ID: 1180222222

View in Genome Browser
Species Human (GRCh38)
Location 21:46366201-46366223
Sequence GCATCCAACCAAGAATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180222222_1180222225 -6 Left 1180222222 21:46366201-46366223 CCTTGGGATTCTTGGTTGGATGC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1180222225 21:46366218-46366240 GGATGCTGGCTCGGACGCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 122
1180222222_1180222228 11 Left 1180222222 21:46366201-46366223 CCTTGGGATTCTTGGTTGGATGC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1180222228 21:46366235-46366257 CTGTGGTGTGAGTAGGAGGTTGG 0: 1
1: 0
2: 6
3: 46
4: 479
1180222222_1180222226 4 Left 1180222222 21:46366201-46366223 CCTTGGGATTCTTGGTTGGATGC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1180222226 21:46366228-46366250 TCGGACGCTGTGGTGTGAGTAGG 0: 1
1: 0
2: 0
3: 8
4: 91
1180222222_1180222227 7 Left 1180222222 21:46366201-46366223 CCTTGGGATTCTTGGTTGGATGC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1180222227 21:46366231-46366253 GACGCTGTGGTGTGAGTAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 169
1180222222_1180222229 30 Left 1180222222 21:46366201-46366223 CCTTGGGATTCTTGGTTGGATGC 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1180222229 21:46366254-46366276 TTGGTTGTGCCTGCCGTGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180222222 Original CRISPR GCATCCAACCAAGAATCCCA AGG (reversed) Intronic
901721435 1:11201433-11201455 GCATCAAACCAACAGTCTCAGGG + Intronic
902272765 1:15316519-15316541 GGATCCCACCAAGAACCTCAAGG - Intronic
905958544 1:42022340-42022362 GCATGGAAGCAAGCATCCCACGG - Intronic
907882576 1:58565024-58565046 GCATGCAACAACGAACCCCAGGG + Intergenic
911049987 1:93662701-93662723 GCTTCCAACCAAGTAACCCCAGG + Intronic
912480330 1:109978032-109978054 GCAACCAACCTGGATTCCCAAGG - Intergenic
916869078 1:168892900-168892922 TCATCCATCCAAATATCCCAAGG + Intergenic
919282165 1:195504582-195504604 GCATCCAATCAAAAATCACCAGG - Intergenic
924808930 1:247384231-247384253 GGAGCCAACCAAGACTCCCCAGG + Intergenic
1063491163 10:6464905-6464927 GCATCCCACCTAGATTCCCCAGG - Intronic
1073452638 10:103618784-103618806 GCATCCAGCCAAGGAGCCCAGGG - Intronic
1073693593 10:105839459-105839481 GCATTCAAGCAATAATGCCAAGG + Intergenic
1073862473 10:107763581-107763603 GCTTTCAACCAATAATCACATGG - Intergenic
1074691762 10:116012174-116012196 GCACCCAACCTAGAATTCTATGG - Intergenic
1075081923 10:119390057-119390079 GCATCCAACCAAGGATCTAAAGG - Intronic
1078057115 11:8018052-8018074 GCATCCAGCCCACAATCACAGGG - Intergenic
1080225487 11:29955678-29955700 GCATGCAGCCAACAATCACATGG + Intergenic
1080849054 11:36052006-36052028 GCATCTAAACAAGCAGCCCAGGG + Intronic
1088187819 11:107193158-107193180 GCAGCCCACCCAGAATCTCAGGG - Intergenic
1089088284 11:115842750-115842772 TCATCCGAGAAAGAATCCCAAGG - Intergenic
1090765729 11:129874452-129874474 GCCTCCATCCCAGAATCCCTAGG + Intronic
1091480958 12:830197-830219 ATATCTAACAAAGAATCCCAAGG + Intronic
1095697902 12:45161445-45161467 TGATCCAACCTTGAATCCCAGGG + Intergenic
1099560668 12:84170652-84170674 GGATCCAGTCAAGAATCACATGG + Intergenic
1105807667 13:23966132-23966154 ACATCAAACCAAAAAACCCATGG - Intergenic
1107664881 13:42678519-42678541 GAATGCAACCAAGCACCCCAAGG - Intergenic
1108337920 13:49465173-49465195 GGATCCAACCTAGACTCCCCAGG + Intronic
1110232145 13:73178221-73178243 GCATCCAATAAAGAATTTCACGG + Intergenic
