ID: 1180226827

View in Genome Browser
Species Human (GRCh38)
Location 21:46398527-46398549
Sequence TGTCACAGCCAGTATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180226816_1180226827 25 Left 1180226816 21:46398479-46398501 CCTGGCACGTGGTTCCCCAGAGG 0: 1
1: 0
2: 0
3: 21
4: 398
Right 1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 172
1180226820_1180226827 9 Left 1180226820 21:46398495-46398517 CCAGAGGTCTCATCCACAGAGCC 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 172
1180226818_1180226827 11 Left 1180226818 21:46398493-46398515 CCCCAGAGGTCTCATCCACAGAG 0: 1
1: 0
2: 1
3: 33
4: 321
Right 1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 172
1180226822_1180226827 -4 Left 1180226822 21:46398508-46398530 CCACAGAGCCGGAATGCAGTGTC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 172
1180226819_1180226827 10 Left 1180226819 21:46398494-46398516 CCCAGAGGTCTCATCCACAGAGC 0: 1
1: 0
2: 1
3: 31
4: 178
Right 1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180226827 Original CRISPR TGTCACAGCCAGTATGGGCA GGG Intronic
901401786 1:9019631-9019653 AGACACAGCCAGGCTGGGCATGG + Intronic
904216840 1:28927750-28927772 TGTAACAGCCAGTAAGGATATGG + Intronic
904360192 1:29966143-29966165 GGTCAGAGCCAGAATGGGAAAGG - Intergenic
904891774 1:33784608-33784630 TTTCTCTGCCAGTATGGGGAGGG + Intronic
909356505 1:74715809-74715831 TGTCACAGCGACTCTGTGCAAGG - Intronic
912949549 1:114111393-114111415 TGGCACAGCCAGGATGTGGACGG + Intronic
912972556 1:114297703-114297725 GGTCACAGCCAGTAAAGGCAGGG - Intergenic
924152790 1:241145584-241145606 TTTCAAAGCCAGTTTGGCCAAGG + Intronic
924469082 1:244323939-244323961 TTTAACAACCAGTATGGGCCAGG - Intergenic
1065250914 10:23812656-23812678 TGTCACAGCCAGTGGGCACAGGG - Intronic
1065319640 10:24497440-24497462 AGTGACAGCCAGGCTGGGCATGG + Intronic
1068228957 10:54144647-54144669 TGACACAGCAATTATAGGCAAGG - Intronic
1069848506 10:71390089-71390111 TCTCACAGCCAGGATGTGCTGGG + Intergenic
1071329574 10:84546406-84546428 AGTGACAGCCAGACTGGGCAGGG + Intergenic
1075173827 10:120141079-120141101 TGTCATTGTCAGTTTGGGCAAGG + Intergenic
1077652647 11:3987452-3987474 AGTCTCAGGCAGTATGGGGATGG + Intronic
1078024920 11:7685667-7685689 TGTAACATAGAGTATGGGCAAGG - Intergenic
1078195085 11:9130521-9130543 TGTGACAGCCTGTAGGGGTAGGG + Intronic
1078516615 11:12028082-12028104 TGTGCAAGCCAGGATGGGCAGGG + Intergenic
1078563826 11:12396457-12396479 TGACACAGCCAGTGTGTGCTAGG - Intronic
1080569345 11:33542219-33542241 CATCCCAGCCAGTATGGGCAGGG + Intronic
1080787716 11:35490873-35490895 TGTCACTGCCAGTATGACCTTGG - Intronic
1080862258 11:36160050-36160072 GCTCACAGCCAGTAAGGCCACGG - Intronic
1082784683 11:57310369-57310391 TGGACCAGCAAGTATGGGCAAGG - Exonic
