ID: 1180207708

View in Genome Browser
Species Human (GRCh38)
Location 21:46272256-46272278
Sequence CACTCACCTGTCTCATGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180207701_1180207708 11 Left 1180207701 21:46272222-46272244 CCTTGCAGGGCACCTGGAACTCC 0: 1
1: 0
2: 2
3: 10
4: 245
Right 1180207708 21:46272256-46272278 CACTCACCTGTCTCATGAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 133
1180207704_1180207708 -10 Left 1180207704 21:46272243-46272265 CCCTCTCCTGGTTCACTCACCTG 0: 1
1: 0
2: 2
3: 20
4: 340
Right 1180207708 21:46272256-46272278 CACTCACCTGTCTCATGAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 133
1180207703_1180207708 -1 Left 1180207703 21:46272234-46272256 CCTGGAACTCCCTCTCCTGGTTC 0: 1
1: 0
2: 1
3: 33
4: 342
Right 1180207708 21:46272256-46272278 CACTCACCTGTCTCATGAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180207708 Original CRISPR CACTCACCTGTCTCATGAGG AGG Intronic
901413528 1:9101558-9101580 CACTCATCTGTGGCAAGAGGTGG + Exonic
902787715 1:18744016-18744038 CACTCATCTGTCTCCTCTGGGGG + Intronic
902956901 1:19931523-19931545 CACTCACTTGGCTGAGGAGGAGG + Intergenic
903133678 1:21295133-21295155 TACTCATCTGTCAAATGAGGAGG + Intronic
904351834 1:29913489-29913511 TCCTCACCTGTCTGATGAGAGGG + Intergenic
905276830 1:36823952-36823974 CACTCACACCTCTCTTGAGGTGG - Intronic
911382416 1:97131461-97131483 CACTAACCTTTCTCAGGTGGAGG - Intronic
913445203 1:118943747-118943769 CACTCACCTGGCTCAGGATAAGG + Intronic
913530767 1:119732771-119732793 CAGTCACCTGTCTGTGGAGGGGG + Intronic
914903141 1:151722898-151722920 CAATCACCTGTCTTTTGTGGAGG - Intronic
916168197 1:161981906-161981928 CCCTCACCTGTAAAATGAGGGGG - Intergenic
918374531 1:183895900-183895922 CTCTCTCCTATCTAATGAGGAGG + Intronic
920059859 1:203219736-203219758 CACTCTGGTGTCTGATGAGGAGG + Exonic
920432716 1:205929007-205929029 CACTCCCCTGCCTCCTTAGGGGG + Intronic
922857577 1:228788207-228788229 CACTGTACTGTCTCATGGGGCGG + Intergenic
1064025539 10:11845824-11845846 CACTCTCCTGCCTCAGGAGCAGG - Intronic
1064311695 10:14217626-14217648 CACCCACCAGGGTCATGAGGTGG + Intronic
1070552888 10:77504821-77504843 CAATCACATTTGTCATGAGGAGG - Intronic
1072552791 10:96492170-96492192 CTCTCACCAGTTTCAAGAGGAGG + Intronic
1074288351 10:112119560-112119582 CCCTCACCTGTCTTATGTGCAGG + Intergenic
1074369293 10:112886646-112886668 CTCTCACCTGGCTGAGGAGGGGG - Intergenic
1074690284 10:115998128-115998150 CACTCACCAGTGAGATGAGGTGG + Intergenic
1074852401 10:117449259-117449281 CACTCATCTGTAAAATGAGGGGG + Intergenic
1077703119 11:4459768-4459790 CACTCACTTGGCTGAGGAGGAGG + Intergenic
1080767924 11:35313906-35313928 CACTCACTTCTTTCATGAGGTGG + Intronic
1083479285 11:62933479-62933501 CACTCACCTGGCTCACGTTGAGG + Intergenic
1085865748 11:80290024-80290046 CACTCACCAGTAGCAAGAGGAGG - Intergenic
