ID: 1180214798

View in Genome Browser
Species Human (GRCh38)
Location 21:46317237-46317259
Sequence CAAGAACGGCAGAACGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180214798_1180214803 17 Left 1180214798 21:46317237-46317259 CCTTCCACGTTCTGCCGTTCTTG 0: 1
1: 0
2: 0
3: 12
4: 271
Right 1180214803 21:46317277-46317299 AAGAGAGACCGTGACAGAGACGG 0: 1
1: 0
2: 8
3: 124
4: 1098
1180214798_1180214804 20 Left 1180214798 21:46317237-46317259 CCTTCCACGTTCTGCCGTTCTTG 0: 1
1: 0
2: 0
3: 12
4: 271
Right 1180214804 21:46317280-46317302 AGAGACCGTGACAGAGACGGTGG 0: 1
1: 0
2: 1
3: 60
4: 452
1180214798_1180214801 -6 Left 1180214798 21:46317237-46317259 CCTTCCACGTTCTGCCGTTCTTG 0: 1
1: 0
2: 0
3: 12
4: 271
Right 1180214801 21:46317254-46317276 TTCTTGCTCCAGCTTCTGTGAGG 0: 1
1: 0
2: 7
3: 100
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180214798 Original CRISPR CAAGAACGGCAGAACGTGGA AGG (reversed) Exonic
901643723 1:10705754-10705776 CAAAAACGTCAGAAAGTGGTAGG + Intronic
901744753 1:11364815-11364837 CAAGAACGGCACCAAGAGGATGG - Intergenic
902945504 1:19834258-19834280 CAATAACAGCAGAAAGGGGAGGG + Intergenic
906033501 1:42737385-42737407 GAATAAGGGCAGATCGTGGAGGG - Intronic
906323174 1:44829060-44829082 CAAGAAGGGCAGCACCTGGAGGG + Exonic
908167022 1:61468736-61468758 CCAAAGAGGCAGAACGTGGATGG - Intergenic
909448269 1:75771422-75771444 CAATCACGGCAGAAGGTGAAGGG - Intronic
909529580 1:76667357-76667379 CAATAATGGCAGAAGGTGAAGGG + Intergenic
912421024 1:109542680-109542702 CAAGAATGGCAGAAAGGAGATGG + Exonic
913188769 1:116395228-116395250 CAGGAACGGCCGCCCGTGGAGGG - Exonic
914897530 1:151690228-151690250 CATGAATGGCAGAAAGTCGAAGG - Intronic
915243251 1:154538875-154538897 GAAGAGAGGCAGAACGTGGTTGG + Intronic
916660416 1:166918274-166918296 CTAGAATGGCAGAACTGGGATGG + Exonic
919242613 1:194934920-194934942 CAATCATGGCAGAAAGTGGAAGG - Intergenic
923261868 1:232275380-232275402 CAATCACGGCAGAAGGTGAAGGG - Intergenic
1062915754 10:1240378-1240400 CAAGACCGGCAGAAGGTAGATGG - Intronic
1063696581 10:8341351-8341373 CAAGCATGGCAGAAGGTGAAGGG + Intergenic
1064338191 10:14462826-14462848 GAAGAACGGCACAACGAAGATGG + Intergenic
1064500224 10:15963400-15963422 CAATCACGGCAGAAGGTGAAAGG + Intergenic
1065024101 10:21525602-21525624 CAAGAACCGCAGCAAGAGGAAGG + Exonic
1065619783 10:27569238-27569260 CAATCACGGCAGAAGGTGAAAGG + Intergenic
1065668546 10:28088497-28088519 CAAGCATGGCAGAAGGTGAAGGG - Intronic
1074640387 10:115372048-115372070 CAATCACGGCAGAAGGTGAAAGG - Intronic
1075661705 10:124201532-124201554 CAATCACGGCAGAAGGTGAAAGG + Intergenic
1076479623 10:130776383-130776405 CAACAAAGGCAGAAAGTGAAGGG - Intergenic
1076748228 10:132525136-132525158 CAAGAACCTCAGAGCCTGGAGGG + Intergenic
1078423271 11:11229439-11229461 CAAGAATGGGAGAAAGTGGGAGG + Intergenic
1079343930 11:19635565-19635587 CACTCATGGCAGAACGTGGAAGG + Intronic
1079519867 11:21313913-21313935 CAAGAACAGCACAAAGTGGATGG - Intronic