1084427992 11:69096040-69096062 TGTCTCCGCCAGGAAGGGCAGGG - Intergenic
1085216878 11:74840723-74840745 TGTTACAGCTGGAATGGGCATGG + Exonic
1085430325 11:76442574-76442596 AGTCACAGGCAGCATGGGAAAGG + Intergenic
1089588437 11:119524561-119524583 TGTCCCGGCCAGCAGGGGCAAGG + Intergenic
1090409578 11:126498610-126498632 TGTCACAGCCAGGAGGGGAAGGG + Intronic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1093532447 12:20183553-20183575 TATCACAGCCACTCTGGGAAAGG - Intergenic
1096004650 12:48159459-48159481 TTCCACAGCCTGTATGAGCAAGG + Intronic
1096579633 12:52576325-52576347 AGCCACAGCAAGGATGGGCAGGG + Intergenic
1097245454 12:57605206-57605228 AGGCACAGCCCGGATGGGCAAGG - Intronic
1100478591 12:94956467-94956489 TGTCTAAGCCAGTTTGGGGAAGG - Intronic
1101095713 12:101338147-101338169 TGCCACAGCCAGTATTGTAATGG + Exonic
1101712006 12:107276275-107276297 TGTCACAGCCCATAATGGCAGGG + Intergenic
1101781877 12:107844699-107844721 CGGCACAGCCAGCATCGGCACGG - Intergenic
1109498537 13:63208447-63208469 TGTCACAGCAAGAAGGTGCAAGG - Intergenic
1111634260 13:90882770-90882792 GATCACAGCCAGTCTGGGCACGG + Intergenic
1112158005 13:96838453-96838475 GGTCACAGCAACTATGGGAAAGG - Exonic
1112321908 13:98415576-98415598 TGTCACATCCAGGGTGGTCATGG + Intronic
1112527172 13:100161202-100161224 TGTGGCATCCAGTGTGGGCAAGG + Intronic
1116224364 14:42129848-42129870 TGTCACAGCCTCTATTGGTATGG - Intergenic
1116873900 14:50092660-50092682 TGTCACCACCAGCCTGGGCATGG + Intergenic
1117377644 14:55130086-55130108 GGGCACAGACAGTCTGGGCAGGG - Intronic
1117705196 14:58458973-58458995 TCTCACAACCACAATGGGCATGG + Intronic
1119465634 14:74855908-74855930 GGTCACGGCCAGTATGGGACAGG - Intronic
1120239105 14:81928918-81928940 TGTCAGAGCCTGGATGGCCAAGG + Intergenic
1121392645 14:93589413-93589435 AGTCTCAGTCAGTATGGGCTGGG + Intronic
1121493123 14:94374095-94374117 TGTTTCAGTCAGGATGGGCAAGG + Intergenic
1121638807 14:95471803-95471825 TGTCGCAGCCAATGAGGGCAAGG + Intronic
1122719184 14:103712666-103712688 TGTCACAGACAGGCTGGGCCTGG + Intronic
1122967932 14:105139912-105139934 TGGCACAGCCAGAAAGGGCCAGG + Intergenic
1123917757 15:25049360-25049382 TTTCACATGCAGGATGGGCATGG - Intergenic
1125769952 15:42158537-42158559 TGGTACAGCCAGTGTGGTCATGG - Intergenic
1126134312 15:45376314-45376336 CGTCACAGCCTGTAATGGCAAGG - Intronic
1126857143 15:52849514-52849536 AGGCACAGCCTGTATGGGCCAGG + Intergenic
1128145439 15:65330154-65330176 TCACACAGCCAGCATGTGCATGG + Intronic
1128604572 15:69027270-69027292 TTTCACAGCAAATATGGGGAAGG + Intronic
1128904811 15:71457431-71457453 AGCCCCAGCCAGAATGGGCAAGG - Intronic
1132933528 16:2470317-2470339 CGTCACAGCACGTTTGGGCAGGG - Intergenic
1133008084 16:2895747-2895769 TGTCACAGGGAGCATGGGCCAGG - Intronic
1133639442 16:7702652-7702674 AGTCACAGCCAATATTGGCCAGG - Intronic