1087082545 11:94185896-94185918 TGCTCACCTCTCTCAAGAGGAGG + Intergenic
1088814874 11:113413964-113413986 AACTCACCCGTCTCAAGAGTTGG - Intronic
1092208830 12:6633237-6633259 CCCTGACCTGTGTCCTGAGGTGG + Intronic
1096373642 12:51089452-51089474 CTCTCGCCTGTCTCCTGAGTAGG - Intergenic
1097073891 12:56377749-56377771 CAGTTCCCTGTCCCATGAGGAGG + Intergenic
1097883887 12:64709938-64709960 CACTCACATATATAATGAGGTGG + Intergenic
1099070191 12:78036527-78036549 CAATCACATGTCTCAGCAGGAGG - Intronic
1102164720 12:110797166-110797188 CACTCTCCTGTCTCCGGAAGGGG - Intergenic
1112157460 13:96833206-96833228 CCCTCTCCTCTCTCAGGAGGGGG + Exonic
1112636076 13:101219488-101219510 CTTTCACCTGTCTCATGTGTGGG + Intronic
1115623056 14:35159878-35159900 CATACACCAGTCTCATAAGGAGG - Intronic
1117236362 14:53781213-53781235 CATTGACCAGTTTCATGAGGGGG + Intergenic
1117337498 14:54767480-54767502 CACTTCCCTGTGTCTTGAGGTGG + Intronic
1119266058 14:73263892-73263914 CACACACCTGTCAAAGGAGGAGG - Intronic
1120665853 14:87306235-87306257 TACTCACATATCCCATGAGGAGG + Intergenic
1121110274 14:91307999-91308021 CACCCATCTGTCTCATCAGAGGG + Intronic
1125816105 15:42586121-42586143 TACCCACCTGAATCATGAGGAGG - Intronic
1126079123 15:44941293-44941315 GAGTCACCTGCCTTATGAGGTGG + Intergenic
1129171719 15:73812070-73812092 CACTCACCTCTCCCAAGATGGGG + Intergenic
1131252209 15:90838199-90838221 CACCCACCAGTCTCAGGAAGGGG - Intergenic
1132809915 16:1792580-1792602 CACTCCTCTGTCCCATGGGGTGG - Intronic
1132925475 16:2427155-2427177 CACTCACCTCTCTTCTGAGACGG + Intergenic
1144575576 17:16427532-16427554 CACTCACCTGGCCCACGAGGAGG - Exonic
1145322795 17:21776194-21776216 TGCCCACCTGGCTCATGAGGCGG - Intergenic
1152920026 17:83062007-83062029 CGCACACCTGCCTCAGGAGGGGG - Intergenic
1154015228 18:10609835-10609857 CACACACCTCTCTCCTCAGGGGG + Intergenic
1154190292 18:12225809-12225831 CACACACCTCTCTCCTCAGGGGG - Intergenic
1155317901 18:24590647-24590669 CACCGACCTGTCTCATAAGGAGG - Intergenic
1158827814 18:61243169-61243191 CACTCACCTACCTCTTGAGTTGG + Intergenic
1163796394 19:19340731-19340753 CACTGAACTGTCCCCTGAGGTGG + Intronic
1164280816 19:23767072-23767094 CACGCACCTGTCTACTCAGGAGG - Intronic
1164419831 19:28079243-28079265 CCCTCATCTGTCCCCTGAGGAGG - Intergenic
1165069742 19:33248467-33248489 CACTTCCCTGTCCCAGGAGGAGG + Intergenic
1166500534 19:43337784-43337806 CGCACACCTGGCTCAGGAGGTGG + Intergenic
1167916957 19:52748796-52748818 CACTCACTTGGCTGAGGAGGAGG + Intergenic
1168472983 19:56654798-56654820 CACACACATATCTCTTGAGGGGG + Intronic
925198278 2:1945395-1945417 CTCTCATCTGTCTCATGATCTGG - Intronic
927855267 2:26523797-26523819 CACTCAGCTGCCCCATGAGAAGG + Intronic
930811670 2:55548065-55548087 GAGTCACCTGCCTTATGAGGTGG + Intronic
931357560 2:61550486-61550508 CACTCACATCTCTCATGACGAGG - Intergenic
