAATGGCAAGAACCTGGGAGG - Intergenic
1025631217 7:63274800-63274822 GAGAATGGCAAGAACCTGGGAGG - Intergenic
1025651377 7:63472693-63472715 GAGAATGGCAAGAACCTGGGAGG + Intergenic
1025914526 7:65854999-65855021 GAGAATGGCAAGAACCTGGGAGG + Intergenic
1026039300 7:66853761-66853783 GAGAATGGCATGAGCCTGGGAGG + Intergenic
1026265198 7:68790411-68790433 GAGAATGGCATGAACCTGGAAGG - Intergenic
1027124947 7:75549757-75549779 GAGAATTGCTTGAGCATGGAAGG - Intronic
1027305618 7:76893215-76893237 GAGAATGGCATGAACCTGGAAGG - Intergenic
1027530839 7:79330281-79330303 AAGAATGGCATGAACCTGGAAGG - Intronic
1028138894 7:87250161-87250183 AAGAATGACAAAAGCATGCAAGG - Intergenic
1028510582 7:91621017-91621039 GGGAGTGGCCAGAGCATGGAGGG - Intergenic
1029441550 7:100589689-100589711 CAGGAGGGCAGGAGCAGGGAGGG + Exonic
1029926017 7:104317981-104318003 CAGACTGGTGAGGGCATGGATGG - Intergenic
1030338548 7:108351192-108351214 CAGAAGGGCAAGAGAGAGGAGGG - Intronic
1030632237 7:111908356-111908378 GAGGATGGCATGAACATGGAAGG + Intronic
1031785139 7:126021044-126021066 GAGAATGGCAAGAACCTGGGAGG - Intergenic
1032340703 7:131070010-131070032 GAGAATGGCATGAACCTGGAAGG + Intergenic
1032589837 7:133181893-133181915 CAGAATGCTCAGGGCATGGAAGG - Intergenic
1033680862 7:143595322-143595344 CAGAATGGCATGAACCTGGGAGG - Intergenic
1033704030 7:143866491-143866513 CAGAATGGCATGAACCTGGGAGG + Intronic
1034043978 7:147908142-147908164 CAGCAGGTCAAGAGCATGAAGGG - Intronic
1034642282 7:152613848-152613870 GAGAATGGCATGAACCTGGAAGG - Intergenic
1035965289 8:4185047-4185069 GAGAATGGCTAGAGCCTGGGAGG + Intronic
1036516535 8:9449691-9449713 GAGAATGGCGTGAACATGGAAGG - Intergenic
1036573962 8:10007148-10007170 GAGAATGGCATGAACATGGGAGG + Intergenic
1036589410 8:10154465-10154487 GAGAATGGCATGAACCTGGAAGG - Intronic
1037448007 8:18987375-18987397 GAGAATGGCGTGAGCCTGGAAGG - Intronic
1037523600 8:19703391-19703413 GAGAATGGCATGAACCTGGAAGG - Intronic
1037669195 8:20999795-20999817 CACAATGGCAAGGGCTTGGCAGG + Intergenic
1037895268 8:22648043-22648065 GAGAATGGCATGAGCCTGGGAGG + Intronic
1038006665 8:23436387-23436409 CAGAATGGAGAGAGGATGGTGGG + Intronic
1038189497 8:25306602-25306624 GAGAATGGCATGAACCTGGAAGG + Intronic
1038354147 8:26811280-26811302 GAGAATGGCGTGAGCCTGGAAGG - Intronic
1038774822 8:30519571-30519593 GAGAATGGCATGAACCTGGAAGG - Intronic
1038944792 8:32346917-32346939 GAGAATGGCATGAACCTGGAAGG - Intronic
1039122488 8:34162912-34162934 CAGAAGTGTAAGAACATGGAAGG + Intergenic
1039449180 8:37657944-37657966 AAGATTGGAAAGAGCAAGGAAGG + Intergenic
1040034786 8:42859535-42859557 CAGGATGGCCTGAGCTTGGAAGG + Intronic
1041217095 8:55611566-55611588 GAGAATGGCATGAACCTGGAAGG - Intergenic
1042109337 8:65363448-65363470 GAGAATGGCATGAACCTGGAAGG - Intergenic
1042216017 8:66430053-66430075 CAGAAGGGCAAGAGAAAGGGAGG + Exonic
1042763718 8:72297987-72298009 GAGAATGGCATGAACCTGGAAGG + Intergenic
1043089958 8:75887466-75887488 CAGAAACCCTAGAGCATGGATGG - Intergenic
1043810546 8:84733654-84733676 CAGACTGGCAGGAACAGGGAGGG - Intronic
1043880389 8:85535793-85535815 TTGAATGGGAAGAGGATGGATGG + Intergenic
1043968222 8:86503260-86503282 GAGAATGGCTAGAACCTGGAAGG + Intronic
1044579171 8:93805489-93805511 CAGAATGGCATGAACCTGGGAGG + Intronic
1045815303 8:106270809-106270831 CAGAACGGCAGGAGGATGGGTGG + Intronic
1045941445 8:107743372-107743394 CAGAATGGCATGAACCTGGGAGG + Intergenic
1046618300 8:116501178-116501200 GAGAATGGCATGAGCCTGGGAGG - Intergenic
1047541780 8:125774638-125774660 CTGAATGGCAGGAGGATGGAGGG - Intergenic
1048513706 8:135085964-135085986 GGAAAGGGCAAGAGCATGGAAGG - Intergenic
1048881437 8:138875757-138875779 CAGAATGCTGAGATCATGGAAGG - Intronic
1050523022 9:6521549-6521571 CAGAATGGCATGAACCTGGGAGG - Intergenic
1051078484 9:13268791-13268813 CAGAATGACAGGAGCTAGGAAGG + Intronic
