ID: 1180227736

View in Genome Browser
Species Human (GRCh38)
Location 21:46406038-46406060
Sequence TTAGGTTTCCAGTTATTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180227734_1180227736 -1 Left 1180227734 21:46406016-46406038 CCATTTAAAGGTTTGACTCTTGT 0: 1
1: 0
2: 2
3: 21
4: 203
Right 1180227736 21:46406038-46406060 TTAGGTTTCCAGTTATTTCAAGG 0: 1
1: 0
2: 2
3: 28
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180227736 Original CRISPR TTAGGTTTCCAGTTATTTCA AGG Intronic
904798536 1:33075984-33076006 TCTGGTTTCTAGTTACTTCAGGG + Intronic
907151524 1:52292935-52292957 TTTGGTTTCCAATTTTATCAGGG - Intronic
908725281 1:67169320-67169342 TTATTTTTCCATTTATTTCTAGG + Exonic
909004837 1:70263997-70264019 TAGAGTTTCCAGTTATTTCTGGG + Intronic
909297014 1:73963455-73963477 TTACACTTCCATTTATTTCAAGG + Intergenic
909385053 1:75045281-75045303 TGAAGTTTCCAGTTGTATCAGGG - Intergenic
909439029 1:75677580-75677602 TTAGTTTTCCAGTTGTTTTGTGG - Intergenic
910005046 1:82386159-82386181 TTAGATTTTCAGCTTTTTCAAGG - Intergenic
910483972 1:87690298-87690320 TTATGTTTCCAATTATCTCAAGG - Intergenic
910853692 1:91672824-91672846 TTTGGTTTCAAGTTGTTTCATGG - Intergenic
912154684 1:106903468-106903490 TTAGATTTTAAGTTACTTCAGGG - Intergenic
912180867 1:107217731-107217753 TTTAATTTCCATTTATTTCATGG + Intronic
912564650 1:110578841-110578863 TTAGGTTGCCATTACTTTCAAGG + Intergenic
912674683 1:111667766-111667788 TTAGGTTTCCAGTTGTAAAATGG - Intronic
912747795 1:112260077-112260099 TTAGCTTTTCATTTATTTAATGG - Intergenic
913271272 1:117095958-117095980 TAATGCTTCCAGTTATTTCTAGG - Intronic
917483395 1:175432627-175432649 TCAGTTTTCCCATTATTTCAAGG + Intronic
918441173 1:184568604-184568626 ATAGGTTTTAAGTTACTTCAAGG - Intronic
919191200 1:194221848-194221870 TGAGGTTTTCAGTTTCTTCAGGG - Intergenic
920276053 1:204805194-204805216 TTATCTTTCCAGATATTTCTAGG + Intergenic
922623627 1:227014536-227014558 GGAGGTTTGCATTTATTTCATGG - Intronic
923288716 1:232522765-232522787 TTACATTTTCAGCTATTTCACGG - Intronic
923810105 1:237305400-237305422 TTATGTTTCTAGTTATATAAAGG + Intronic
924193693 1:241582920-241582942 ATAGCTTTCCAGGTATTCCAAGG + Intronic
1064881477 10:20059695-20059717 TTAGGTTTCCAGAGTTTTCAGGG + Intronic
1065283993 10:24169525-24169547 TTAGGTATTCAGTTATGGCAGGG - Intronic
1065855424 10:29826385-29826407 TTAGGCTTCAAGTTCTTTGATGG - Intergenic
1066262949 10:33746642-33746664 TTCGGTTCACACTTATTTCAGGG - Intergenic
1066274880 10:33858801-33858823 TTCTGTTGCCAGTTATCTCAAGG - Intergenic
1067920752 10:50454618-50454640 AGAAGTTTCCAGTTAATTCAGGG - Intronic
1068998216 10:63232591-63232613 TTATATATCCAGATATTTCAGGG + Intronic
1070268882 10:74932545-74932567 TTAGTTTTCCATTTAGTTTAAGG - Intronic
1070871830 10:79761347-79761369 TTACTGTTCCAGTTATCTCATGG - Intergenic
1071638750 10:87283519-87283541 TTACTGTTCCAGTTATCTCATGG - Intergenic
1071656490 10:87454433-87454455 TTACTGTTCCAGTTATCTCATGG + Intergenic