1079863951 11:25711695-25711717 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1081164500 11:39791020-39791042 CAATCACGGCAGAAGGTGAAAGG - Intergenic
1082807275 11:57459172-57459194 GAAGAACGAGAGACCGTGGAGGG + Intergenic
1082865745 11:57898685-57898707 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1083105503 11:60354431-60354453 CAAACATGGCAGAAAGTGGAAGG - Intronic
1083506163 11:63159499-63159521 CAATCACGGCAGAAGGTGAAAGG - Intronic
1085394065 11:76197790-76197812 GGAGAACGGCAGATCGAGGAGGG - Intronic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1091441320 12:513096-513118 GAAGGAAGGCAGAAGGTGGAAGG - Intronic
1092014151 12:5143029-5143051 CAAGAACGGCACCAAGGGGATGG + Intergenic
1094777224 12:33744852-33744874 CAATCATGGCAGAACGTGAAGGG - Intergenic
1096015058 12:48263767-48263789 TAAGAATGGCAGAAGGTGAAGGG + Intergenic
1098214614 12:68202522-68202544 CAATCACGGCAGAAGGTGAAGGG + Intronic
1100118171 12:91335066-91335088 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1100141660 12:91626117-91626139 CAATACCGGCAGAATGTGGCTGG + Intergenic
1100549559 12:95634699-95634721 CAATCATGGCAGAACGTGAATGG + Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102180904 12:110911553-110911575 CAAGAAAGGAAGAACAGGGAAGG - Intronic
1102713746 12:114952230-114952252 CAAGAAAGGCAGAGTGTAGATGG - Intergenic
1105709216 13:22990036-22990058 CAATCATGGCAGAAGGTGGAAGG - Intergenic
1106855221 13:33844375-33844397 GAAGAACAGCAGAAACTGGAAGG - Intronic
1107719057 13:43229171-43229193 CAATCATGGCAGAAGGTGGAAGG - Intronic
1109616111 13:64836213-64836235 CAATCACGGCAGAAAGTGAAGGG - Intergenic
1110342429 13:74408183-74408205 CAAGCATGGCAGAAGGTGAATGG - Intergenic
1111494936 13:89035239-89035261 CAAGAACAGCACCAAGTGGATGG - Intergenic
1111685956 13:91500983-91501005 CAATCACGGCAGAAGGTGAAAGG - Intronic
1111746024 13:92270453-92270475 CAATCACGGCAGAAAGTGAAGGG - Intronic
1111956689 13:94766694-94766716 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1112252109 13:97792016-97792038 CAAGAAGAGCAGCAAGTGGATGG + Intergenic
1113987289 13:114328281-114328303 CAATCACGGCAGAAGGTGAAGGG - Intergenic
1114975945 14:28099734-28099756 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1115060819 14:29187696-29187718 CAAGAACGGCAGTCCAGGGACGG - Intergenic
1115134462 14:30091932-30091954 CAATAATGGCAGAAGGTGAAGGG + Intronic
1115962699 14:38853473-38853495 CAATAATGGCAGAAGGTGAAAGG - Intergenic
1117632379 14:57707483-57707505 CAATCATGGCAGAACGTGAAGGG - Intronic
1117881712 14:60319102-60319124 CAATCATGGCAGAAAGTGGAGGG - Intergenic
1119121078 14:72078139-72078161 TAAGAACAGCACAAAGTGGAGGG - Intronic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1120650319 14:87124569-87124591 CAAGAACAGCACCAAGTGGATGG + Intergenic
1121384634 14:93509062-93509084 CAATAATGGCAGAAGGTGCAGGG + Intronic
1122442262 14:101740193-101740215 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1122749303 14:103921042-103921064 CATGTACAGCATAACGTGGAGGG + Exonic