1111557162 13:89895598-89895620 ACATCCTGACAAGAATCCCAGGG - Intergenic
1114870258 14:26646817-26646839 ACATACAACCAAAAATCCTAAGG + Intergenic
1118841243 14:69514625-69514647 GCATTCAACAAAAAATCACAAGG - Intronic
1118874365 14:69770767-69770789 GCATCCTGCTAAGCATCCCACGG + Intronic
1121712534 14:96050142-96050164 GCATCCAACCAAGAATTATCAGG - Intronic
1126946639 15:53828798-53828820 GCTTCCAACCCAGACGCCCAAGG - Intergenic
1129062787 15:72873646-72873668 ATACCCAACCAAGAACCCCATGG - Intergenic
1132110679 15:99099993-99100015 GGATCCAAGCAACGATCCCACGG - Intronic
1134784967 16:16934003-16934025 GCCTCCAGCCAAGGATACCAGGG - Intergenic
1137553895 16:49458190-49458212 GCATGTAACCAAGAAGTCCAGGG + Intergenic
1147160586 17:38567496-38567518 GCATCCCACCCAGACTCCCCAGG - Intronic
1150102325 17:62434403-62434425 GCATACTCCCAAAAATCCCAGGG + Intronic
1150658517 17:67056233-67056255 GCATCCATGCAGGACTCCCATGG - Exonic
1150956376 17:69865113-69865135 GCATCCCACCAACAATTTCAAGG - Intergenic
1152646200 17:81469594-81469616 GCATCCATCCAGAAATCCCTTGG - Intergenic
1153436301 18:5071536-5071558 GCATTCAACCAAGAACCCAAGGG + Intergenic
1155189340 18:23415541-23415563 GAATCCAAAAAAGAATGCCATGG + Intronic
1159839930 18:73387324-73387346 CCATACATCCAAGAATCCCAAGG - Intergenic
1160786676 19:903373-903395 GCCTCCCACCGAGAATCCAAGGG + Intronic
1163474598 19:17517589-17517611 CCATCCTACTAACAATCCCATGG - Intronic
1164702382 19:30295072-30295094 GCATGCTACCAAGACCCCCAGGG - Intronic
1168026700 19:53648414-53648436 TCATCCAACCAGGAAGTCCAGGG + Intergenic
1168430528 19:56275859-56275881 CCATCCAACCAACATTCACATGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
929122665 2:38496348-38496370 GCATCCCTTCAAGAATGCCAAGG - Intergenic
929292890 2:40213631-40213653 GCATCTGACAAACAATCCCAAGG + Intronic
929803892 2:45127911-45127933 CCATCACACCAAGAAGCCCAGGG + Intergenic
931791818 2:65670524-65670546 CCATCTATGCAAGAATCCCAAGG - Intergenic
932720461 2:74135038-74135060 GCCTCCTACCAAGAATCAAAGGG + Intronic
933731107 2:85456850-85456872 GCATTTAAACAAGAAGCCCAGGG - Intergenic
936490453 2:112966958-112966980 AGATCCAATCAAGAATGCCATGG + Intergenic
938733758 2:134167412-134167434 GCATGCATCCAAGAATCACCTGG + Intronic
940508051 2:154580677-154580699 GCTTTCAACCAAGAATTACAAGG + Intergenic
944341975 2:198612045-198612067 GCATCCCACTAAGAAAGCCAAGG + Intergenic
944423489 2:199556003-199556025 GCAGGCAACCAAAAATCCAAGGG - Intergenic
946529858 2:220559363-220559385 TCAACTAACCAATAATCCCAAGG - Intergenic
946900737 2:224369064-224369086 GCCTCCCACCAAGACTCCTATGG + Intergenic
947809845 2:232997464-232997486 GCATCCAAGCCAGAACCCCCGGG + Intronic
948294882 2:236853281-236853303 GAATCCAAACAAATATCCCATGG + Intergenic
1174823707 20:53749786-53749808 GCTTCCTACCAAGAATAACAGGG - Intergenic
1175127876 20:56765938-56765960 GTATCCAGCCAAAAATCCCAGGG + Intergenic
1177145381 21:17401739-17401761 TCTTCCTACCTAGAATCCCAGGG + Intergenic
1177194417 21:17887703-17887725 GCATTTAACCAAAAATACCATGG - Intergenic
1178343883 21:31808538-31808560 GAAGCCAACCATGATTCCCAAGG + Intergenic
1179091460 21:38269881-38269903 GCATCCCACAGAGAACCCCAGGG - Intronic
1180222222 21:46366201-46366223 GCATCCAACCAAGAATCCCAAGG - Intronic
949694744 3:6681355-6681377 GCATTTTAACAAGAATCCCAGGG - Intergenic
953817009 3:46166688-46166710 TGAACCAACCATGAATCCCAGGG + Intronic
965382462 3:168006859-168006881 GCTTCCAACAAAAAATTCCAGGG + Intergenic
966195688 3:177311699-177311721 GCATCCAACCAAAAGTTCTAAGG - Intergenic
