ID: 1180210928

View in Genome Browser
Species Human (GRCh38)
Location 21:46295260-46295282
Sequence GGCCAGGCCAGCTCTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 354}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180210916_1180210928 10 Left 1180210916 21:46295227-46295249 CCACCAGCCCAGGACCCCATCCT 0: 1
1: 0
2: 8
3: 59
4: 614
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210911_1180210928 29 Left 1180210911 21:46295208-46295230 CCCTGAGGGGAGGGCCAGCCCAC 0: 1
1: 0
2: 3
3: 40
4: 218
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210912_1180210928 28 Left 1180210912 21:46295209-46295231 CCTGAGGGGAGGGCCAGCCCACC 0: 1
1: 0
2: 6
3: 36
4: 337
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210922_1180210928 -5 Left 1180210922 21:46295242-46295264 CCCATCCTCATAGCCACAGGCCA 0: 1
1: 0
2: 1
3: 10
4: 227
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210919_1180210928 2 Left 1180210919 21:46295235-46295257 CCAGGACCCCATCCTCATAGCCA 0: 1
1: 0
2: 2
3: 29
4: 277
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210914_1180210928 15 Left 1180210914 21:46295222-46295244 CCAGCCCACCAGCCCAGGACCCC 0: 1
1: 0
2: 10
3: 83
4: 750
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210923_1180210928 -6 Left 1180210923 21:46295243-46295265 CCATCCTCATAGCCACAGGCCAG 0: 1
1: 0
2: 3
3: 26
4: 281
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210925_1180210928 -10 Left 1180210925 21:46295247-46295269 CCTCATAGCCACAGGCCAGGCCA 0: 1
1: 0
2: 0
3: 32
4: 290
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210915_1180210928 11 Left 1180210915 21:46295226-46295248 CCCACCAGCCCAGGACCCCATCC 0: 1
1: 0
2: 4
3: 50
4: 460
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210918_1180210928 3 Left 1180210918 21:46295234-46295256 CCCAGGACCCCATCCTCATAGCC 0: 1
1: 0
2: 2
3: 18
4: 261
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210917_1180210928 7 Left 1180210917 21:46295230-46295252 CCAGCCCAGGACCCCATCCTCAT 0: 1
1: 0
2: 2
3: 40
4: 401
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354
1180210921_1180210928 -4 Left 1180210921 21:46295241-46295263 CCCCATCCTCATAGCCACAGGCC 0: 1
1: 0
2: 0
3: 27
4: 294
Right 1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG 0: 1
1: 0
2: 3
3: 37
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180210928 Original CRISPR GGCCAGGCCAGCTCTGCTCA GGG Intronic
900031879 1:378437-378459 GCCCAGGACAGCTCTGACCATGG - Intergenic
900052427 1:606628-606650 GCCCAGGACAGCTCTGACCATGG - Intergenic
900130114 1:1083819-1083841 GGCCGGGTGAGCCCTGCTCATGG + Intronic
900285151 1:1895504-1895526 AAGCAGGGCAGCTCTGCTCAGGG + Intergenic
900361177 1:2289813-2289835 GGCCAGGCCAGCCAGGCTCTTGG - Intronic
900421592 1:2558165-2558187 CCCCAGAGCAGCTCTGCTCATGG + Intronic
900495263 1:2973274-2973296 GGGCACCCCAGCTCTGCCCAGGG - Intergenic
900813918 1:4828736-4828758 GAGAAGGACAGCTCTGCTCAGGG + Intergenic
900944077 1:5819836-5819858 AGCCAGGCCAGCCCTGCTGGAGG - Intergenic
902337892 1:15764486-15764508 GTTCAGGCCAGCTCTGCTTTGGG - Exonic
902530972 1:17090438-17090460 GGTCAGACCAGCTCTCCCCAAGG - Intronic
902629371 1:17695633-17695655 GGCCAGGCCCGGCCTGCTCGTGG + Intronic
902657443 1:17879137-17879159 GGCCAGGTCAGGGCAGCTCATGG - Intergenic
902737837 1:18413037-18413059 GCCCAGACCAGCTCTGTACATGG + Intergenic
902814516 1:18908500-18908522 GGCCCTGCCACCTCTCCTCATGG - Exonic
903548929 1:24144054-24144076 GGCCAGGCAAACTCTCCCCAGGG - Intergenic
904287660 1:29462446-29462468 GGCCAGGCCAGTCCTGCTCATGG - Intergenic
904370928 1:30046934-30046956 GGCCAGGCCAGTCCTGCCCGTGG - Intergenic
904468832 1:30723471-30723493 GGCGAGGCCAGGGCTGCACAGGG + Exonic
904483188 1:30806866-30806888 GGCCAGGCCATTTCTGCTCTTGG - Intergenic