1133741156 16:8652503-8652525 TTTCACAGCAAGCAAGGGCAAGG - Intergenic
1141165796 16:81660201-81660223 TGTCACAGCTAGTATGGCTGGGG - Intronic
1141659516 16:85434525-85434547 TGTCAGAGCCAGGCTGGTCACGG + Intergenic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1142008813 16:87703424-87703446 TGTCACAGCCTGTAAGTGAATGG + Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1143783769 17:9242438-9242460 TGCCACAGCCCTTCTGGGCAGGG - Exonic
1144772655 17:17768640-17768662 AGTGCCAGCCAGGATGGGCAGGG + Intronic
1148699207 17:49577839-49577861 TGCCACACCCAGGATGGCCATGG - Intronic
1149198039 17:54147173-54147195 TGTAACAGCCAGAATGCACAGGG - Intergenic
1151937775 17:77273752-77273774 TGTCACAGTCTCTATGGGCCAGG - Intergenic
1152559079 17:81068866-81068888 GGTCACAGACACTGTGGGCAAGG - Intronic
1158341499 18:56471584-56471606 TGCCACCCACAGTATGGGCAGGG - Intergenic
1163839621 19:19598844-19598866 TGTCTCAGCCCTTATGTGCATGG - Intronic
1164484351 19:28641996-28642018 TGTAACAGTCAGTATGGGCAAGG - Intergenic
1164484366 19:28642067-28642089 TGCAACAGTCAGTATGGGCAAGG - Intergenic
1164520790 19:28977564-28977586 TGTCACAGTCACTGTGGCCAGGG + Intergenic
1166189343 19:41165428-41165450 GGTCACAGTCAGGCTGGGCACGG + Intergenic
925877999 2:8328515-8328537 TGTCACAGCCCATAAGGGGAAGG + Intergenic
926272321 2:11375989-11376011 TGTGACAGGCAGTATGGGTGGGG - Intergenic
926659802 2:15452303-15452325 TATCATGGCCAGGATGGGCACGG + Intronic
928248437 2:29652795-29652817 TGTCACACCCAGAGAGGGCATGG + Intronic
933755498 2:85634963-85634985 TGTCATAGCCACTATTGGCTAGG + Intronic
935160351 2:100524312-100524334 TATCACAGCAAGAATGAGCAGGG - Intergenic
935357025 2:102210812-102210834 GGTCATGGCCTGTATGGGCATGG + Intronic
937661892 2:124439771-124439793 TGTCCCAGCCAGTATTGTAAAGG - Intronic
937880430 2:126860267-126860289 TGCCACAGCCAGTGTGTGCCAGG - Intergenic
944112509 2:196148300-196148322 TGTCACTGCCAGTCTGTGCCTGG - Intronic
946201273 2:218072221-218072243 TCACACAGCCAGTAAGGACAGGG + Intronic
946335444 2:219032439-219032461 TGCCACAGCGAGTGAGGGCAGGG - Intronic
947149994 2:227105777-227105799 TGACAGAGCCAGTAAGGGCCTGG - Intronic
1168763154 20:363423-363445 TGACTCAGCCAGTGTGAGCAGGG + Intronic
1169037209 20:2463158-2463180 TGCCACAGCCAGTATTGCCGGGG - Exonic
1170941824 20:20854366-20854388 TGCCACAGGAAGTATGGGCAAGG + Intergenic
1172138486 20:32704730-32704752 TGACACAGCCACTATGGGGAAGG - Intronic
1172152685 20:32801450-32801472 TGTCACAGACAGCCAGGGCAGGG + Intronic
1172813875 20:37671051-37671073 TGTTACAACCAGGATGGGCTTGG + Intergenic
1176363436 21:6017597-6017619 TGACCAAGCCAGAATGGGCAGGG + Intergenic
1179760082 21:43520948-43520970 TGACCAAGCCAGAATGGGCAGGG - Intergenic
1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG + Intronic
1180982468 22:19885292-19885314 TGTCCCAGCCACGATGAGCAGGG - Intronic