970005476 4:11406766-11406788 GCTTCTTTCCAAGAATCCCATGG + Intronic
973155111 4:46941899-46941921 GCATCAAATCAAGAATCCTGTGG + Intronic
975848051 4:78546210-78546232 GCAGCCACCCCAGAATCACAAGG - Intergenic
977883191 4:102229807-102229829 GCATCCAACCAGGAAACTCTAGG + Intergenic
980643126 4:135604710-135604732 GCATGCAACAATGAACCCCAGGG + Intergenic
981959773 4:150522820-150522842 GAATCCTTCCAAGAGTCCCATGG + Intronic
983523614 4:168737094-168737116 GCATGCAAAAAAGAATACCAGGG + Intronic
985716487 5:1466102-1466124 GCATCCACCCGAGGCTCCCAGGG - Intronic
986694647 5:10340754-10340776 CCATCCAACCAAGGAGGCCAGGG - Intergenic
987382948 5:17302749-17302771 GTATCCACCCAAGATTCCCAGGG - Intergenic
987783384 5:22467089-22467111 CTATCCAATCAAGATTCCCAGGG - Intronic
991488684 5:67163824-67163846 GAATCCCACCAGAAATCCCATGG + Exonic
994938314 5:106285552-106285574 GCATCAAACAAACAATGCCATGG - Intergenic
997524225 5:134542032-134542054 CCAGCCTCCCAAGAATCCCAGGG - Intronic
999371941 5:151061128-151061150 TCAACCAACCAAGAAGCCAATGG + Intronic
1002772395 6:301136-301158 GCTTCCCACCAAGACTCCCTGGG + Intronic
1007203523 6:40131047-40131069 CTATCCTACCAAGAAGCCCAGGG - Intergenic
1008562687 6:52737632-52737654 GCAGCCAAGCAAGGAGCCCAAGG - Intergenic
1012501927 6:99897699-99897721 GGTTACAAGCAAGAATCCCAGGG + Intergenic
1012547614 6:100437264-100437286 ACATCCAACTAAGAAGCCTAAGG + Intronic
1013952394 6:115798951-115798973 GCATTCAACAAAAAATTCCAAGG + Intergenic
1022317175 7:29256484-29256506 GCATACACCCAAAAATCACAAGG - Intronic
1027553673 7:79634593-79634615 GCAGCCATCCAATAAACCCAGGG - Intergenic
1032156309 7:129471643-129471665 CCCTCCAGCCAAGAATCCCATGG - Intronic
1032724546 7:134578412-134578434 GCATTCAAGCAAGAAGGCCAGGG + Intronic
1034159685 7:148983472-148983494 ACATCCATCAAAGACTCCCACGG - Intergenic
1034286165 7:149884634-149884656 GCTTCCATCCCAGAATTCCATGG - Intergenic
1035464618 7:159066373-159066395 GCAGGCATCCTAGAATCCCACGG - Intronic
1036515959 8:9444136-9444158 GCATACCACCACGGATCCCACGG - Intergenic
1036657183 8:10684144-10684166 CCATCCACCCAAGACTGCCATGG - Intronic
1037314324 8:17586389-17586411 ACATCAAACAAAGAATCTCATGG + Intronic
1043229275 8:77780125-77780147 GCATTCACCCAAAAATCCAAAGG + Intergenic
1043945578 8:86248095-86248117 GCATCCAACTTTGCATCCCAGGG + Intronic
1044364124 8:91323508-91323530 ACATACAACCAAGCATTCCAAGG - Intronic
1046405274 8:113764602-113764624 ACAACCAACCAAAAATCCCTCGG + Intergenic
1046514200 8:115237421-115237443 ACATTCAAACTAGAATCCCATGG + Intergenic
1049423586 8:142527355-142527377 GCATCCAAGCAAGACTGGCACGG - Intronic
1050003626 9:1104412-1104434 GCATGCAACCAACAATCATATGG - Intergenic
1051853099 9:21531814-21531836 GCATTTTACCAAGACTCCCAAGG - Intergenic
1054863032 9:69972713-69972735 GCAAATAACCAAGAAGCCCATGG + Intergenic
1056333744 9:85544803-85544825 GAATCAATCCAAGAATACCAAGG + Intergenic
1056810162 9:89757765-89757787 GAATCCAACTGAGAAACCCAGGG - Intergenic
1057172727 9:92973419-92973441 GCATCCAATCAAAAATCACCAGG - Intronic
1057407517 9:94786767-94786789 GGATCCAGGCAAGAAGCCCAGGG + Intronic
1061596001 9:131629396-131629418 GCAACCAAACCAGAACCCCAGGG - Intronic
1188010121 X:25046008-25046030 ACATCCAACCTAGAATCACTGGG - Intergenic
1195405612 X:104509634-104509656 GCCTCCAACCATGAAAGCCAAGG - Intergenic
1200138826 X:153887259-153887281 GCATCCAAGCCAGGATGCCAGGG - Intronic
1201712890 Y:17012046-17012068 CCACCCAACCCAGAAGCCCAGGG + Intergenic