905446382 1:38030674-38030696 GGCCAGGGCGGCTTTGCTCCAGG + Intergenic
906033301 1:42736502-42736524 GGCCAGGCCAGCCCTGCTCCTGG + Intronic
906240514 1:44239590-44239612 GGCCAGGCCAGCTGAGCCCCAGG - Intronic
907238935 1:53070020-53070042 GGCCAGGCCCGGGCTCCTCAGGG - Exonic
907241803 1:53085118-53085140 GGCCAGGCCAGCAGTCCTGAAGG - Exonic
907872392 1:58454902-58454924 GGTCAGGCTAGATCTGCTCTTGG - Intronic
912495444 1:110088692-110088714 GGCCAAGGCCTCTCTGCTCAGGG + Intergenic
915087258 1:153397210-153397232 GGCCAGGTCGACTCTGCTCTTGG - Intergenic
916608220 1:166363838-166363860 GGGCAGGCCATCCCTCCTCAGGG + Intergenic
917408968 1:174738148-174738170 GACCAGGACAGCTCAGTTCAAGG - Intronic
917471583 1:175330424-175330446 GGACAGTCCAGGTCTGCTGATGG + Intronic
917499810 1:175575946-175575968 GCCCAGGCCTGCTCTGCTAGGGG + Intronic
919796296 1:201323297-201323319 TGCCAGGCACACTCTGCTCATGG - Intronic
920630369 1:207645819-207645841 GCCCAGGCCAGCCCAGCCCATGG - Intronic
920971291 1:210745699-210745721 GGCCAGCCCAGCACTGCTTGGGG - Intronic
922468639 1:225861956-225861978 GGCCAGGCCACATCAGCTCGAGG + Intronic
922962615 1:229661774-229661796 GGCCCAGCCAGCTCTCCACATGG + Intergenic
923433826 1:233949895-233949917 GCCCAGGGCATCTCTGCCCAGGG - Intronic
1063104561 10:2981655-2981677 GGCTTGGCCAGCTGTGCTCACGG + Intergenic
1063819736 10:9820218-9820240 GGCAGGGGCAGCACTGCTCAGGG - Intergenic
1064202833 10:13299489-13299511 GGCCAGGCAGGCGCTGCCCAGGG - Intronic
1066733244 10:38451631-38451653 GCCCAGCCCAGCCCAGCTCATGG + Intergenic
1067669305 10:48305120-48305142 GGAAAGGCCAGCTCTGCTGGAGG - Intergenic
1069147718 10:64916976-64916998 CACCAGGCCACTTCTGCTCAGGG - Intergenic
1069860115 10:71465545-71465567 GGCTAGGCCAGCTCAGGGCAGGG + Intronic
1069948122 10:72001310-72001332 TGCCAGGTCAGCTCTGCTTGAGG - Intronic
1069968740 10:72146141-72146163 GGGCAGGACACCTCTGCCCACGG - Intronic
1071345126 10:84685076-84685098 GGCAAGGCCCTCCCTGCTCAGGG - Intergenic
1071491484 10:86139453-86139475 GGCCAGGCCCGCTCCAGTCAGGG - Intronic
1071679795 10:87693228-87693250 GGCCATGCCAGCCTGGCTCAAGG - Intronic
1072426748 10:95336625-95336647 TGCCGGGCCGGCTCTCCTCAGGG + Exonic
1073455441 10:103634084-103634106 GGCCAGGCCTGCTCCGCCCCCGG + Intronic
1073574793 10:104613258-104613280 GGCCAAGCCAGCTGTGGTGATGG + Intergenic
1073682168 10:105716441-105716463 GGCAGTGCCTGCTCTGCTCAAGG - Intergenic
1076392203 10:130111334-130111356 GGCCAGCCCCGCGCGGCTCACGG + Intergenic
1076458595 10:130622691-130622713 GGATGGGCCACCTCTGCTCAGGG - Intergenic
1076531619 10:131148970-131148992 GACCAGGCCAGCTGTGGCCAAGG - Intronic
1076670852 10:132120435-132120457 GGCCTGGGCAGCTGTGGTCAGGG - Intronic
1076912652 10:133399424-133399446 CCCCAGGCCAGGTCAGCTCAGGG - Intronic
1077061642 11:620212-620234 GACCCAGCCAGCTCTGCCCAAGG + Intronic
1077375583 11:2203888-2203910 TCCCAGGCCTGCTCTCCTCAGGG - Intergenic
1078141644 11:8697486-8697508 GGCACGGTCAGCTCTGCTCCAGG - Intronic
1080657061 11:34266442-34266464 TGATCGGCCAGCTCTGCTCACGG - Intronic
1080685319 11:34510612-34510634 GGTTAGGCCAGGCCTGCTCAAGG + Intronic
1081566277 11:44263188-44263210 GGCCAGGCCCACTATGCTCAGGG - Exonic
1081706956 11:45187892-45187914 GGCCCTGCCTGCTCTGCTGATGG + Intronic
1082092053 11:48098169-48098191 GGCCAGGCCAGCTCTGTTCCAGG + Intronic
1083223987 11:61273267-61273289 GGGCAGGCCAGCTCAGGGCAGGG + Exonic
1083720331 11:64600647-64600669 GGCCAGGCCCGCTTGGCCCAGGG - Intronic
1083898578 11:65632707-65632729 TGCCAGGCCAGCTCCTCTCCCGG + Intronic
1085319725 11:75566480-75566502 GGCCAGGCCGGCGCTGCGCTCGG - Exonic
1085747373 11:79126761-79126783 GGGGAGGCCAGCTCTGCTTGAGG + Intronic
1089086148 11:115818606-115818628 GGCCTGGCCAGCTCTGCTGCTGG + Intergenic
