ID: 1180215015

View in Genome Browser
Species Human (GRCh38)
Location 21:46318274-46318296
Sequence AGTGCCCCAGAAGCCAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 192}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180215008_1180215015 12 Left 1180215008 21:46318239-46318261 CCTGTGGGAAGATAGCCACACCC 0: 1
1: 0
2: 2
3: 8
4: 112
Right 1180215015 21:46318274-46318296 AGTGCCCCAGAAGCCAGCGCTGG 0: 1
1: 0
2: 1
3: 20
4: 192
1180215011_1180215015 -8 Left 1180215011 21:46318259-46318281 CCCTCCCTGGACTGCAGTGCCCC 0: 1
1: 0
2: 4
3: 52
4: 595
Right 1180215015 21:46318274-46318296 AGTGCCCCAGAAGCCAGCGCTGG 0: 1
1: 0
2: 1
3: 20
4: 192
1180215012_1180215015 -9 Left 1180215012 21:46318260-46318282 CCTCCCTGGACTGCAGTGCCCCA 0: 1
1: 0
2: 3
3: 127
4: 3918
Right 1180215015 21:46318274-46318296 AGTGCCCCAGAAGCCAGCGCTGG 0: 1
1: 0
2: 1
3: 20
4: 192
1180215010_1180215015 -3 Left 1180215010 21:46318254-46318276 CCACACCCTCCCTGGACTGCAGT 0: 1
1: 0
2: 7
3: 62
4: 727
Right 1180215015 21:46318274-46318296 AGTGCCCCAGAAGCCAGCGCTGG 0: 1
1: 0
2: 1
3: 20
4: 192
1180215007_1180215015 13 Left 1180215007 21:46318238-46318260 CCCTGTGGGAAGATAGCCACACC 0: 1
1: 0
2: 2
3: 10
4: 94
Right 1180215015 21:46318274-46318296 AGTGCCCCAGAAGCCAGCGCTGG 0: 1
1: 0
2: 1
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180215015 Original CRISPR AGTGCCCCAGAAGCCAGCGC TGG Intronic