1123811636 15:23932546-23932568 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1123827770 15:24101107-24101129 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1123842224 15:24260516-24260538 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1123874452 15:24609663-24609685 CAGGAAGGGCAGACCATGGAAGG + Intergenic
1123877837 15:24642028-24642050 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1123883272 15:24695774-24695796 CAGGAAGGGCAGACCATGGAGGG + Intergenic
1124195861 15:27628288-27628310 CAAGAAAGGAAGAAAGTGAATGG + Intergenic
1127339428 15:58025779-58025801 CAATCACGGCAGAATGTGAAGGG + Intronic
1127581528 15:60343253-60343275 CAATCACGGCAGAAGGTGAAGGG + Intergenic
1129278530 15:74464471-74464493 CAATCATGGCAGAACGTGAAGGG - Intergenic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1132209406 15:100008817-100008839 CAAAAACGGCACAAACTGGAGGG - Intronic
1134042847 16:11081396-11081418 CAAGAAGGGCAGGATGTGGCTGG - Intronic
1135298449 16:21303004-21303026 CAATCACGGCAGAAGGTGAAAGG + Exonic
1135815331 16:25627416-25627438 CAATCATGGCAGAAAGTGGAGGG + Intergenic
1136479630 16:30533447-30533469 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136483408 16:30556406-30556428 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136623494 16:31446090-31446112 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1140632615 16:76872273-76872295 CATGAAAGGCAGAACATAGAGGG - Intergenic
1141739240 16:85879626-85879648 CAATCACGGCAGAAGGTGAAGGG + Intergenic
1142385927 16:89764669-89764691 CAAGAACAGCAGCACTTAGATGG - Intronic
1142516198 17:431084-431106 CAATCATGGCAGAACGTGAAGGG + Intergenic
1142798874 17:2331570-2331592 CAATCATGGCAGAAGGTGGAGGG - Intronic
1144180423 17:12746382-12746404 GTAGAAGGGCAGAAGGTGGAAGG + Intronic
1144874774 17:18391672-18391694 CAATCACGGCAGAAGGTGAAAGG - Intergenic
1145157451 17:20552749-20552771 CAATCACGGCAGAAGGTGAAAGG + Intergenic
1147208752 17:38858383-38858405 AAACAAAGGCAGAACGTGGAAGG - Intergenic
1148992356 17:51677301-51677323 CAAGAACGGCCCACAGTGGATGG - Intronic
1149219366 17:54398377-54398399 AAAGAATGGCAGAAGGTGAAGGG - Intergenic
1149417573 17:56475978-56476000 CAATCACGGCAGAAAGTGAAGGG + Intronic
1152003921 17:77665312-77665334 CAATTATGGCAGAAGGTGGAAGG - Intergenic
1152430302 17:80245161-80245183 CAAGACAGGCTGATCGTGGAGGG - Intronic
1152768336 17:82152803-82152825 AAAGAACAGCAGCACCTGGAAGG - Intronic
1155668325 18:28337875-28337897 CAATCATGGCAGAAGGTGGAGGG + Intergenic
1156409065 18:36810528-36810550 GAAGATCGGCAGAAAGTGAATGG + Intronic
1158060577 18:53335823-53335845 CAATCACGGCAGAAGGTGAAAGG + Intronic
1158565859 18:58553726-58553748 CAATCACGGCAGAAGGTGAAGGG - Intronic
1160243949 18:77142428-77142450 CAATCACGGCAGAAGGTGAAAGG - Intergenic
1160827735 19:1088575-1088597 CCAGGACGGGAGAACGTGGGTGG + Exonic
1162108873 19:8389499-8389521 AAAGAATAGCAGAAAGTGGACGG + Intronic
1163615343 19:18323984-18324006 CGACAAAGGCAGAACGCGGAAGG - Intergenic
925261146 2:2529674-2529696 CAAGAAGGGCAGGCCATGGAGGG + Intergenic