1089297131 11:117476509-117476531 TGCCAGGCCAGCTCACCCCATGG + Intronic
1089385139 11:118062423-118062445 GGCCAGCCCAGCTCCTCTCCAGG + Intergenic
1090171946 11:124613068-124613090 GGCCAGGCCCGTCCTGCTTATGG - Exonic
1090714134 11:129415305-129415327 AGCCTGGCCAGTTCTCCTCATGG + Intronic
1090879581 11:130821827-130821849 GGGCTGGGCAGTTCTGCTCAGGG - Intergenic
1091823680 12:3493720-3493742 GCACATGCCAGCTCTGCTGAAGG + Intronic
1091845203 12:3650559-3650581 GGAGCGGGCAGCTCTGCTCACGG - Intronic
1092139338 12:6171981-6172003 GGCCAGGCCAGCATTGCCCTGGG + Intergenic
1094000159 12:25686423-25686445 AGGCAGGCCAGCAGTGCTCAGGG - Intergenic
1094567353 12:31611709-31611731 GCCCAGGCCTGCTCTTCCCAGGG - Intergenic
1096215979 12:49797486-49797508 AACCAGGCCAGCTCTGTTCCTGG - Intronic
1097280793 12:57844824-57844846 GGCAAGGCCATCCCTTCTCAGGG + Intronic
1097426146 12:59446758-59446780 TGCCATGCAACCTCTGCTCAGGG + Intergenic
1099653577 12:85459800-85459822 GGCAAGTCCAGCTCAGCCCATGG + Intergenic
1100717272 12:97319152-97319174 GCCCAGGCCAGCCCTACTGAAGG + Intergenic
1101731534 12:107431250-107431272 GGCTAGGCCAAGCCTGCTCATGG - Intronic
1101885694 12:108659829-108659851 GGCCAAGACTGCTCTGATCATGG + Intronic
1101987746 12:109460859-109460881 AGACACCCCAGCTCTGCTCAGGG - Intronic
1103866542 12:124056541-124056563 TGCCAGGCAAGCTCTTCTCATGG - Intronic
1105216699 13:18291115-18291137 GGTTAGGCTAGCGCTGCTCAGGG - Intergenic
1106890580 13:34241442-34241464 AGGCAGGCCAGTTCTGATCAGGG - Intergenic
1108594880 13:51940867-51940889 GGCCAGACCAGAGCTGCTCTGGG + Intronic
1110537703 13:76670769-76670791 GGTCAGGCCAGCTGTGCTGCTGG - Intergenic
1112021204 13:95372703-95372725 GGCCTGGGCAGCTCAGCGCAGGG - Intergenic
1112637019 13:101226779-101226801 TGCCAGGCCAGCTGGGATCATGG + Intronic
1113092586 13:106630811-106630833 GGCCACCCCAGCTGTGCCCAAGG - Intergenic
1113265272 13:108609409-108609431 GCCCAGGTCTGTTCTGCTCACGG + Intronic
1113957347 13:114105960-114105982 GGTCAGGACTGCTCAGCTCAGGG - Intronic
1114492720 14:23113484-23113506 GGCCAGGCCAGGCCTGCTTATGG + Intergenic
1117456179 14:55899069-55899091 GCCAAGGGCAGCTCTGGTCAGGG - Intergenic
1117566143 14:56995518-56995540 GGCCAGGACAGCTGTCCTCAGGG - Intergenic
1117676265 14:58157873-58157895 GGTCAAGTCAGCTCTGCTCAAGG - Intronic
1118309562 14:64682413-64682435 GGCCAGCCCTGCCCTGCCCACGG - Intergenic
1118683347 14:68266051-68266073 TGCCAGGCAAGGACTGCTCAGGG - Intronic
1118762309 14:68888053-68888075 GGGAAGGTCAGCTCTGCTGAAGG - Intronic
1119261143 14:73238384-73238406 GGCCAGTCCGGGTCTGGTCACGG - Intronic
1119378565 14:74214355-74214377 TGCCAGCCCAGCTTTTCTCATGG - Intergenic
1119891468 14:78185669-78185691 GCCTAGGCTGGCTCTGCTCATGG + Intergenic
1119892882 14:78196225-78196247 GGCCATGCCAGCACCACTCAAGG + Intergenic
1120829263 14:88983629-88983651 GCCCAGGCCAGCTGTGGTAAGGG - Intergenic
1121271473 14:92640942-92640964 GCCCAGGCCAGCTCCTCTAAAGG - Intronic
1121429855 14:93879077-93879099 GGCCAGGACCCTTCTGCTCATGG + Intergenic
1121521109 14:94586846-94586868 GGCAAGGCCAGCAGTGCTGATGG + Intronic
1122651215 14:103228239-103228261 TGGCCGGCCTGCTCTGCTCAGGG - Intergenic
1122716682 14:103700380-103700402 GGCCAGGCCAGCCATGCCAATGG - Intronic
1122717933 14:103706604-103706626 CGCCAGGCCAGGTATGCTCCTGG - Intronic
1122837429 14:104437021-104437043 GGCCAGGCCAGCACAGCACGGGG + Intergenic
1122889745 14:104726784-104726806 GGCCCAGCCCGCTCTGCCCACGG - Intronic
1122903769 14:104792693-104792715 GGCCAGGCCAGCTGGGCTCGGGG - Exonic
1123060272 14:105591272-105591294 GCCCAGGCCAGGGCAGCTCAGGG + Intergenic
1123156530 14:106232684-106232706 GGCCAGACAGGCTCTACTCAAGG + Intergenic
1123418668 15:20113793-20113815 GCCACAGCCAGCTCTGCTCAAGG + Intergenic
1123527887 15:21120331-21120353 GCCACAGCCAGCTCTGCTCAAGG + Intergenic