1074068358 10:110039755-110039777 TTGGGTCTTCAGTCATTTCAAGG + Intronic
1075132690 10:119754075-119754097 GTCAGTTTCCAGTTATTACAGGG - Intronic
1076837764 10:133029775-133029797 TGAGGTGTCCAGCTGTTTCACGG - Intergenic
1079062430 11:17261103-17261125 TCAGTTTTCCAAGTATTTCAGGG + Intronic
1079478388 11:20855915-20855937 TTAGTTTTCCAGATAGATCAGGG + Intronic
1079650411 11:22921732-22921754 TAATGTATCCATTTATTTCAAGG + Intergenic
1080014638 11:27491573-27491595 TTAGGTTGTCAGTTACTGCATGG - Intergenic
1080080335 11:28209775-28209797 GAATGTTTCCACTTATTTCAGGG - Intronic
1080368217 11:31603368-31603390 TTAAGTTTTCAGTTAGTTCTTGG + Intronic
1081372396 11:42320470-42320492 TTAAGTTTCAAATTATCTCAAGG + Intergenic
1082741790 11:56918886-56918908 TCAGCTTTCAAGTTTTTTCAAGG - Intergenic
1086487752 11:87326707-87326729 TTATTTTTCTATTTATTTCAGGG + Intergenic
1086938821 11:92773742-92773764 TTAGGTTTCTAAATATTTAATGG + Intronic
1087139764 11:94753899-94753921 TTAAGTTACCAGTTCTTTGAGGG - Intronic
1087187402 11:95215698-95215720 ATTGGTTTACAGTTATTTCTAGG - Intronic
1087529972 11:99368097-99368119 TTATGATTCCAGTTTTTTCAAGG - Intronic
1091756681 12:3057142-3057164 TTATGTTTCCAGTTTATTGAAGG + Intergenic
1093402927 12:18768261-18768283 TTATCTTTTCAGTCATTTCATGG + Intergenic
1093405527 12:18799774-18799796 TTAGGCTGGCTGTTATTTCATGG + Intergenic
1093923070 12:24881401-24881423 TTTGATCTCCAGTTATTTGAAGG - Exonic
1097405880 12:59189424-59189446 TTAGTTTGCAATTTATTTCAAGG + Intergenic
1097633175 12:62089109-62089131 TTCGTTTAACAGTTATTTCAGGG - Intronic
1097877639 12:64658139-64658161 TTAGGTTTCCAGACATCTGACGG - Intronic
1098189623 12:67934523-67934545 TTAGGTTTGGAGTAATTTCTTGG - Intergenic
1099070721 12:78042903-78042925 TTAGGATCCTAATTATTTCAAGG - Intronic
1101799858 12:108011888-108011910 TGATGTTTCCATTTATCTCAGGG + Intergenic
1102266010 12:111485625-111485647 TTAGGTTTTCAGTGACTTGAGGG - Intronic
1102277158 12:111591319-111591341 TTACGTTTCTATTTATTTCAAGG + Intronic
1102709307 12:114911574-114911596 TTAAGTTTCCATCTATTTCAGGG - Intergenic
1104019843 12:124984646-124984668 TTAAATTTCCTGTTGTTTCATGG - Intronic
1104796071 12:131519906-131519928 TTAGGTTTCCTGTTTCTTCATGG - Intergenic
1105771096 13:23612521-23612543 TTGAATTTCTAGTTATTTCATGG + Intronic
1106960633 13:34993245-34993267 TTATTTTTTCAGTTATTTCATGG + Intronic
1107204962 13:37773201-37773223 TTAGGTTTCTAGACATGTCAGGG + Intronic
1108883245 13:55147428-55147450 TTAGGTTTTCAGGTTTCTCAGGG - Intergenic
1109418965 13:62084794-62084816 TTAGGCTTACAGTTATAACAAGG - Intergenic
1109818162 13:67615207-67615229 TTAAATTTCCAGTTCTTCCAAGG - Intergenic
1111093698 13:83481084-83481106 TTAGTTTTGCAGTGATTTCTGGG + Intergenic
1111668316 13:91297212-91297234 TTGGATTTCAAATTATTTCAAGG + Intergenic
1112425313 13:99292960-99292982 TTAGCTTTACATTTATTTCCGGG - Intronic
1112473022 13:99706416-99706438 CTGGGGTTCCAGTTATTTCAAGG + Intronic
1112877289 13:104059400-104059422 TTAATTTTCCAGTTCTTTCAAGG + Intergenic
