ID: 1180207381

View in Genome Browser
Species Human (GRCh38)
Location 21:46269600-46269622
Sequence CTGGAGCCACAGATCAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180207376_1180207381 3 Left 1180207376 21:46269574-46269596 CCCTGATGTGTGACCAAAGAAAT 0: 1
1: 0
2: 4
3: 29
4: 221
Right 1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG 0: 1
1: 0
2: 1
3: 19
4: 158
1180207377_1180207381 2 Left 1180207377 21:46269575-46269597 CCTGATGTGTGACCAAAGAAATG 0: 1
1: 0
2: 5
3: 29
4: 211
Right 1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG 0: 1
1: 0
2: 1
3: 19
4: 158
1180207379_1180207381 -10 Left 1180207379 21:46269587-46269609 CCAAAGAAATGACCTGGAGCCAC 0: 1
1: 1
2: 5
3: 26
4: 184
Right 1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG 0: 1
1: 0
2: 1
3: 19
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180207381 Original CRISPR CTGGAGCCACAGATCAACCA AGG Intronic
900379452 1:2376613-2376635 CCGCAGCCCCAGACCAACCATGG - Intronic
902610340 1:17593445-17593467 CTGGGCCCACAGATAACCCAGGG - Intronic
903060226 1:20664061-20664083 CTTGGGCCACAGACCAGCCAGGG + Exonic
903296042 1:22343661-22343683 CTGCAGCCACAGATGTGCCAAGG - Intergenic
903484041 1:23676495-23676517 CTGGAGGGACAGAGCACCCAGGG - Intergenic
903884028 1:26530762-26530784 CTGGAGCCACAGAGCCCTCAAGG - Intronic
903884283 1:26531887-26531909 CAGGAGCCACAGGGCAGCCACGG + Intronic
904152980 1:28458354-28458376 CAGGAGCTTGAGATCAACCAGGG - Intronic
904214074 1:28905608-28905630 CTGGAGTCAGAGATCAGGCATGG - Intronic
905880467 1:41460021-41460043 ATGCAGCCACAGGACAACCAGGG - Intergenic
906273269 1:44498023-44498045 CTGGAGCCATGGATCAGCCATGG + Intronic
908382092 1:63606403-63606425 ATGGAGCCACACATCAGCCCTGG - Intronic
910710611 1:90175998-90176020 CTGGAGCCAGATAACAAGCATGG - Intergenic
912159835 1:106968271-106968293 CTTGAGCCATAGATGAACGATGG + Intergenic
912635143 1:111284920-111284942 CTGGAGCCACAGCTCAGCCTTGG + Intergenic
918403166 1:184184795-184184817 CTGGAGGCACATATACACCATGG - Intergenic
920689144 1:208132346-208132368 CTGCAGCCACAGGGCAGCCAGGG + Intronic
922185593 1:223271523-223271545 GAGGAGCCACATATCAACTAGGG + Intronic
923261721 1:232274008-232274030 CTGGACCCACACATTAACAACGG - Intergenic
924018280 1:239752002-239752024 CTTGAGCCACAGAACTACAAAGG - Intronic
924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG + Intergenic
924723377 1:246644577-246644599 CTGGAGCCACCGCACAACCTGGG - Intronic
1064087423 10:12355837-12355859 CTGGAGCCACAGAAAATACAAGG + Intronic
1064496429 10:15915356-15915378 CTGAATCCAAAGATCAACTAGGG + Intergenic
1065841160 10:29702440-29702462 ATGGACCCACAGAGCAGCCACGG + Intronic
1068338575 10:55670422-55670444 CTTTAGTCACAGATCAACAAAGG + Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1072251743 10:93587176-93587198 CTGGAGCCACAGGTGACCGAGGG - Intronic
1075449067 10:122535257-122535279 CTTGAGCCACAGTTCTTCCAGGG + Intergenic
1076281957 10:129253961-129253983 CGGGAGCCACAGAGCAACTCTGG + Intergenic
1077220297 11:1412774-1412796 CTGGCTGCACAGATCAACCCAGG + Intronic
1077326372 11:1965766-1965788 CTGGAGCCACAGAACGCCCATGG + Intronic
1083006877 11:59355335-59355357 CAGGAGTCACAGCTCAGCCAAGG + Intergenic
1083570791 11:63761453-63761475 CAGGAGTCACAGATCCACCGTGG + Exonic
1083700371 11:64473488-64473510 GTGGAGCCACAGAGACACCAGGG - Intergenic