1124061579 15:26298251-26298273 CGCCAGGCCAGCACTGCTGGGGG + Intergenic
1124346296 15:28923674-28923696 TGCCAGGGCATCCCTGCTCAGGG + Intronic
1125677739 15:41511697-41511719 GGCCAGCCCAGCCCAGCGCAGGG + Intronic
1128222192 15:65977237-65977259 GGCCATGCCAGCTCTCCTGGAGG + Intronic
1128535844 15:68489638-68489660 GGCCAGGGTAGCTGTGCTGAAGG + Intergenic
1129109808 15:73330758-73330780 AGCCAGCTCAGCTCTGTTCAGGG - Intronic
1129109944 15:73331355-73331377 GGGCAGCCCAGCTCTGCTGTTGG + Intronic
1129168693 15:73794559-73794581 GCCCAGGCCAGCCAAGCTCAAGG + Intergenic
1131014903 15:89050170-89050192 GGCCAGGTCTGCTCTGTTCCTGG - Intergenic
1132643376 16:988041-988063 GGCAAAGCCAGCTCTGCCCCTGG + Intergenic
1132825687 16:1904134-1904156 GGCAGGACCAGCCCTGCTCAGGG + Intergenic
1133067310 16:3217874-3217896 GGCCAGGCCAACTCCTGTCAGGG + Intergenic
1134062232 16:11206137-11206159 GGCCAGGCCAGGCCAGCTCAGGG - Intergenic
1134848496 16:17461176-17461198 GGCCTGGGCTGCTCTGCTCATGG - Intronic
1135323489 16:21512052-21512074 GGCCAGGCAAGGCCTGCCCATGG + Intergenic
1135926390 16:26697612-26697634 CGCCTGGCCAGATCTGGTCAGGG - Intergenic
1136025532 16:27465876-27465898 GACCAGGCCAGCCCTGGTCAGGG - Intronic
1136058044 16:27705389-27705411 GTCCAGGCCAGGCCAGCTCAGGG - Intronic
1136114881 16:28088179-28088201 AGCCAGGGCAGCTCTGCACCAGG - Intergenic
1138107624 16:54297715-54297737 TGTCAGGCTAGCCCTGCTCAAGG - Intergenic
1138269828 16:55687586-55687608 GGCCAGGAGAACTCTGCTCCTGG - Intronic
1138392264 16:56678698-56678720 GTCCAGGCCAGCACTGCTGAAGG - Intronic
1138458670 16:57135240-57135262 GGGAAGGCCAGCCCTGCTCTGGG + Intronic
1138526982 16:57614533-57614555 GGGCAGGCCAGGCCTGCTCCTGG + Intronic
1138526993 16:57614578-57614600 GGGCAGGCCAGACCTGCTCCAGG + Intronic
1139583865 16:67888608-67888630 GGCCTGGGCAGCTGTGCCCAGGG - Intronic
1141671900 16:85496530-85496552 AGCCAGGCCAGCTGTGGGCAGGG + Intergenic
1141927147 16:87177354-87177376 GAACAGGCCTGCCCTGCTCACGG + Intronic
1142032037 16:87843458-87843480 GGCTGGTCCAGCTCTGCTTAAGG + Intronic
1142035690 16:87861136-87861158 GGCCAGGCAAGGCCTGCCCATGG + Intronic
1142568342 17:855368-855390 CTCCAGGACAGCTTTGCTCAGGG + Intronic
1142610844 17:1108707-1108729 CTCCAGGCCAGCCCAGCTCAGGG - Intronic
1144384682 17:14738352-14738374 CTCCAGGCCAGCCGTGCTCACGG + Intergenic
1144675280 17:17158013-17158035 GGCCAGCCCTGCCTTGCTCAGGG - Intronic
1147889402 17:43706638-43706660 GGAGAGGCCAGCTATGCACAGGG - Intergenic
1147918038 17:43900336-43900358 GCCCAGGACAGCTCTCCTGAAGG + Intronic
1147991116 17:44334041-44334063 GCCGATGCCAGCTCAGCTCACGG - Intergenic
1148695435 17:49555668-49555690 GGCCCGGCCAGCTCTGGGCGTGG + Intergenic
1149534308 17:57420646-57420668 GGGCAGGCCAGCTCAGCTCCTGG - Intronic
1150816336 17:68395107-68395129 GCCCAGGCCAGCTTACCTCAAGG + Exonic
1151098906 17:71532884-71532906 GGCAAAGAAAGCTCTGCTCATGG + Intergenic
1151479685 17:74362605-74362627 GGCCAGCCCCGCTCTGGGCAGGG - Intergenic
1151725117 17:75878899-75878921 GGCCAGGCCAGCGCTCCGCAGGG + Intergenic
1151788244 17:76287131-76287153 GGCCAAGCCAGCTCTGAGAAGGG + Intronic
1152202338 17:78954423-78954445 GGTCAGGACAGCTCAGCTCCAGG - Intergenic
1152318944 17:79597276-79597298 TGCCAGCCCAGCTGTGCTCCAGG + Intergenic
1152361120 17:79833675-79833697 GGACAGGGCAGCTCTGCGCCCGG - Exonic
1152643712 17:81459451-81459473 GGCCAGGCCCCACCTGCTCATGG + Intronic
1153147451 18:2050017-2050039 GGCCAGGGCAGCTGTTCTCCTGG - Intergenic
1153769620 18:8404946-8404968 GCCCAAGCAAGCTCTGCACAAGG - Intronic
1154131199 18:11738349-11738371 GGCCAGGCCAGGTCTGCTGTGGG + Intronic
1154154907 18:11936519-11936541 GCCCAAGCCTGCTCTGCCCATGG - Intergenic
1156226963 18:35118873-35118895 TGCCTGGCCTGCTCTGCTCCTGG + Intronic
1157274140 18:46298307-46298329 GGCCTGGCCTGCAGTGCTCAGGG - Intergenic