1182281495 22:29220140-29220162 AGACAAAGCCAGTGTGGGCAGGG - Intronic
1182330196 22:29546152-29546174 TGTCCCAGCCAGTCCAGGCATGG - Intronic
1182626178 22:31648203-31648225 TGTCACCAACAGAATGGGCAGGG + Intronic
1183751095 22:39720927-39720949 TGTGACAGCCACTTTGGGAATGG + Intergenic
1183903591 22:41023374-41023396 TGTCCCAGAAAGCATGGGCACGG - Intergenic
1185300578 22:50077901-50077923 TGTCACTGCCAATACGGTCAGGG - Intronic
950327526 3:12125713-12125735 TGTCCCAGACAGGATGGACATGG + Intronic
950645545 3:14374552-14374574 TGCCCCTGCCAGGATGGGCAGGG + Intergenic
950668783 3:14512922-14512944 CAGCACAGCCAGAATGGGCATGG - Intronic
950764684 3:15265097-15265119 TTTCACTGCCAGTATTGCCATGG - Intronic
953057862 3:39402626-39402648 TGTAACAACCAGGCTGGGCACGG + Intergenic
953685315 3:45073569-45073591 TGTCACAGTCAGGATGGTGAAGG + Intergenic
954807878 3:53230816-53230838 TTTCACAGCCAGAAGGGGCCGGG - Intronic
954998956 3:54908796-54908818 ATTCACAGACAATATGGGCATGG - Intronic
960520613 3:118650487-118650509 TGGCAAAGCCAATATAGGCACGG - Intergenic
961475034 3:127140929-127140951 TGGCAGAGCCAGTGTGGACAGGG + Intergenic
961992211 3:131204205-131204227 TGGCACACCCAGGAAGGGCATGG + Intronic
962712585 3:138100310-138100332 TGTCACACTCAGAAAGGGCAGGG + Intronic
968067480 3:195766697-195766719 TGTCCCAGCCAGTGTGGGAGAGG - Exonic
969674059 4:8605260-8605282 TCACACAGCCAGTAAGGCCATGG + Intronic
973260034 4:48153862-48153884 TGTCACAGCCAGAATGATCCAGG - Intronic
979840486 4:125433742-125433764 TCCCACAGACAGTATGGGAAAGG + Intronic
986164170 5:5259053-5259075 CGTCACACCCAGCATGGACACGG - Intronic
986488330 5:8263371-8263393 TGTTAGAGCCAGGATGGGGATGG + Intergenic
986709883 5:10480918-10480940 TCTCACACCCAGTTTGAGCAGGG + Intergenic
992297116 5:75336864-75336886 TATCACAGCCAGGACGAGCACGG + Intronic
992722953 5:79578600-79578622 TGGCACAGTCTGTATTGGCATGG + Intergenic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
995478863 5:112575563-112575585 TTTCACAGCCTGTCTGGGTAAGG + Intergenic
996020586 5:118586859-118586881 CTTCACAGACAGTATGGCCAAGG + Intergenic
996515967 5:124369486-124369508 TGTCCTACCAAGTATGGGCATGG + Intergenic
1000925885 5:167193483-167193505 TGTAACAGACAGAAAGGGCAGGG + Intergenic
1001562267 5:172677472-172677494 GGTCACAGCCAGAATTGGCCAGG + Intronic
1002139431 5:177130038-177130060 TTTCACAGGCAGTATGTGTAGGG + Intergenic
1002330132 5:178435298-178435320 TGTCAGAGCCAGCCTGGGCCAGG - Intronic
1002861950 6:1087187-1087209 TGCCACAGCAAGTGTGGACAAGG - Intergenic
1003179498 6:3779903-3779925 TGTCCCACCCAGTAAGGCCATGG - Intergenic
1003995001 6:11531342-11531364 TGTCAAAGCCAGTATCAGCCTGG - Intergenic
1005015505 6:21371558-21371580 TATCACTGCCAGCCTGGGCAGGG - Intergenic
1005400066 6:25422920-25422942 TTTCACAGCCAGCCTGGCCAGGG + Intronic
