ID: 1180226796

View in Genome Browser
Species Human (GRCh38)
Location 21:46398305-46398327
Sequence GACAGTCCCAGCGAGCGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180226796_1180226803 11 Left 1180226796 21:46398305-46398327 CCCCTGCGCTCGCTGGGACTGTC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1180226803 21:46398339-46398361 TCGCTTTTCTTGCTCTTGTTTGG 0: 1
1: 0
2: 2
3: 27
4: 419
1180226796_1180226804 12 Left 1180226796 21:46398305-46398327 CCCCTGCGCTCGCTGGGACTGTC 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1180226804 21:46398340-46398362 CGCTTTTCTTGCTCTTGTTTGGG 0: 1
1: 0
2: 3
3: 28
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180226796 Original CRISPR GACAGTCCCAGCGAGCGCAG GGG (reversed) Intronic
902783812 1:18720534-18720556 GACAGACCCAGAGAGAGCTGGGG + Intronic
904263683 1:29305561-29305583 GTCAGTGCCAGGGAGCTCAGAGG + Intronic
913187337 1:116380880-116380902 GAAAGTCACAGCAAGGGCAGGGG - Intronic
915283861 1:154840797-154840819 GACAGTACCAGGGAGCAGAGTGG + Intronic
923548078 1:234939339-234939361 TACAGTCCCAGCTACCCCAGAGG + Intergenic
1069818033 10:71211045-71211067 GACAGCCCTAGCAAGGGCAGTGG - Intergenic
1076734319 10:132451976-132451998 GACTGTGGCAGCCAGCGCAGGGG - Intergenic
1079139388 11:17797924-17797946 GACAGTCCCACAGTGGGCAGAGG + Intronic
1079366373 11:19813719-19813741 GACACTCCCAGAGAGGGCATGGG + Intronic
1080006517 11:27413623-27413645 GAAAGTCCCAGCATGCGCTGGGG + Intronic
1084178612 11:67435843-67435865 CCCAGGACCAGCGAGCGCAGGGG - Exonic
1090230570 11:125100190-125100212 GGCAGTCCCAGAGAGCTCATGGG - Intronic
1093154567 12:15665820-15665842 GACGGTCCCAGGGGGCGCAGGGG + Exonic
1095968507 12:47885111-47885133 GACGGTCCCAGCAAAAGCAGTGG - Intronic
1098361072 12:69655197-69655219 GACAGTTTCAGCCAGCGCTGAGG - Exonic
1103298590 12:119909347-119909369 CAAAGTCCCAGCCAGGGCAGTGG + Intergenic
1110974270 13:81808995-81809017 CACAGTCCCAGTGACCACAGGGG + Intergenic
1112436516 13:99394616-99394638 GACAGTCCCAGGGAGAGTTGAGG - Intergenic
1115236519 14:31213347-31213369 TACAGTCCCAGCTAGTCCAGAGG + Intergenic
1122958940 14:105085781-105085803 GCCAGTCCCAGTGAGAGCAGGGG - Intergenic
1124820845 15:33044353-33044375 GCCAGTCCCACAGAGCACAGTGG + Intronic
1125499153 15:40227552-40227574 CAGAGTCCCAGCGAGTCCAGGGG + Intergenic
1126574289 15:50182390-50182412 CTCTGTCCCAGCGAGGGCAGAGG - Exonic
1127779815 15:62302334-62302356 GACAGCCCCAGCGATGGAAGGGG + Intergenic
1128081788 15:64861357-64861379 GAGATTCCCAGAGAGGGCAGCGG + Intronic
1128765550 15:70248941-70248963 CACAGTCCCAGAGAGGGTAGAGG + Intergenic
1131122156 15:89829397-89829419 GGCAGTCCCAGCAAGCACGGCGG - Intergenic
1132622318 16:873646-873668 GAGGGTCCCCGCGAGCGCAGGGG - Intronic
1141823586 16:86463983-86464005 GGCAGCCCCAGAGAGGGCAGAGG + Intergenic
1147872051 17:43594325-43594347 GACAGTCCCAGCCCTCCCAGTGG - Intergenic
1149507140 17:57203783-57203805 CACAATCCCTGCCAGCGCAGAGG - Intergenic
1150144401 17:62755490-62755512 AGCAGGCCCAGCGAGTGCAGAGG - Intronic
1150414511 17:64976002-64976024 GACTGCCCCAGGGAGCGCCGCGG - Intergenic
1150774949 17:68073851-68073873 TACAGTCCCAGCTACCCCAGAGG - Intergenic
1152011443 17:77721237-77721259 GACAGTCCTAGCCAGAGCAGTGG + Intergenic
1152256764 17:79244502-79244524 GGCAGTGCCAGCGAGGGCTGCGG + Intronic
1152715904 17:81900576-81900598 GACAGTCCCAGTGAGAACAATGG - Intronic
1153985887 18:10350685-10350707 GACAGTCCCAGAGAGGCCTGGGG + Intergenic
1160190786 18:76712578-76712600 GACAGGCCCAGCGACCTCACAGG - Intergenic
1162105732 19:8368569-8368591 GAGAGTCCCGCCGGGCGCAGTGG + Intronic
1162921544 19:13906214-13906236 GGCAGACCCGGCGAGCCCAGTGG + Exonic
1163807059 19:19405856-19405878 GACCGGCGCAGCGAGCGCCGCGG + Intronic
1165098507 19:33424118-33424140 GAAAGCCCCAGTGAGGGCAGTGG - Intronic
1168033884 19:53703511-53703533 CACAGTCCCAGCCACTGCAGAGG + Intergenic
925924821 2:8662456-8662478 GGCAGCCCCAGAGAGCGGAGTGG + Intergenic
927082086 2:19640561-19640583 GACACTCCCAGTGAGAGCACTGG - Intergenic
927237326 2:20886054-20886076 GGCAGACACAGGGAGCGCAGAGG - Intergenic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
932430726 2:71672352-71672374 GGCAGGCCCAGGGAGCCCAGAGG - Intronic