1157309505 18:46541738-46541760 GGCAAGGCCAGCCCTTCTCTGGG - Intronic
1160495100 18:79368844-79368866 TGCCTGGCCTGCTCTGCTGAGGG - Intronic
1161009450 19:1953267-1953289 GACCAGGTCAGCTCTGCCCCCGG + Intronic
1162351280 19:10151249-10151271 GGCCAGTCCCGCTCTTCTCAGGG + Intronic
1162918363 19:13886094-13886116 GGTCGGGCAAGCTCTGCACAGGG + Intronic
1163496587 19:17649464-17649486 TAGCAGGCCTGCTCTGCTCAGGG + Intronic
1163835188 19:19569003-19569025 AGCCAGGCCAGCTCAGATCCAGG - Intronic
1164077865 19:21836384-21836406 GGTTGGGCCTGCTCTGCTCAGGG - Intronic
1164432026 19:28197167-28197189 GCCCAGGACAGCTCTACTTAAGG + Intergenic
1164591161 19:29507711-29507733 GGCTTGGCCCGCTCTGCTCTTGG - Intergenic
1164813397 19:31175827-31175849 AGCCAGGCCTGCAGTGCTCAGGG - Intergenic
1165075111 19:33276137-33276159 GGCCCGGCCAGCCCTGCTCGTGG - Intergenic
1165169819 19:33884073-33884095 GGGCATGCCTGCTCTGCCCAGGG - Intergenic
1165179694 19:33957044-33957066 GGCCACGCCAACTCTGCCCAAGG + Intergenic
1165355096 19:35299645-35299667 GGCCCAGCCAGCTCAGCTCAGGG - Exonic
1165805890 19:38580332-38580354 GGCCAGGTCAGCTCCGCCCTGGG - Intronic
1166934318 19:46321818-46321840 GGCCAGGGCAGCCTCGCTCAGGG - Exonic
1167381365 19:49140067-49140089 GGCCGGGACAGCTCTTCTCTGGG + Exonic
1202688183 1_KI270712v1_random:67092-67114 GACACAGCCAGCTCTGCTCAAGG + Intergenic
925390346 2:3490093-3490115 GACCAAGCCACGTCTGCTCACGG - Intergenic
925848983 2:8062024-8062046 GACCAGGCCTGCTGTGCTCCAGG + Intergenic
925976167 2:9143563-9143585 GGCCTGCCCAGCCCTGCTCTTGG - Intergenic
925987659 2:9229498-9229520 TGCCAGGCCAGCAGTGCCCAAGG - Intronic
927212504 2:20647306-20647328 GACCAGGCCAGCTCAGCTCTGGG - Intronic
927846804 2:26476399-26476421 GGGCAGGGCAGCTCTGACCAGGG - Intronic
927936532 2:27079471-27079493 GGCCTGGCCCGCTCCCCTCAGGG - Intronic
928103766 2:28454283-28454305 GCCCAGGCCTGCTGTGCACACGG - Intergenic
928950394 2:36808504-36808526 GGCCAAACCAGCTCTGCACGTGG - Exonic
929138011 2:38643249-38643271 GGGCAGGCCAGCACTGCTGGGGG + Intergenic
930170203 2:48243985-48244007 GGCAAGGACAGCTATGGTCATGG - Intergenic
932129919 2:69178364-69178386 TGGCAGGCCAGCTCCGGTCAGGG + Intronic
934573390 2:95385545-95385567 AGCCAGCCCAGCTCCACTCAGGG + Exonic
934841029 2:97624235-97624257 GGCCAGGGCAGCTCAGCACCTGG - Intergenic
936160032 2:110077958-110077980 GGCTGGAGCAGCTCTGCTCAGGG - Intergenic
936184632 2:110293395-110293417 GGCTGGAGCAGCTCTGCTCAGGG + Intergenic
937238936 2:120447828-120447850 GGCCAGGCCAGTTCTGCCTCAGG + Intergenic
937333371 2:121045682-121045704 GGCCAGCCCTACTCTGCTCCGGG - Intergenic
937907752 2:127060686-127060708 GGACAGGCCAGTTCTGCACCTGG - Intronic
938422882 2:131157788-131157810 GTCCAGCCTTGCTCTGCTCAGGG + Intronic
938985710 2:136573408-136573430 GGCCAGTACAACTCTGGTCATGG + Intergenic
943294905 2:186125886-186125908 GGCAAGACCAGTTCTACTCATGG - Intergenic
944398486 2:199297624-199297646 GGCCAGCACAGATCTGCTAATGG + Intronic
946166879 2:217869815-217869837 GGCCAGCTCAGCTCAGCTCCTGG + Intronic
946252951 2:218424428-218424450 AGCCAGGCCAACTCTCCCCACGG - Intronic
946386231 2:219386107-219386129 AGCCAGGCCAGGTCAGCCCAGGG + Intronic
946407023 2:219497227-219497249 CGCCAGCCCAGCTCTGGGCACGG + Intronic
947353214 2:229268156-229268178 ACCCAGCGCAGCTCTGCTCAGGG + Intronic
947827774 2:233118017-233118039 AGTCAGGACAGGTCTGCTCATGG - Intronic
947867043 2:233405556-233405578 GGCCAGGAGGGCTCTGCTCTGGG + Intronic
947948233 2:234124813-234124835 TGCCAGTCCAGCTCTTCTCCCGG + Intergenic
948371348 2:237491400-237491422 AGACAGACCAGCTCTGCTCTGGG - Intronic
948655620 2:239475306-239475328 GGCCAGGCCAGCAGAGCTGATGG + Intergenic
948792919 2:240388527-240388549 GGCCAGCCCAGCCCTGAGCAAGG + Intergenic