1006402135 6:33823961-33823983 AGAGACAGCCAGTGTGGGCATGG + Intergenic
1006988844 6:38195560-38195582 AGTCAGAGCCAGTATGGGGTTGG - Intronic
1008079588 6:47180134-47180156 TGTCAAAGGCAGGGTGGGCATGG - Intergenic
1008093447 6:47315267-47315289 TGCCACAGCCAGTAGTGCCATGG - Intergenic
1010480197 6:76342539-76342561 TGTCCCAGCCTGTGTGGGCTTGG + Intergenic
1011343799 6:86346881-86346903 TGTCCCAGCCAGTCTAGCCATGG - Intergenic
1012142086 6:95636741-95636763 TCTCAGAGCAAGTATGGGCCTGG - Intergenic
1014863265 6:126496745-126496767 TGTCCCAGCCACTCTGGCCATGG - Intergenic
1016017903 6:139204932-139204954 TGCCACAGCCACTGTGGGGATGG - Intergenic
1016145205 6:140662983-140663005 TGTCACAGCAAGTAGGGGTAGGG - Intergenic
1016397216 6:143637554-143637576 TGTCACAGCTTGTATGGGTCAGG + Intronic
1019317305 7:393111-393133 TCTCACAGCCACTCTTGGCATGG + Intergenic
1023073524 7:36460964-36460986 TGTCACAGTCACTATGGGTCAGG + Intergenic
1024969098 7:55052523-55052545 GGACACAGCCAGCACGGGCAGGG - Intronic
1027187101 7:75979268-75979290 TGTCACAGCCACTGTGGCAAAGG - Intronic
1028847034 7:95493049-95493071 TGTCATAGACAGTCTGGGCTGGG - Intronic
1032883516 7:136115010-136115032 TCTCACTGCCAGGCTGGGCAGGG - Intergenic
1034132805 7:148736210-148736232 TATTACAGCCAGTGTTGGCAAGG + Intronic
1036296587 8:7542869-7542891 TGTCCCAGCCTGTATGTCCATGG + Intergenic
1036325979 8:7778150-7778172 TGTCCCAGCCTGTATGTCCATGG - Intergenic
1037251043 8:16894679-16894701 TATCCCAGCCAGAATGGCCATGG - Intergenic
1037567031 8:20126656-20126678 AGCCACAGCTAATATGGGCAGGG + Intergenic
1040893248 8:52339131-52339153 TGCCACAGCCTGGATGGGCTTGG - Intronic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1045826391 8:106403333-106403355 TGTCACAGGCAAGGTGGGCAGGG - Intronic
1046237424 8:111443962-111443984 TGTTTCAGCCAGGATAGGCATGG - Intergenic
1048300368 8:133246833-133246855 TGTCACAGCTGGTAATGGCAAGG - Intronic
1051088403 9:13378822-13378844 TGCCACACCCAGGCTGGGCATGG + Intergenic
1053545139 9:39014972-39014994 TGTCACAGTAGATATGGGCATGG + Intergenic
1053809539 9:41838165-41838187 TGTCACAGTAGATATGGGCATGG + Intergenic
1054621053 9:67349263-67349285 TGTCACAGTAGATATGGGCATGG - Intergenic
1057804287 9:98209521-98209543 TACCACAGCCAGTAAGCGCAGGG + Intronic
1059360425 9:113737898-113737920 AGTCACAGACAGTATAGGAATGG - Intergenic
1059497244 9:114720049-114720071 TCTCACAGCCATTATGGTAATGG + Intergenic
1059721006 9:116960076-116960098 CGTCACAGCCAGGGAGGGCAGGG + Intronic
1060569467 9:124625096-124625118 TGTCACAGAGAGTATAGCCAAGG + Intronic
1061865093 9:133488020-133488042 TGTAGCAGGCAGGATGGGCAGGG - Intergenic
1062332443 9:136050706-136050728 TGTCCCAGCCAGGAGGGGCGGGG - Intronic
1187908262 X:24087259-24087281 TGGCACAGCCTGGCTGGGCATGG - Intergenic
1189219157 X:39356278-39356300 TGTCTCTGCCAGTGTGGGCAGGG + Intergenic