925669051 2:6292137-6292159 CAATAATGGCAGAAGGTGAAAGG - Intergenic
926548015 2:14266196-14266218 CAAGAAAGGGAGCAGGTGGACGG + Intergenic
926952284 2:18255140-18255162 CAATGACGGCAGAAGGTGAAAGG - Intronic
928353049 2:30580653-30580675 GAAGAACAGCTGAACGTGAAAGG + Intronic
928593788 2:32841850-32841872 CAATCACGGCAGAAGGTGAAGGG - Intergenic
929070943 2:38029881-38029903 CAATCACGGCAGAAGGTGGAAGG + Intronic
931713894 2:65013053-65013075 CAAGCATGGCAGAAGGTGAAGGG + Intronic
932882181 2:75513029-75513051 CAAAAAAGGCAGAAAATGGAAGG - Intronic
933031356 2:77333106-77333128 CAATAATGGCAGAAGGTGAAAGG - Intronic
933081711 2:77996808-77996830 CAAGATCGTGAGAACATGGAGGG - Intergenic
935125785 2:100221676-100221698 CAAGAATGGGAGAACTTGGTTGG - Intergenic
935239632 2:101167265-101167287 CAATCACGGCAGAAGGTGAAGGG - Intronic
935481326 2:103593870-103593892 CAATAATGGCAGAAGGTGAAAGG - Intergenic
937086443 2:119174894-119174916 CTAGAACGGCAGAGGGAGGAGGG + Intergenic
937509419 2:122577328-122577350 AAAGAAAGGCAGAAACTGGAAGG + Intergenic
939425997 2:142037330-142037352 TAAAAACGGCAGAATGTGCATGG - Intronic
940639401 2:156331587-156331609 CCAGAAAGGCAGATTGTGGAAGG - Intronic
940649392 2:156426301-156426323 CAATCACGGCAGAAGGTGAAGGG + Intergenic
942111305 2:172685074-172685096 CAATCACGGCAGAAAGTGAAGGG - Intergenic
942441657 2:176043190-176043212 CAATCACGGCAGAAGGTGAAAGG - Intergenic
942482531 2:176404570-176404592 CAATAATGGCAGAAGGTGAAAGG + Intergenic
942514023 2:176732913-176732935 CAATCACGGCAGAAGGTGAAAGG + Intergenic
942892338 2:181006394-181006416 CTGGAACGGCAAAAGGTGGAAGG - Intronic
943107204 2:183560427-183560449 CAATAATGGCAGAAGGTGAAAGG + Intergenic
943467549 2:188247366-188247388 CAATCACGGCAGAAGGTGAAAGG - Intergenic
943520486 2:188943871-188943893 CAAAACCGACACAACGTGGAAGG + Intergenic
944303453 2:198152138-198152160 CCAGAAGGGCAAAAGGTGGAAGG + Intronic
944945759 2:204682749-204682771 CAAGAAAGGGAAAACTTGGAGGG - Intronic
945182446 2:207105623-207105645 GAAGAAGGGTAGAATGTGGATGG + Intronic
945270482 2:207933870-207933892 CAAAAATGGCTGAACGTGGTGGG - Intronic
946205119 2:218100323-218100345 CAATCACGGCAGAAGGTGAAGGG + Intergenic
946503604 2:220275901-220275923 CAATAATGGCAGAAGGTGAACGG + Intergenic
948710854 2:239824689-239824711 CAATCATGGCAGAAGGTGGAAGG - Intergenic
948789197 2:240368686-240368708 CAAGACAGGCAGAGCCTGGAGGG + Intergenic
1168988228 20:2070053-2070075 CAAAAACGGGAGCAAGTGGAGGG + Intergenic
1169532531 20:6501245-6501267 AAAGAATGGCAGGACGAGGAAGG - Intergenic
1173456489 20:43206573-43206595 CAATCATGGCAGAAAGTGGAGGG + Intergenic
1174713969 20:52737029-52737051 CAAGAAAGGGAGAAGCTGGAGGG + Intergenic
1174724489 20:52846953-52846975 CAAGGCAGGCAGAACGGGGAAGG + Intergenic
1175118555 20:56701337-56701359 AAAGAAGGGAAGAAGGTGGAGGG - Intergenic
1175531922 20:59679698-59679720 CAATAATGGCAGAAGGTGAAAGG + Intronic
1175603103 20:60290986-60291008 CAATCACGGCAGAAGGTGAAGGG + Intergenic
1176267688 20:64219192-64219214 CAAGGACCGCAGAGCTTGGATGG + Intronic