932440934 2:71734473-71734495 CACTCACCTGGCTGAAGAGAGGG + Intergenic
932749843 2:74364480-74364502 CAGTTACCTGACTCAGGAGGTGG - Intronic
940978858 2:159978645-159978667 CACCCAGCTGTCTCATGTAGTGG + Intronic
942804404 2:179912706-179912728 AACTTACCAGTCTCATGAGTTGG + Intergenic
946339864 2:219060146-219060168 CGCTCACCTGGGTCATGAGGCGG + Exonic
946450436 2:219774695-219774717 CACTCTCCTGTCCAGTGAGGGGG + Intergenic
1169135084 20:3192367-3192389 TACTCACCTGTCTCACCAGCCGG - Intronic
1170793600 20:19527560-19527582 CTCTCTCCTGCCTCATGAGCAGG - Intronic
1172388206 20:34548477-34548499 CACGCCCCTGGCTCAAGAGGAGG + Intronic
1172893745 20:38285113-38285135 CACTCACATGGCTGATGAGCTGG + Intronic
1174103780 20:48147624-48147646 GAGTCACCCGTGTCATGAGGTGG - Intergenic
1177151448 21:17459228-17459250 CAAGCACCTTCCTCATGAGGTGG + Intergenic
1178405114 21:32317193-32317215 CACTCACCAGGCTCCTGACGTGG - Intronic
1180069553 21:45429564-45429586 CCCTCTCCAGTCTCATGATGGGG + Intronic
1180143416 21:45906650-45906672 CAGACCCCTGCCTCATGAGGTGG - Intronic
1180207708 21:46272256-46272278 CACTCACCTGTCTCATGAGGAGG + Intronic
1180886065 22:19244762-19244784 CACTCAGCAGCCCCATGAGGTGG - Intronic
1183639371 22:39083800-39083822 GACTTACCTGTGTTATGAGGTGG + Exonic
1185103760 22:48855758-48855780 CATTCACATGTCTCATGACGAGG + Intergenic
950026875 3:9826128-9826150 CCCTCATCTGTGACATGAGGAGG + Intronic
950188936 3:10963052-10963074 CACCTAACAGTCTCATGAGGAGG - Intergenic
951301072 3:20997164-20997186 CTCTCACCTCTCTCCTGAGCTGG - Intergenic
951710403 3:25580842-25580864 CACTCACCTGACTTAGTAGGTGG + Intronic
955957494 3:64305446-64305468 CACTCACCTCTCTTATGGGAGGG + Intronic
956860078 3:73314325-73314347 CACCCAGCTGTCCCGTGAGGTGG - Intergenic
958936132 3:100257843-100257865 CACTCACATGCCTGATGAGTTGG - Intergenic
960024146 3:112989040-112989062 CCCTCACCTGTCTCACTAGTAGG + Intergenic
964295612 3:155229881-155229903 CACTCACCTGGCACATGAGATGG + Intergenic
966889979 3:184399841-184399863 CACTCACCTATTTCTGGAGGAGG - Intronic
967092553 3:186147664-186147686 GACTCACAGGTCTCATGAAGGGG - Exonic
969323194 4:6425428-6425450 TCCTCACATGACTCATGAGGAGG - Intronic
971268915 4:25118868-25118890 CAATCACCTTTGTCATGTGGAGG + Intergenic
972969512 4:44555544-44555566 CACTCACTTGTCTCCTAGGGAGG + Intergenic
977479260 4:97554178-97554200 CTCTCACCTTTCTTTTGAGGAGG - Intronic
977942618 4:102875453-102875475 CACTCACATGTATCAGGTGGTGG - Intronic
979887130 4:126042297-126042319 CACTCATCAGTTTTATGAGGAGG - Intergenic
990217377 5:53549291-53549313 CTCACACCTGTCTTCTGAGGTGG + Intergenic
990994322 5:61716092-61716114 CATTCATCTGTCTCATCAGTGGG + Intronic
991626177 5:68603301-68603323 CATTCTCCTGCCTCAAGAGGAGG + Intergenic
996926685 5:128835346-128835368 CACTCCCCTGTCTCTTAGGGAGG + Intronic
999283108 5:150377792-150377814 CTCCCACCTGTACCATGAGGTGG + Intronic