948816274 2:240511887-240511909 GGGCAGGACGGCTCTGCACATGG - Exonic
948907926 2:240988667-240988689 GGTCAGGCCAGCCCTCCTCTGGG - Intronic
948988923 2:241541979-241542001 GGCCAAGCCTGCTCTGCAGAGGG - Intergenic
1168852855 20:988444-988466 GGACAGACAAGCTCTGCTCATGG + Intronic
1169130880 20:3165920-3165942 GGCCAGGCCACCTGGGCTCTGGG - Exonic
1169216979 20:3799805-3799827 AGCCAGGCCAGCTCCTCACAGGG + Intronic
1169235110 20:3924521-3924543 GGCGTGGCCACCTCTGCACATGG + Intronic
1170059780 20:12246920-12246942 GGCCAGAGAAGCTCAGCTCAAGG + Intergenic
1170119896 20:12900430-12900452 GGCCATGCCTGCCTTGCTCAGGG - Intergenic
1171412023 20:24953774-24953796 GGGCAGGCCAGGCCTGCTCGAGG - Intronic
1172125472 20:32622875-32622897 GGCCAGGCGTGCCCTGCTCTAGG + Intergenic
1172882968 20:38213555-38213577 GCCCAGGCCTGCCCGGCTCAGGG + Exonic
1174201265 20:48808193-48808215 GGCCGCTCCAGCTCTGCCCACGG - Intronic
1174484122 20:50850938-50850960 GGGCAGGGCAGCTCCGCCCATGG - Intronic
1175120993 20:56716317-56716339 TGCCAGGACAGCTTTGCTTATGG - Intergenic
1175805506 20:61826302-61826324 GGCCATGCCAGCTAAGCTCCCGG + Intronic
1175888890 20:62307383-62307405 GGCCAGGCCAGGTCCAGTCAGGG - Exonic
1175891958 20:62319656-62319678 GGCCAGCCCAGCCAGGCTCAGGG - Intronic
1176021399 20:62964091-62964113 GGCAGGGCCAGCCCTGCTCCTGG - Intronic
1176146909 20:63569570-63569592 CGCCAGGCCGGCTCTACGCACGG - Exonic
1176259503 20:64172057-64172079 GGCCAGGCCACCTCTGGTGTGGG + Intronic
1176369213 21:6052430-6052452 GGCCTGGCCACCCCTGATCATGG + Intergenic
1179054529 21:37918806-37918828 GGCAAGGCCAGATCTACACATGG - Intergenic
1179754306 21:43486111-43486133 GGCCTGGCCACCCCTGATCATGG - Intergenic
1179807831 21:43851283-43851305 GGCCTGGCGACCTCTGCCCAAGG - Intergenic
1180043817 21:45293762-45293784 AGCCTGGCCAGCTCTGTGCACGG + Intergenic
1180183569 21:46128716-46128738 GCAGAGGCCAGGTCTGCTCAGGG + Intronic
1180210928 21:46295260-46295282 GGCCAGGCCAGCTCTGCTCAGGG + Intronic
1180722195 22:17917717-17917739 GGCCAGGGCAGCCCCGCCCAGGG - Intronic
1181404600 22:22673732-22673754 ACCCAGGCCAGCCCTGCTCATGG - Intergenic
1181557029 22:23677082-23677104 TGCCAGGCCAGCCCTGCTGCTGG - Intergenic
1181697347 22:24600453-24600475 TGCCAGGCCAGCCCTGCTGCTGG + Intronic
1183172285 22:36197273-36197295 AACCAAGTCAGCTCTGCTCAGGG - Intronic
1183830539 22:40416395-40416417 GACCAGGCCTTTTCTGCTCAAGG + Intronic
1183912915 22:41092324-41092346 GGTCCGGCCAGCTCCGCTCCCGG + Exonic
1184235830 22:43182552-43182574 GGCAAGGCCAGGCCTGCTCTGGG + Intronic
1184243192 22:43222278-43222300 GGCCAGGCCAGCTCTGACTCGGG + Intronic
1184477797 22:44730784-44730806 GGCCAGGCCAGCTCTGCCTGTGG - Intronic
1184730131 22:46367247-46367269 GGCCAGGCCTCCCCTCCTCAGGG + Intronic
1184888774 22:47366971-47366993 GGCAAGGCCAGCACTGCTGCAGG + Intergenic
1185041783 22:48507903-48507925 GGCCAGGCCAGGGCTGCAGATGG - Intronic
953463413 3:43099506-43099528 GGCCTGGCCATCACTGCCCATGG - Intronic
953770602 3:45776288-45776310 AGCCAGGCCAGCCCTGATGATGG + Intronic
953821941 3:46214536-46214558 GTTCAGACCACCTCTGCTCAGGG + Intronic
954198979 3:49013091-49013113 CTCCAGACCAGGTCTGCTCAAGG + Exonic
954395050 3:50289079-50289101 GGCCAGGACACCACTGCTGAGGG + Intronic
954448697 3:50560256-50560278 GGGCAGGCCAGGCCTGCTCATGG + Intronic
954647929 3:52142884-52142906 GGCCAGGTCTGCTCTGGTCTTGG - Intronic
955008073 3:54988383-54988405 GGGCAGGCCAGCCATGCTCTTGG + Intronic
959662451 3:108884108-108884130 GGCCAGACCAATTCAGCTCAAGG - Intergenic
960617931 3:119613196-119613218 GGTCAGGGCATCTCTGCCCAGGG - Intronic
961459124 3:127039187-127039209 GGCCAGGTCAGCTCTGTGCAGGG + Intergenic
961565664 3:127761690-127761712 TGGCAGTCCAGCTCTGCCCACGG - Intronic
961745769 3:129062656-129062678 GGCCAGGCCAGCTTTGCACCGGG + Intergenic