1176714677 21:10341124-10341146 AAAGAACACCACAACGTGGAAGG + Intergenic
1177068812 21:16475552-16475574 CAAGATTAGCAGAATGTGGAAGG - Intergenic
1177407721 21:20691877-20691899 CAATCACGGCAGAAGGTGAAGGG - Intergenic
1177408470 21:20699977-20699999 CAATAATGGCAGAAGGTGAAAGG - Intergenic
1177740968 21:25153619-25153641 CAAGGATGGCAGAAGGTGAAAGG - Intergenic
1178178440 21:30132032-30132054 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1178624114 21:34201551-34201573 CAAGAAATGCAGAAGGTGGCAGG - Intergenic
1179266549 21:39808405-39808427 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1179915630 21:44476322-44476344 CAATCATGGCAGAACGTGAAGGG - Intergenic
1180214798 21:46317237-46317259 CAAGAACGGCAGAACGTGGAAGG - Exonic
1181987894 22:26813902-26813924 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1182536878 22:31010427-31010449 CAATCATGGCAGAAGGTGGAGGG - Intergenic
1182809522 22:33103954-33103976 CAATCACGGCAGAAGGTGAAAGG - Intergenic
1182815327 22:33156997-33157019 CAATCACGGCAGAAGGTGAAAGG - Intergenic
1184439456 22:44499922-44499944 CAATGACGGCAGAAGGTGAAAGG - Intergenic
1184914069 22:47555555-47555577 CAATCATGGCAGAAGGTGGAGGG + Intergenic
949201285 3:1382951-1382973 GAAGAACTGCAGAATGGGGAGGG + Exonic
949248202 3:1950163-1950185 CTAACACGGCAGAAGGTGGAAGG + Intergenic
949763435 3:7498851-7498873 CAAGGACAACAGAAAGTGGAGGG - Intronic
949924570 3:9031163-9031185 CACAAAAGGCAGAAAGTGGAAGG - Intronic
952849669 3:37717524-37717546 CAATCACGGCAGAAGGTGAACGG + Intronic
952905368 3:38136539-38136561 GACGAACGGAAGAACGGGGAAGG + Intronic
956235696 3:67068754-67068776 CAAAAATGGCAGAAGGTGAAAGG + Intergenic
956675631 3:71729403-71729425 CAATAAAGGCAGAACATGGGAGG + Intronic
958044770 3:88270181-88270203 CAAGAAGTGCAGAACGAGGTGGG - Intergenic
960361729 3:116720378-116720400 CAAGAATGGCAGAAAATAGATGG + Intronic
963849347 3:150194665-150194687 CAATTACGGCAGAAAGTGAAGGG + Intergenic
967348194 3:188482144-188482166 CAATCACGGCAGAAGGTGAAGGG - Intronic
968852620 4:3094058-3094080 CAAACACTGCAGAACGTGGCAGG - Intronic
969182378 4:5452102-5452124 CAAGAAGCACAGAATGTGGATGG - Intronic
969941790 4:10739379-10739401 CAATCACGGCAGAAGGTGAAGGG - Intergenic
970419131 4:15888652-15888674 CAAACACGGCAGAAGGTGAAGGG - Intergenic
971263878 4:25081300-25081322 CAATCACGGCAGAATGTGAAGGG - Intergenic
971599998 4:28580654-28580676 CAAGAATGGCAGACCCTGCAGGG + Intergenic
971632924 4:29018183-29018205 CAATAATGGCAGAAGGTGAAGGG - Intergenic
972227972 4:37036239-37036261 CAATAATGGCAGAAGGTGAAAGG + Intergenic
972301710 4:37791163-37791185 CAATCATGGCAGAACGTGAAAGG - Intergenic
976260160 4:83137750-83137772 TAAGAATGGTAGAAAGTGGATGG - Intergenic
976267255 4:83195755-83195777 AAAGAAAGGAAGAAGGTGGAAGG - Intergenic
978408496 4:108404784-108404806 CAATAATGGCAGAAGGTGAAGGG + Intergenic
978417120 4:108488340-108488362 CAATCATGGCAGAAGGTGGAAGG + Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