1084312880 11:68326888-68326910 CTGAAGCCACACAGCAACCTAGG - Intronic
1084790016 11:71469043-71469065 CTGAATCCACAGATCAACTTAGG - Intronic
1085022587 11:73218618-73218640 GTGGAGACAAAGTTCAACCACGG - Intronic
1089586544 11:119513183-119513205 CTGGAGGCACAGAGACACCAGGG - Intergenic
1202809353 11_KI270721v1_random:20945-20967 CTGGAGCCACAGAACGCCCATGG + Intergenic
1092006496 12:5074588-5074610 ATGGAGCCACCGATGAGCCAGGG + Intergenic
1097042756 12:56165486-56165508 CTGGAGCCACAGCCAAGCCATGG + Exonic
1099656384 12:85497719-85497741 ATGGAGGCACAGATCAACACAGG - Intergenic
1101197638 12:102401506-102401528 CTGGAGCCAAAGATGACACAAGG - Intronic
1101834538 12:108286291-108286313 CTGCAGCCTCAGATGAGCCATGG - Intergenic
1103088736 12:118082287-118082309 CTGGAACCACCATTCAACCACGG + Exonic
1103896150 12:124274540-124274562 CTGGGGCCACAGGGCACCCATGG + Intronic
1104729577 12:131097592-131097614 CTGGAGTCACAGATCCGCCAGGG + Intronic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106762158 13:32877979-32878001 CAGGAGGCACAGAACAACCAAGG + Intergenic
1112304089 13:98257796-98257818 CTGTAGCCACACATCAATGAGGG - Intronic
1112334774 13:98505168-98505190 CCGGAAACACAGATCCACCAAGG + Intronic
1113776979 13:112953474-112953496 ACGGAGCCACAGATCTGCCAAGG + Intronic
1115994742 14:39184694-39184716 CAGGAGCCAGAGACCAACCTCGG + Intergenic
1122189139 14:100026040-100026062 CAGGAGCCCCAGATCAGCCTGGG + Intronic
1122718392 14:103708476-103708498 CTGGAGCCACATGTCACCCCTGG + Intronic
1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG + Intergenic
1123726915 15:23112347-23112369 CTGGAGCAACACAACAAGCAGGG + Intergenic
1124420392 15:29516003-29516025 TAGGAGCCACTGATCACCCATGG - Intronic
1125998746 15:44189437-44189459 GTAGAGCCAAAGATAAACCAGGG - Intronic
1128793307 15:70448623-70448645 CGGGAGCCACAGATAACCCAGGG + Intergenic
1129389468 15:75213457-75213479 CTGGGGCCACAGAGGAACCCAGG - Intergenic
1129518915 15:76173452-76173474 CTGAACCCACAGAACCACCAAGG + Intronic
1134059263 16:11189090-11189112 GTGGAGCCAAAGAACAAACACGG - Intergenic
1134767912 16:16777869-16777891 CTGGATCTACAGATATACCAAGG - Intergenic
1136093084 16:27934653-27934675 CTGGAGCCACAGCTCTCCCATGG - Intronic
1138398669 16:56728203-56728225 CTTCAGCCACAGATACACCATGG - Intronic
1139436733 16:66940876-66940898 CAGGAGCCACAGAACAAGCTCGG - Intronic
1141746039 16:85926829-85926851 CCGGAACCACAGATGACCCAGGG + Intergenic
1143663056 17:8339150-8339172 CTGGAGCCACAGGCCAGGCAAGG + Intergenic
1143786360 17:9258758-9258780 CTGGAGCCACAGAGGAAGCCTGG - Intronic
1144427050 17:15152979-15153001 ATGGAGCCAGAGAAGAACCAGGG - Intergenic
1145001438 17:19307802-19307824 CGGGATCCACAGAAGAACCAGGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1152277977 17:79369210-79369232 CCGGTGCCACAGGTCAACCCCGG - Intronic
1152686399 17:81695780-81695802 CTGCAGCCACAGTTCCACAATGG + Exonic
1152900389 17:82937750-82937772 AAGGAGCCACAGAGCAGCCAAGG - Intronic
1153068450 18:1076626-1076648 ATGGAGACACATATTAACCATGG + Intergenic
1153407486 18:4757341-4757363 CCGGAGCTACAGATCAACCTGGG + Intergenic
1153643067 18:7172280-7172302 CTGGAGACACAGGGCTACCAGGG + Intergenic
1154408385 18:14118564-14118586 GTGGAGCCAAAGATCAAGGAGGG + Intronic
1159070795 18:63621776-63621798 GTGGAGCTACAAATCAAACAGGG - Intergenic