962318680 3:134374155-134374177 GGCAAGGGCCGCTCTGCCCAGGG - Intronic
962984586 3:140523129-140523151 GCCCAGGCCTGCTCTGTGCATGG - Intronic
963271619 3:143291084-143291106 TGCCAGGCCAGCACTGCAGATGG + Intronic
966717752 3:183030472-183030494 GCCCAGGCCAACTCTTCCCAAGG - Intronic
966808483 3:183824613-183824635 TCCCAGCCCAGCTCTGCTCCTGG - Intronic
967312543 3:188119760-188119782 GGACTGGCCAGACCTGCTCACGG - Intergenic
968490477 4:888339-888361 GGCCCGGCAGCCTCTGCTCACGG - Intronic
968490895 4:890044-890066 GGCCAGGCCTGCTGTGGGCAAGG - Intronic
968802269 4:2751036-2751058 GGGCAGGCCAGCCCTGCAAAGGG + Intronic
969633379 4:8351340-8351362 GCCCAGGCCGGCTCTGCTCTCGG - Intergenic
971047747 4:22824521-22824543 GCTCAGGCCAGCTCACCTCAGGG + Intergenic
971357905 4:25911579-25911601 GGCCAGCCAAGCCCTGCTCACGG - Intronic
976332124 4:83844698-83844720 GTTCAGGCCAACCCTGCTCAAGG - Intergenic
976902123 4:90191392-90191414 GGCCAGGCCAGCTTGGCACTAGG - Intronic
977646487 4:99418461-99418483 AGCCAGGGCCACTCTGCTCAAGG - Intronic
980582425 4:134772283-134772305 GGCAAGGCCAGGTCTCCACATGG - Intergenic
981081860 4:140644536-140644558 GGCCAGGCCAGCCTTGCCCCCGG + Intronic
982688466 4:158521273-158521295 ACCCAGGCCAGCTTTGCTCCAGG + Intronic
984883650 4:184431067-184431089 GCCCAGGCCAGCTCTGAAGACGG + Intronic
985481073 5:111289-111311 GGCCAGGCCAGAGCTGCCCCAGG - Intergenic
985811669 5:2094738-2094760 GGCCAGGCCAGCCCTGGCCCCGG + Intergenic
985981940 5:3477345-3477367 GGCCTGGCCAGCTGCCCTCAGGG - Intergenic
994109668 5:95987087-95987109 GGTCAGGAAAGCTCAGCTCAGGG - Intergenic
994425942 5:99587250-99587272 GGCCCTGCCAGCTCAGCTCTAGG - Intergenic
994794424 5:104277320-104277342 GGCCAGTGGAGCACTGCTCAAGG + Intergenic
997805230 5:136910845-136910867 CACCAGCCCAGGTCTGCTCAGGG + Intergenic
998368779 5:141647967-141647989 GGAACTGCCAGCTCTGCTCAAGG - Exonic
999427876 5:151503406-151503428 GGCCAAGTCATATCTGCTCAAGG + Intergenic
1000258337 5:159561870-159561892 GGCATGGCCATCTCTGCTCCAGG + Intergenic
1001124966 5:169011123-169011145 CTCCAGTCCAGCTCTGCTCCTGG + Intronic
1001307319 5:170584890-170584912 CACCAGGCCTGCTCTGCTCTGGG - Intronic
1001424751 5:171615905-171615927 GGCCAGGCCAGCGGAGCTCAGGG + Intergenic
1001797935 5:174517834-174517856 GGGCTGGGGAGCTCTGCTCAGGG - Intergenic
1002091606 5:176809954-176809976 GGCCAGGGCACCTCTGCGCGCGG + Intergenic
1002199738 5:177521014-177521036 TGCCAGGCCAGCTCCTCTCTGGG - Intronic
1002518181 5:179774595-179774617 GGCCAGGCAAGCCCTGCTGAGGG - Exonic
1002741941 5:181440431-181440453 GCCCAGGACAGCTCTGACCATGG + Intergenic
1002921094 6:1574094-1574116 GGCATGGCCAGGCCTGCTCACGG + Intergenic
1002991261 6:2241135-2241157 TGCCAGGCCAGCTGTGCCCCGGG - Intronic
1003106377 6:3219557-3219579 GGCCACTGCAGCTCTGATCATGG - Intergenic
1005183622 6:23137151-23137173 GGACAGGCCCACTCTGCCCATGG - Intergenic
1007130691 6:39470767-39470789 GGGAAGGCCAGTCCTGCTCAGGG - Intronic
1011692461 6:89882881-89882903 TGTCAGGCCTGCTCAGCTCATGG + Intergenic
1011850356 6:91620115-91620137 GGCCAGCCCAGCCCTGGCCATGG + Intergenic
1012506231 6:99949588-99949610 GGCGAGGCCATCTCTTCTCCAGG + Intronic
1016175560 6:141074547-141074569 GCCCAGTCCAGCCCTGCCCATGG - Intergenic
1018169805 6:161135930-161135952 GGGCAGGCCAGCACAGCTCCTGG - Exonic
1019247082 6:170716188-170716210 GCCCAGGACAGCTCTGACCATGG + Intergenic
1019374009 7:679373-679395 TGCCTGACCAGCCCTGCTCACGG - Intronic
1019478436 7:1255177-1255199 GGCCAGGCCAGCCCCGCCCCAGG - Intergenic
1019532544 7:1511000-1511022 GGCCAGGCCTGGTCTGCGCTGGG - Intergenic
1019547436 7:1585303-1585325 GGTCGGGGCTGCTCTGCTCACGG - Intergenic
1021947501 7:25742726-25742748 GGCCAGGTCAGACCTGCTCAAGG + Intergenic
1022178320 7:27893855-27893877 GGCTGGGCACGCTCTGCTCAGGG + Intronic