980755173 4:137149095-137149117 CAATCACGGCAGAAGGTGAAAGG + Intergenic
981392609 4:144209497-144209519 CAATCACGGCAGAAGGTGAAGGG + Intergenic
981724559 4:147833986-147834008 AAAGATAGGCAGAACGTGGGAGG - Intronic
982846713 4:160262173-160262195 AAAGAAGGTCAGAACCTGGAAGG + Intergenic
986784793 5:11104457-11104479 CAAGAGTGGCAGACGGTGGATGG - Intronic
988608867 5:32706190-32706212 CAAGAATGGCAGAAGGCGAAGGG - Intronic
989358568 5:40573074-40573096 CAAGAAAAACAGAACGTGGGAGG - Intergenic
994878010 5:105450287-105450309 CAATCATGGCAGAATGTGGAAGG - Intergenic
995533386 5:113112466-113112488 CAATTACGGCAGAAGGTGAAGGG - Intronic
996876938 5:128250570-128250592 CAAGAACGGCAGGAGGGGGATGG - Intergenic
998480338 5:142457968-142457990 CAATCATGGCAGAAAGTGGAGGG - Intergenic
999705076 5:154265113-154265135 CAAGAAGGGGAGAACATGTAAGG - Intronic
1000633596 5:163618167-163618189 CAATAAGGGCAGCAGGTGGAGGG + Intergenic
1001413527 5:171527466-171527488 TAAAAAGGGCAGTACGTGGAAGG + Intergenic
1001705066 5:173735593-173735615 CAAGACCTGCAGGACATGGATGG + Intergenic
1001910566 5:175513982-175514004 CACAGACGGCAGAGCGTGGATGG + Intronic
1004013245 6:11709424-11709446 CAATCACGGCAGAAGGTGAAGGG + Intergenic
1005046924 6:21651910-21651932 TAAGAACGGCAGGAAGGGGATGG + Intergenic
1007793803 6:44330869-44330891 CAATCATGGCAGAAGGTGGAAGG - Intronic
1010645689 6:78385891-78385913 CAATCACGGCAGAAGGTGAAAGG + Intergenic
1013048138 6:106507948-106507970 TAAGAACTGCATAACGTGGCTGG + Intergenic
1013164117 6:107574674-107574696 CAAGGATGGGAGAACGAGGATGG - Intronic
1014250541 6:119111417-119111439 GAAAAACGGCTGGACGTGGATGG + Intronic
1014290387 6:119551364-119551386 CAAGAACAGCAGAAAGTCCATGG - Intergenic
1014415463 6:121178020-121178042 CAATCATGGCAGAAAGTGGAAGG + Intronic
1014749525 6:125239402-125239424 CAATTATGGCAGAAGGTGGAAGG + Intronic
1016879877 6:148900527-148900549 CAATCACGGCAGAAGGTGAAAGG - Intronic
1017109564 6:150919599-150919621 CAAGAATGGCAGAAAGTGAAGGG + Intronic
1017219555 6:151950123-151950145 CAATCATGGCAGAAGGTGGAAGG - Intronic
1020950152 7:14665355-14665377 CAACAACGACAGAGGGTGGAGGG + Intronic
1022771765 7:33480959-33480981 CAATCACGGCAGAAGGTGAAGGG - Intronic
1024395202 7:48858721-48858743 CAATCACGGCAGAAGGTGAAGGG + Intergenic
1024509230 7:50190112-50190134 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1024715060 7:52069570-52069592 CAACAACGGCATAATGTTGATGG + Intergenic
1026230758 7:68481700-68481722 CGAGATCGGCAGAAAGTTGATGG - Intergenic
1026529455 7:71184666-71184688 CAAGAAGGGCAAAAAGTGCACGG - Intronic
1026968545 7:74454592-74454614 CCAGACCGGGAGAAGGTGGAGGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030752013 7:113240360-113240382 CAAGCATGGCAGAAGGTGAATGG - Intergenic
1032560220 7:132883077-132883099 CAATTACGGCAGAAGGTGAAAGG - Intronic
1032914420 7:136473268-136473290 CAATAATGGCAGAAGGTGAAAGG - Intergenic
1032977657 7:137243490-137243512 CAAGAATGTCAGAATGTGGTGGG - Intronic
1033020796 7:137722283-137722305 CAAGAACGGCAGTACCCGGGTGG + Intronic