1112944327 13:104907924-104907946 TCAGGTTTCAAATTACTTCATGG + Intergenic
1113086502 13:106574471-106574493 TTTTGTTTCCATTAATTTCAGGG + Intergenic
1113154840 13:107308137-107308159 TGAGATTTCCAGTGATTTCCTGG - Intronic
1114904427 14:27108401-27108423 AAAGGTTTTCAGATATTTCAAGG - Intergenic
1115405008 14:33005521-33005543 TTGGGGTTCCAGCTATCTCAGGG - Intronic
1117290861 14:54331157-54331179 GGAAGTTTCTAGTTATTTCAGGG + Intergenic
1121891324 14:97593903-97593925 TTAGGTTTACATTCATTCCAAGG + Intergenic
1122353081 14:101108743-101108765 CTAGGTTTGCAGTTATTTGGAGG - Intergenic
1124081597 15:26503692-26503714 TTATCTATCAAGTTATTTCACGG + Intergenic
1126103070 15:45130977-45130999 TGAGCTTTCCAGTTATGGCAGGG + Intronic
1128294856 15:66509707-66509729 TTAGTTTGCTAATTATTTCATGG - Intronic
1129636893 15:77329363-77329385 TTAGGCTTCCAGATAATTAAGGG + Intronic
1129959593 15:79671507-79671529 TTAGATTTTTACTTATTTCAAGG + Intergenic
1132187104 15:99810098-99810120 TTAGTTTTACAGTAATTTTAAGG - Intergenic
1134586829 16:15418756-15418778 TTAGGTTTTCTGTTACTTGAAGG + Intronic
1135005252 16:18815448-18815470 TTGTGTTTTCAGTTCTTTCAAGG + Exonic
1136527091 16:30838424-30838446 TTAATATTCCAGTTACTTCAGGG + Intronic
1138627092 16:58261080-58261102 CTAGTTTACCAATTATTTCAAGG - Intronic
1138728105 16:59163013-59163035 TTGGTTTTACAGTTATTTGAGGG - Intergenic
1139114251 16:63930087-63930109 TCAGCTTTCCAGTAATTTAAAGG - Intergenic
1141084455 16:81081985-81082007 TCAGGTTTCCACTTAAGTCATGG - Exonic
1143939779 17:10528390-10528412 AAAGGTCTCCAATTATTTCAAGG - Intronic
1145728765 17:27156861-27156883 TTTGGCTGCCAGGTATTTCAGGG - Intergenic
1146745104 17:35321764-35321786 TGAGGTTTCCAGTCAGTTCCAGG + Intergenic
1147471812 17:40669445-40669467 TTAGGTTTAGATTTATTTCTGGG - Intergenic
1148605982 17:48929163-48929185 TTCGGTTTCCAGACAATTCATGG - Intergenic
1149592179 17:57838432-57838454 TTAGGTTTCTGGTTTTTTAAGGG - Exonic
1151219585 17:72602580-72602602 TTTGAATTCCAGTTATTCCAAGG - Intergenic
1153106315 18:1531860-1531882 TTAGTTTTCCAGTTAACTGAGGG + Intergenic
1153865265 18:9261897-9261919 ATAGGCCTCTAGTTATTTCAAGG - Intronic
1155282566 18:24255148-24255170 TCAGGTTTTCAGTTTCTTCATGG - Intronic
1155562675 18:27096225-27096247 CTCTGTTTCCATTTATTTCAAGG - Intronic
1156032889 18:32733485-32733507 TTATGTTTCCAGCTACTCCAAGG - Intronic
1159662280 18:71112984-71113006 TTAGCTTTCCATTTACTTCAGGG - Intergenic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1165156775 19:33793525-33793547 TCAGGTTTCCAGATGTTTCAAGG - Intergenic
926254413 2:11177599-11177621 TTTTGGTTCCAGTTATTTCTGGG - Intronic
926771532 2:16381248-16381270 TTACTTTTCTAATTATTTCAAGG + Intergenic
927723196 2:25400491-25400513 TCAGGTTTCCTGTAATCTCAGGG - Intronic
928715243 2:34052793-34052815 TTGTGTTTCCATTTGTTTCAAGG + Intergenic
931105943 2:59055881-59055903 TTGGGTTAGCAATTATTTCAAGG - Intergenic
931383670 2:61777226-61777248 TTATGTTTTCATTTATTTCAAGG - Intergenic