1051087214 9:13363550-13363572 GAGAATGGCATGAACTTGGAAGG + Intergenic
1052442462 9:28515294-28515316 GAGAATGGCATGAGCCTGGGAGG - Intronic
1052770337 9:32682605-32682627 AAGAATGGCATGAACCTGGAAGG + Intergenic
1053460004 9:38261445-38261467 GAGAATGGCAAGAACCTGGAAGG - Intergenic
1053817998 9:41934306-41934328 GAGAATGGCATGAACCTGGAAGG - Intronic
1054108251 9:61077954-61077976 GAGAATGGCATGAACCTGGAAGG - Intergenic
1054612606 9:67253171-67253193 GAGAATGGCATGAACCTGGAAGG + Intergenic
1055196463 9:73600117-73600139 GAGAATGGCGAGAACATGGGAGG + Intergenic
1055326152 9:75132219-75132241 CTGGAGGGCAAGAGAATGGAAGG + Intronic
1056472035 9:86915052-86915074 GAGAATGGAAAGAGGAAGGAAGG + Intergenic
1056796282 9:89660905-89660927 CAGCACCTCAAGAGCATGGAGGG - Intergenic
1057150715 9:92793796-92793818 CACAGTGGCAACAGCATGCATGG + Intergenic
1057735846 9:97659338-97659360 CAAAATGGAAGGATCATGGAGGG - Intronic
1057821479 9:98334632-98334654 GAGAAGGGCAAGAGTATGGGTGG + Intronic
1058031957 9:100209678-100209700 AAGAATGGCATGAACCTGGAAGG + Intronic
1058906638 9:109487319-109487341 CACTGTGGCAAGAGCAGGGAGGG + Intronic
1058944848 9:109846589-109846611 TTGAATGTCCAGAGCATGGAGGG - Intronic
1058984501 9:110198477-110198499 CAAAATGCCAAGAGCCTGGATGG - Intronic
1059716563 9:116918472-116918494 CAGAATGGCATGAGAATTCAGGG - Intronic
1060327464 9:122631264-122631286 GAGAATGGCATGAACTTGGAAGG - Intergenic
1060837725 9:126769436-126769458 CAGAATGGCGTGAACATGGGAGG + Intergenic
1062071451 9:134557216-134557238 GGGAATTGCAAGAGCATGCAGGG + Intergenic
1062311555 9:135940488-135940510 GAGAATGGCATGAACCTGGAAGG + Intronic
1062679818 9:137772935-137772957 CAGAACGGCAGGAGAATGTAAGG - Intronic
1186616719 X:11196042-11196064 GAGAATGGCATGAACCTGGAAGG + Intronic
1186859770 X:13660932-13660954 GAGAATGGCATGAACCTGGAAGG - Intronic
1186996164 X:15125419-15125441 CAAAATGGCAAGTACAAGGAAGG + Intergenic
1187894738 X:23970144-23970166 GAGAATGGCATGAACCTGGAAGG - Intergenic
1189124469 X:38431643-38431665 CAGAGTGGCAACAGAATGCAAGG - Intronic
1189161940 X:38818102-38818124 CAGAATGTCAAGATCATGAAAGG + Intergenic
1189352979 X:40290907-40290929 GAGAAGGGGAAGAGCAGGGAGGG + Intergenic
1190319799 X:49173295-49173317 CACAATGGCAAGACCAGGGAGGG + Intronic
1190786728 X:53657957-53657979 GAGAATGGCATGAGCCTGGGAGG + Intronic
1191061688 X:56304587-56304609 GAGAATGGCGAGAACATGGGAGG + Intergenic
1191122430 X:56920535-56920557 CAGAATGGCACTCGCATGTATGG + Intergenic
1191887254 X:65901400-65901422 CAGAATGGAAAGATCAGTGAGGG + Intergenic
1193565056 X:83065826-83065848 CAGAATGGCAAGAACAAAGCAGG - Intergenic
1194398284 X:93412701-93412723 AAGAATGGCACAAGCATGGTTGG + Intergenic
1194823688 X:98534713-98534735 GAGAATGGCAAGAACCTGGGAGG + Intergenic
1195272068 X:103242036-103242058 GAGAAGGGCAAGAACCTGGAGGG - Intergenic
1195666090 X:107432668-107432690 CAAAACGGTAAGAGCAGGGATGG + Intergenic
1195812342 X:108848169-108848191 GAGAATGGCATGAGCCTGGGAGG + Intergenic
1196382486 X:115106556-115106578 AAGAATAGCAAGAAAATGGACGG + Intergenic
1196705627 X:118715126-118715148 GAGAATGGCATGAACCTGGAAGG + Intergenic
1197195964 X:123700819-123700841 CACAATGCCTAGAACATGGAAGG + Intronic
1197441912 X:126501930-126501952 GAGAATGGCATGAACCTGGAAGG - Intergenic
1197777671 X:130129969-130129991 CCGAATGCCAATAGCAAGGAAGG - Exonic
1198073535 X:133172717-133172739 CAGTATGGCTAGAACAGGGATGG + Intergenic
1198602947 X:138304460-138304482 GAAAATGGCAAGAGCATAGGAGG + Intergenic
1198740945 X:139842119-139842141 GAGAATGGCGTGAGCCTGGAAGG - Intronic
1198873013 X:141195255-141195277 GAGAATGGCATGAACCTGGAAGG + Intergenic
1200321361 X:155193682-155193704 CAGAATGGCATGAACCTGGGAGG + Intergenic
1200827846 Y:7661507-7661529 GAGAATGGCATGAACATGGGAGG - Intergenic
1201342199 Y:12946741-12946763 CAGGATGGTGACAGCATGGAGGG + Intergenic