1033841289 7:145377480-145377502 CAATGATGGCAGAAGGTGGAGGG + Intergenic
1033864238 7:145668933-145668955 CAATCACGGCAGAAAGTGAAGGG - Intergenic
1035663808 8:1365521-1365543 CAGGTCCGGCAGAATGTGGATGG + Intergenic
1035737650 8:1900327-1900349 CCAGGACGGCTGAAGGTGGATGG - Intronic
1037068380 8:14612383-14612405 CAATCACGGCAGAAGGTGAAGGG - Intronic
1038922927 8:32105353-32105375 CAATCATGGCAGAAGGTGGAAGG + Intronic
1041775020 8:61514183-61514205 CAAGAATGGGAGCAGGTGGATGG - Intronic
1043030591 8:75129620-75129642 CAAGAATGGCAGAAGGTGAAGGG - Intergenic
1043085416 8:75826094-75826116 CAAGAACAGCACAAAGGGGATGG - Intergenic
1045357959 8:101405977-101405999 CAAGAACGCTAGAACTTGGGTGG - Intergenic
1046300019 8:112275615-112275637 CAATCATGGCAGAAGGTGGAAGG + Intronic
1047173605 8:122519088-122519110 TAAGAATGACAGAACATGGATGG + Intergenic
1047414993 8:124657284-124657306 TAAGAACAGCAGAAAGTTGATGG + Intronic
1052152532 9:25135457-25135479 GAAGAACTACAGAACTTGGAAGG + Intergenic
1052414357 9:28158150-28158172 CAATCACGGCAGAAGGTGAAAGG + Intronic
1053264388 9:36700035-36700057 CAATCATGGCAGAACGTGAAGGG + Intergenic
1054802044 9:69359574-69359596 CAATCACGGCAGAAGGTGAAGGG - Intronic
1055725347 9:79221821-79221843 CAATCACGGCAGAAGGTGAAAGG - Intergenic
1056086918 9:83159986-83160008 CAATCACGGCAGAAGGTGAAAGG - Intergenic
1058531394 9:105908791-105908813 CAAGAAAGGAAGCAAGTGGAGGG + Intergenic
1059617766 9:115969227-115969249 CAATCACGGCAGAAAGTGAAAGG + Intergenic
1060859877 9:126945615-126945637 CAAGTACAGCAGAAAGGGGAAGG - Intronic
1186093068 X:6070751-6070773 CAAGCATGGCAGAAGGTGGCGGG + Intronic
1186541167 X:10402012-10402034 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1187204904 X:17172455-17172477 CAATCACGGCAGAAGGTGAAGGG - Intergenic
1188151430 X:26681088-26681110 CAAGCAGGGCAGAAGGTGAAGGG + Intergenic
1188520502 X:31033050-31033072 CAATAATGGCAGAAGGTGAAAGG + Intergenic
1188786726 X:34355795-34355817 AAAGAACGGAAGAAAGTGTAAGG + Intergenic
1190576719 X:51846790-51846812 CAAGAACAGCACCAAGTGGATGG + Intronic
1192070955 X:67940890-67940912 CAATCACGGCAGAAGGTGAAGGG + Intergenic
1192284299 X:69718017-69718039 CAATCACGGCAGAAGGTGAAGGG - Intronic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1192733652 X:73827112-73827134 CAAGTAGGGCAGAAGGTGGAAGG - Intergenic
1193307611 X:79968051-79968073 CAATAATGGCAGAAGGTGAAGGG + Intergenic
1193667422 X:84338930-84338952 CAATAATGGCAGAAGGTGAAAGG - Intronic
1193806432 X:86001529-86001551 CAATCACGGCAGAAGGTGAAGGG + Intronic
1194376653 X:93142888-93142910 CAATCATGGCAGAAAGTGGAGGG - Intergenic
1196483041 X:116173092-116173114 CAGGAAGGTCAGAACATGGAAGG - Exonic
1197673430 X:129303661-129303683 CAATAATGGCAGAAGGTGAAGGG - Intergenic
1198560015 X:137839399-137839421 CAACCACGGCAGAAGGTGAAGGG - Intergenic
1199203076 X:145116189-145116211 CAATCATGGCAGAAGGTGGAAGG + Intergenic
1200442704 Y:3230864-3230886 CATGCACGGCTGAACCTGGAGGG + Intergenic
1200829871 Y:7679496-7679518 CATAAACGGCAGAAAGTTGAAGG + Intergenic