1160504971 18:79421898-79421920 CTGGAGCTACAGAGCACCCTTGG - Intronic
1160515318 18:79476274-79476296 CTGGAGCCACAGAGCCACGGTGG - Intronic
1163408247 19:17136881-17136903 CAGGAGCCCCAGACCAACCTGGG + Intronic
1166006784 19:39913709-39913731 CTGGAGCCACAGTGCACCCCTGG - Exonic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
925563433 2:5223405-5223427 CAGGAGCTGCAGATCAACCTAGG + Intergenic
927863686 2:26575858-26575880 GTGGAGCCACAGATCAGTGAAGG - Intronic
928359349 2:30650102-30650124 CGGGTGCCACAGCTCAGCCAGGG - Intergenic
930887006 2:56337563-56337585 GTGGAGCCACAGATGGACCTGGG - Intronic
933688651 2:85162387-85162409 CTGGATCCACAGAGCAGCCTGGG - Intronic
936668317 2:114624870-114624892 GTGGAGCAACAGATGAACCAAGG - Intronic
938310403 2:130285445-130285467 CTGGAGCCACAGGCCAAGCTGGG + Intergenic
939376568 2:141375872-141375894 CTGCAGTCACTGATCAGCCAAGG - Intronic
1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG + Intergenic
1172883956 20:38219111-38219133 CTGGAGCCAGGAATGAACCAGGG + Intronic
1172948668 20:38707662-38707684 CTGAAGCCACAGAGCTACCATGG - Intergenic
1174331139 20:49819101-49819123 GTGGAGTCAAAGATCAACAACGG - Intronic
1175583424 20:60118329-60118351 CTCGAGCCAGAGAGAAACCAGGG + Intergenic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178635080 21:34295319-34295341 CTGGAGCCACAGTTCTTCCAGGG - Intergenic
1179731987 21:43373157-43373179 CCGGAGCCACAGAGCTGCCAGGG + Intergenic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1181149795 22:20875070-20875092 CTGGAGCCACAGGACTTCCATGG - Intronic
1181808673 22:25390640-25390662 CTGAAGCCACACAGCAACCTAGG + Intronic
1181849435 22:25739599-25739621 CTGGATCCACAAAACAGCCAAGG - Intergenic
1182462408 22:30491963-30491985 CTTCACCCACAGATCAACTATGG - Exonic
1182467374 22:30525740-30525762 CTTCACCCACAGATCAACTACGG - Exonic
1184255816 22:43286281-43286303 CTGGAACCCCAGCTCTACCATGG - Intronic
1184336337 22:43855359-43855381 CTCAAGCCTCAGAACAACCAGGG - Intronic
1184732358 22:46377898-46377920 CTTGAGCCACAGTGCAACCCCGG + Intronic
952905762 3:38138323-38138345 GTGGAGCCACAGTTCTTCCACGG - Intergenic
953334277 3:42080592-42080614 CTGGAGCCAGAGAACATCCAGGG + Intronic
955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG + Intronic
956210321 3:66795685-66795707 CAGGAGCCTCAGATTACCCAGGG - Intergenic
957132674 3:76242675-76242697 CTGGAATCGGAGATCAACCAGGG + Intronic
957414963 3:79890010-79890032 CTGGGGCCACATATGAACCTAGG + Intergenic
958740481 3:98064515-98064537 CAGGACTCACAGATCATCCAGGG + Intergenic
962349295 3:134644932-134644954 CTGGAGCCCCAGATCAGGCGAGG + Intronic
962403896 3:135083879-135083901 CTGGAGCCTCATGTAAACCAGGG - Intronic
963919818 3:150894539-150894561 CTGTAGACACAGAGCAGCCACGG - Intronic
966558938 3:181296988-181297010 CTGGAGCTACAGATCATCATTGG - Intergenic
967948995 3:194825706-194825728 CAGGAGCCACAGAGACACCAAGG - Intergenic
968385839 4:136576-136598 GTGGAGCCAAAGATCAAGTAGGG - Intronic
968394737 4:224331-224353 GTGGAGCCAGAGATCAAGGAGGG - Intergenic
968413699 4:409923-409945 GTGGAGCCAGAGATCAAGGAGGG - Intergenic
969390332 4:6888099-6888121 CTGGAGCTGCAGATCCAACAAGG - Intergenic
974759126 4:66252462-66252484 CTGAAGCCACATATCCACTAGGG + Intergenic
974824397 4:67108297-67108319 CTGGAGCCACAGATAATCTGAGG - Intergenic
978473570 4:109098909-109098931 CTGGAGCCAGAAGTGAACCAAGG - Intronic