932626889 2:73304066-73304088 GACAGTCTCAGCCAACCCAGTGG + Intergenic
934957739 2:98637784-98637806 GACAGTCCCATCTACCTCAGAGG + Intronic
942135003 2:172916389-172916411 AACAGGCCCAGAGAGAGCAGAGG - Intronic
945396265 2:209322980-209323002 GACAGAGACAGCGAGTGCAGGGG + Intergenic
947622728 2:231601108-231601130 GACAGCCCCAGCCAGCCCCGCGG - Intergenic
948931222 2:241133581-241133603 TCCAGTCCCCGTGAGCGCAGGGG + Intronic
949031497 2:241799385-241799407 GACAGACCCAGTGTGTGCAGAGG + Intronic
1179600935 21:42476800-42476822 GACACTCCCGGAGAGCGGAGGGG - Intronic
1179905069 21:44418501-44418523 GACAGTTCCAGCAAAAGCAGCGG + Exonic
1180149788 21:45941563-45941585 GCCTGTCCCAGCGAGCACAGAGG + Intronic
1180226796 21:46398305-46398327 GACAGTCCCAGCGAGCGCAGGGG - Intronic
1182143546 22:27982864-27982886 GACAGCCCGAGCCAGCACAGTGG - Exonic
1184743396 22:46442306-46442328 GGCTGCCCCAGCGAGGGCAGTGG - Intronic
952925085 3:38314619-38314641 CACAGTCGCAGCAAGGGCAGGGG + Intronic
953253388 3:41266187-41266209 GACAGGCCCAGCCAGAGCAGCGG + Intronic
961603837 3:128079162-128079184 GAGAGGCCCAGCCAGGGCAGAGG + Intronic
973195162 4:47431161-47431183 GGCAGTCCCAGGGAGAGCAATGG + Intergenic
976226282 4:82797887-82797909 GAGAGCCCCAGGGACCGCAGAGG + Intronic
981624099 4:146736877-146736899 GTCAGTCCCAGGGAGCCCAGAGG - Intronic
985671958 5:1211246-1211268 GACAGTCCCAGCGAGCAGTGAGG - Intronic
986337550 5:6766697-6766719 GAGAGTGCCAGCGAGGGGAGAGG - Intergenic
987326035 5:16812297-16812319 GGCAGTTACAGCCAGCGCAGAGG + Intronic
999247405 5:150162454-150162476 CCCAGTCCCAGAGAGCACAGGGG + Intergenic
1001518937 5:172377102-172377124 CACTGTCCCAGCCAGAGCAGAGG + Intronic
1012733052 6:102905766-102905788 GACAGTTCCAGCAAGGGAAGAGG - Intergenic
1014297892 6:119642793-119642815 GAAAGTCCCTGCGAGCTTAGTGG - Intergenic
1016240477 6:141923431-141923453 GACAGTCCAAGCTAGCCAAGAGG + Intergenic
1019539644 7:1545915-1545937 GACACTCCCAGGGGGCACAGAGG - Exonic
1023955714 7:44885314-44885336 GACAGCGGCAGCGAGCGCGGCGG - Exonic
1024518869 7:50285195-50285217 AACAATCCCAGTGAGCACAGGGG + Intergenic
1029115885 7:98236851-98236873 GTCACCCCCAGCGAGCTCAGTGG - Exonic
1030524543 7:110637441-110637463 GCCAGCCCCAGTGAGAGCAGAGG - Intergenic
1038687153 8:29729043-29729065 GAGAGTCCCAGGGAGCACAGGGG - Intergenic
1039442517 8:37605042-37605064 GACACCCCCAGTGAGGGCAGCGG + Intergenic
1046974735 8:120261843-120261865 GACATTCCCAGGGAGTTCAGAGG - Intronic
1049747435 8:144268955-144268977 CCCAGCCCCAGCGAGGGCAGTGG + Intronic
1055757243 9:79570680-79570702 GAACGTCCCAGGGCGCGCAGGGG + Intergenic
1057078646 9:92155391-92155413 TACAGTTCCAACGAGCGGAGTGG + Intergenic
1057519961 9:95752404-95752426 GACCGACCCAGGGAGCTCAGTGG + Intergenic
1061648608 9:132027438-132027460 CAGAGTCCCAGAGAGAGCAGAGG - Intronic
1061929915 9:133827172-133827194 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061929959 9:133827364-133827386 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061929998 9:133827556-133827578 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930018 9:133827652-133827674 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930028 9:133827700-133827722 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930039 9:133827748-133827770 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930050 9:133827796-133827818 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930085 9:133827940-133827962 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930096 9:133827988-133828010 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930149 9:133828228-133828250 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930159 9:133828276-133828298 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930172 9:133828324-133828346 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930183 9:133828372-133828394 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930196 9:133828420-133828442 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1061930207 9:133828468-133828490 GTCAGCCCCAGTGGGCGCAGCGG - Intronic
1185720456 X:2377171-2377193 GACAGTCACTGTGAGTGCAGGGG + Intronic