1001305348 5:170568474-170568496 GAATCACCTGTCTCAGGAGGCGG - Intronic
1001844761 5:174912103-174912125 CACTAATCTCACTCATGAGGGGG - Intergenic
1002592470 5:180300154-180300176 CCCTCACCTGTATCATGGGCTGG - Intergenic
1005559496 6:27023767-27023789 CACCCACCGGTCTGAAGAGGAGG + Intergenic
1006455495 6:34129660-34129682 GACTCAGCTGTCTCTTGAGCAGG + Intronic
1007074202 6:39056478-39056500 GACTCACCTGTGGCAGGAGGTGG - Exonic
1010924977 6:81734072-81734094 CACTCGTCTATCTCATGAGGTGG - Intronic
1014568046 6:122975502-122975524 CATTCCCCTGTCTCATGAAAGGG - Intergenic
1015838709 6:137452090-137452112 CAATCAAGTGACTCATGAGGTGG - Intergenic
1017705517 6:157119288-157119310 CTCTCACCGGTCTGAGGAGGTGG - Intronic
1021876599 7:25055103-25055125 CAGTCACCTTGCACATGAGGTGG + Intergenic
1022472545 7:30690733-30690755 CACTCTCCTGTCTGAGCAGGTGG - Intronic
1023732763 7:43208170-43208192 CACTCAGATGTCACATGAAGAGG - Intronic
1024062405 7:45708890-45708912 CCCTCACCTGTGTCGTGAGGAGG + Intronic
1024895710 7:54259409-54259431 CACTGACCTGTCACTGGAGGTGG + Intergenic
1030152410 7:106420559-106420581 CACTCACCTTCCTCACAAGGTGG + Intergenic
1030386596 7:108874484-108874506 AACTCTCCTGTCTCAAGTGGGGG + Intergenic
1033345922 7:140525744-140525766 CACTCACCTGTCTGAGGAACCGG + Exonic
1034914167 7:155023180-155023202 CACTCACCTGGCCCAGGAGGTGG - Intergenic
1035359580 7:158301958-158301980 CAATCCCCTGTCCCATGAGATGG + Intronic
1035543192 8:458098-458120 CGCACACCTGTCGCATGGGGAGG + Intronic
1040602676 8:48899473-48899495 CAGTAACCTGTCTCAAGAGAAGG - Intergenic
1042291946 8:67178306-67178328 CACCCACCTGTATCCTGAGGGGG + Intronic
1043063107 8:75529918-75529940 CATTCACCTTTCTCAAGAAGAGG + Intronic
1046890521 8:119416601-119416623 CACTTACCTGTCCCAGGAGATGG - Exonic
1048419135 8:134260054-134260076 CACCCAACAGTCTCATGAGCTGG - Intergenic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1052421930 9:28253792-28253814 CACTTAGCTGTCTCATTATGAGG - Intronic
1053303380 9:36967185-36967207 CACTGACCGGTCACATGATGTGG - Intronic
1053350549 9:37410911-37410933 CAATCACCTGTGGAATGAGGAGG - Intergenic
1055978016 9:81973183-81973205 CACTCACCTGTCTGATGCTCTGG - Intergenic
1056830635 9:89914352-89914374 CACTCACCTGTCTTCTGTAGGGG + Intergenic
1059422146 9:114198876-114198898 GCCTCAGCTGCCTCATGAGGTGG + Intronic
1059948868 9:119441197-119441219 CACTTTCCTGTCTCCAGAGGAGG + Intergenic
1189113472 X:38319029-38319051 CACTGACCTGTCTCATAAAAAGG - Intronic
1193224129 X:78961498-78961520 CACTCTCCTTGCTCATGAGGCGG - Exonic
1193285500 X:79709762-79709784 CACTCAGTTTTCTCATGAGATGG + Intergenic
1195002255 X:100653159-100653181 CCCTGACCTGTCTCCTGAGCTGG + Intronic
1196847144 X:119905294-119905316 CACTCACCGTTCTCATTAGGAGG + Intronic
1199246859 X:145615166-145615188 CCCTCACCCTTCTCATGAGATGG - Intergenic
1199635340 X:149807594-149807616 CACTCACCTTTCTCCTGGAGGGG - Intergenic