980362869 4:131763293-131763315 ATGGAGCCACAGATCGACGCAGG + Intergenic
984879086 4:184394778-184394800 CTGATGCCACAGATCAGGCAAGG + Intronic
988863940 5:35314520-35314542 TTGGTGACATAGATCAACCATGG + Intergenic
990150561 5:52812831-52812853 CTTGGGCAACAGATCAGCCATGG + Intronic
990448406 5:55914160-55914182 TTGGAGAGACAGCTCAACCAGGG - Intronic
990524219 5:56608642-56608664 GTGGAGTCACAGAGCAACCTTGG - Intergenic
992803548 5:80315079-80315101 CTGAGGCCACAGATCAACTGAGG - Intergenic
994156791 5:96513014-96513036 CTGAAACCACAGAACAATCATGG + Intergenic
995687325 5:114784958-114784980 CTGGTGCTACAGATGAACCAAGG - Intergenic
997046574 5:130326225-130326247 CTTGAACCATATATCAACCAAGG + Intergenic
997634879 5:135398173-135398195 CAGGGGCCACAGATCACTCAAGG - Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999242450 5:150135824-150135846 CTGGAACCACAGATCTCTCAGGG - Exonic
1001052738 5:168426009-168426031 CTGGAGCCACAGAGCTGACATGG - Intronic
1002564194 5:180100716-180100738 CTGTAGCCACAGTTCAGGCATGG - Intergenic
1004083631 6:12421959-12421981 CTGGTCCCACAGATCAACTCTGG + Intergenic
1004260249 6:14101641-14101663 CTGGAGTCACCGATTAAACAGGG - Intergenic
1013980342 6:116121288-116121310 CTGGAGCCCCAGGCCAGCCAGGG - Exonic
1015339867 6:132085958-132085980 CAGCAGCCACAGATAAGCCACGG + Intergenic
1023337095 7:39181593-39181615 TTGGAGCCACAGAAAATCCATGG + Intronic
1023500867 7:40847980-40848002 CTGCTCCCACAGATCAATCATGG + Intronic
1024467210 7:49723862-49723884 CTGGAATTACAGATCAACAAGGG - Intergenic
1029284751 7:99457851-99457873 CTGGAGCCACAGGACAGCCGGGG + Intronic
1031018060 7:116596903-116596925 CTGGAACTACAAAACAACCATGG + Intergenic
1034889383 7:154826578-154826600 CTAGAGCTACAAATCAAACATGG + Intronic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1036389351 8:8311040-8311062 CTGGAGGCACAGAAAAGCCAAGG + Intergenic
1037763729 8:21758803-21758825 CCGGAGCCACAGGTCCACCGTGG + Intronic
1038435845 8:27535502-27535524 CTGGAGGCAGAGATCCACTAGGG - Intronic
1039739930 8:40373195-40373217 CTGGTGTCACAGAACAACCTTGG - Intergenic
1042702892 8:71636330-71636352 CTGGAGCCACTGACCAAAGAAGG - Intergenic
1049402336 8:142434030-142434052 CTGAAGGCACAGAACAGCCAGGG - Intergenic
1050360762 9:4828888-4828910 CTGGAGCCAGATACCAACCAAGG - Intronic
1055856040 9:80690110-80690132 CAGGAGCAAGAGATCAAACAGGG - Intergenic
1057163776 9:92910415-92910437 CTCAATCCTCAGATCAACCAAGG + Intergenic
1058874015 9:109226313-109226335 CTGGAGCCACAGAGAACTCATGG - Intronic
1061165370 9:128919271-128919293 CTGAAGCCCCACATCAAACACGG - Intergenic
1062031646 9:134364652-134364674 TGGGAGCCACAGAGCACCCAGGG - Intronic
1062562881 9:137149621-137149643 CCGGTGCCACAGAGCAACCTTGG + Intronic
1186613242 X:11159332-11159354 ATGGAGCCAGAGATAAAGCAAGG + Intronic
1187296384 X:18005297-18005319 ATGCAGCCACAGATTAAGCATGG + Intergenic
1187528066 X:20071862-20071884 CAGGAGTTAAAGATCAACCAGGG - Intronic
1189443610 X:41060057-41060079 CTGGTCTCACAGATCAACCCTGG - Intergenic
1189443938 X:41063235-41063257 CTGGTCTCACAGATCAACCCTGG - Intergenic
1189612031 X:42747142-42747164 CTGGGGCCACAGAGCATCCGTGG + Intergenic
1190779561 X:53580259-53580281 CTGGATCCACAGCCCAACCAAGG + Intronic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1199622553 X:149713363-149713385 GTGGAGCCTCAGGTCAACCCAGG + Intronic