1022594316 7:31697399-31697421 GGGCATTCCAGCTCTTCTCAAGG - Intronic
1024250344 7:47501489-47501511 AGCCAGCTCCGCTCTGCTCAGGG - Intronic
1026256628 7:68717690-68717712 GGCAATGCCAGTTCTACTCAGGG - Intergenic
1029629965 7:101744001-101744023 TTGGAGGCCAGCTCTGCTCAGGG - Intergenic
1030632437 7:111910322-111910344 GGCCAGGCCTGCTTTGCCTAGGG + Intronic
1030640762 7:112003627-112003649 GCCCAGGCCAACTCTGCTCCAGG - Intronic
1034541280 7:151759773-151759795 CGCCTGGCCAGCTGTTCTCAGGG + Intronic
1034752500 7:153584007-153584029 ATCCAGGCAAGGTCTGCTCAAGG + Intergenic
1034794308 7:153999090-153999112 GGGCAGCCCAGCTCTCCTCTGGG + Intronic
1035501059 8:91765-91787 GCCCAGGACAGCTCTGACCATGG - Intergenic
1036562431 8:9908033-9908055 GTCCAGGCCAACTCGGGTCACGG - Intergenic
1037517340 8:19645832-19645854 GCCCAGGCCAGCACTGCCCTGGG - Intronic
1038455669 8:27670816-27670838 CGCCGTGCCCGCTCTGCTCATGG + Intronic
1038795674 8:30707246-30707268 TGCCAGGCCAGACCTACTCAAGG + Intronic
1038893561 8:31755105-31755127 GGACAGGCCTGCACTGCTCTGGG + Intronic
1041390420 8:57342808-57342830 GGCCTGCCCTGCTCTGCTCTTGG + Intergenic
1041790764 8:61693937-61693959 GGCAAGGGCAGCTGGGCTCACGG + Intronic
1047370070 8:124248650-124248672 GGAAATGCCAGCTCTGCTCTTGG + Intergenic
1047898811 8:129397505-129397527 GGACAGGCCTGTTCTGCCCATGG + Intergenic
1047967304 8:130055835-130055857 GGCCTGCCCAGCTCTCCTGAAGG + Intronic
1048733146 8:137466853-137466875 GGCCAGGCCATCTCAGTCCATGG - Intergenic
1049325635 8:142020137-142020159 GGCCAGGAGAGCCCTGCTCTGGG + Intergenic
1049376489 8:142291835-142291857 GGCCCGGCCACCCCTGCTCCTGG - Intronic
1049472464 8:142782592-142782614 GCCCAGGCCAGTGCCGCTCATGG - Intergenic
1049688111 8:143947098-143947120 GGCCCGGCCAGCTTTCCACAGGG - Intronic
1051500923 9:17776922-17776944 AGTTAGGCCAGCACTGCTCAGGG - Intronic
1052826401 9:33178909-33178931 GGCGGGGACAGCTCTGCTTAAGG + Intergenic
1053463339 9:38287665-38287687 GGCCAGGCCAGCTCATCTCTGGG - Intergenic
1053853354 9:42312723-42312745 GGTCAGGCCAGTTGTGCACATGG + Intergenic
1055414738 9:76069277-76069299 GGCCAGGTCAGCCCTTCTCATGG + Intronic
1057131694 9:92658396-92658418 GGCCAGGCCAGGGCAGCTCCTGG + Intronic
1057138948 9:92715294-92715316 GGCCACGCCGGGTCTGCTCATGG + Exonic
1057212377 9:93207108-93207130 GGCCAGGCCAGCTGTGCAGGAGG + Intronic
1057276042 9:93676482-93676504 GCCCAGCCCTGCTGTGCTCAAGG + Intronic
1057514570 9:95710602-95710624 GGCCCAGGCAGCTCTGCTCTGGG + Intergenic
1060034072 9:120240100-120240122 GGCCAGGCCAGGGCTGCTGGAGG + Intergenic
1060183151 9:121547564-121547586 GGCCTGGCTTTCTCTGCTCAGGG - Intergenic
1061250192 9:129421928-129421950 GGCCTGGCCAGGGCTGGTCATGG - Intergenic
1061412844 9:130430539-130430561 GGCCCGGCCCACACTGCTCAGGG - Exonic
1061668674 9:132175469-132175491 GGCCAGGTCAGCCCCGGTCAGGG - Intronic
1062267291 9:135693005-135693027 GGCCAGGTGACCTCTGCCCAGGG + Intergenic
1062311750 9:135941761-135941783 GGCCCTGCCAGCTCTGCCCCCGG + Intronic
1062457646 9:136646991-136647013 GGCCAGGCCAGCGCCTCTCTGGG - Intergenic
1062547578 9:137070525-137070547 GGCCCGGCGAGCTCAGCCCACGG + Exonic
1203607853 Un_KI270748v1:71647-71669 GCCCAGGACAGCTCTGACCATGG + Intergenic
1185471588 X:386878-386900 GGTCCGGCCCGCGCTGCTCAGGG + Intronic
1185704066 X:2253322-2253344 GGCCACGCCATCTTGGCTCAAGG - Intronic
1187169392 X:16836458-16836480 GGCCAAGCCACATCTGCACAAGG - Intronic
1189358688 X:40331311-40331333 GTCTTGGCCAGCACTGCTCAGGG - Intergenic
1190739880 X:53281631-53281653 GGCCAGGCCAGCTGGGCTGCGGG + Intronic
1192715301 X:73634473-73634495 GGTCAGGCAGGCTGTGCTCAGGG + Intronic
1193371428 X:80701968-80701990 GGCCAGTCCCTCTGTGCTCATGG - Intronic
1196093857 X:111777167-111777189 GGCCAGCCCAGCCCTGCCCATGG - Intronic
1199938668 X:152602456-152602478 GGCCAATCAAGCTCTGCTCTGGG - Intergenic