931849299 2:66236628-66236650 TTAGCTTTACAGTGATTTCAAGG + Intergenic
932633426 2:73367000-73367022 TAAGGTATCCAGTAATTTCAAGG - Intergenic
932638927 2:73421809-73421831 CTAGATTTGCAGTAATTTCAGGG + Intronic
932653086 2:73581232-73581254 TTTGGTTTTCAGTATTTTCAAGG + Intronic
933491914 2:82995996-82996018 GTAAGTTTCAAGATATTTCATGG + Intergenic
934743169 2:96740447-96740469 ATAGTTTTCCAGCTATTTTACGG - Intergenic
937399379 2:121568615-121568637 TTAAGTTTCCATTTAGTTAATGG + Intronic
937581148 2:123489562-123489584 TGAGCTTTCTAGATATTTCAGGG - Intergenic
937738956 2:125326063-125326085 TCTCTTTTCCAGTTATTTCACGG + Intergenic
940923854 2:159341809-159341831 TTCTGTTTTCATTTATTTCAAGG - Intronic
943040052 2:182793710-182793732 TTAGGTTGCAATTTATTACATGG + Exonic
943045444 2:182855402-182855424 CTATCTTTCCATTTATTTCAAGG - Intronic
946936580 2:224727657-224727679 TTAGGTTTTCAGTTTCTTCATGG + Intergenic
948634789 2:239328147-239328169 TTGGGCCTCCAGTCATTTCAGGG - Intronic
1169360241 20:4942400-4942422 TCAGGTTTACATTTATTTCCAGG - Intronic
1169584815 20:7069356-7069378 TTGGGTTTCCATTTATCACAGGG + Intergenic
1169857700 20:10121873-10121895 TTAGGTTTCAAATGAATTCAGGG - Intergenic
1169912738 20:10660600-10660622 TAAGCTTTCCACTTATTTCCGGG + Intronic
1170115391 20:12853011-12853033 TTTAGTTTCCAGATATTTGAAGG - Intergenic
1171241637 20:23572893-23572915 TTAGGTTTTCTGTTTTTTCTTGG + Intergenic
1171459351 20:25290211-25290233 TTAGGTTTTCAGAAATTACAAGG - Intronic
1173877673 20:46385406-46385428 TTAGGTATTCAGTAAATTCAGGG - Intronic
1175748745 20:61480370-61480392 TTGGGTTTCCCGTTGTTCCAAGG + Intronic
1177005156 21:15663582-15663604 TCAGGTCTCCAGTTCTTCCAAGG - Intergenic
1177282691 21:19004169-19004191 TGAGGTTTCCAGTTACTTGCAGG - Intergenic
1177313930 21:19431998-19432020 TTAGGTTTCACATGATTTCAAGG - Intergenic
1178642813 21:34359894-34359916 TTTGGTTTTCAGATATATCAAGG + Intergenic
1180227736 21:46406038-46406060 TTAGGTTTCCAGTTATTTCAAGG + Intronic
1180734582 22:18006431-18006453 CTAAGTGTCCAGTTATTTCTGGG - Intronic
1180762438 22:18220454-18220476 GCAGGTTTAAAGTTATTTCACGG + Intergenic
1180773230 22:18404154-18404176 GCAGGTTTAAAGTTATTTCACGG - Intergenic
1180804583 22:18653703-18653725 GCAGGTTTAAAGTTATTTCACGG - Intergenic
1180806165 22:18715707-18715729 GCAGGTTTAAAGTTATTTCACGG + Intergenic
1181217113 22:21341488-21341510 GCAGGTTTAAAGTTATTTCACGG + Intergenic
1181344039 22:22204082-22204104 TAAGGTTTTCAGACATTTCAAGG - Intergenic
1203235060 22_KI270731v1_random:145136-145158 GCAGGTTTAAAGTTATTTCACGG - Intergenic
949507414 3:4740570-4740592 TTTGGCTTCCAGGCATTTCAGGG - Intronic
949903696 3:8840666-8840688 CTAGGTTTTCAGTGATTACAAGG - Intronic
953731446 3:45452861-45452883 TCAGGTTTTCAATTACTTCATGG + Intronic
955510894 3:59679371-59679393 CTAGGTTTCCAGGTGTTTCTAGG + Intergenic
955914895 3:63897390-63897412 TTAGGTTTTAAGTTATTCCCAGG - Intronic
956019484 3:64918574-64918596 TGAGGTTTAAAGTAATTTCAAGG - Intergenic
957456218 3:80451047-80451069 TTAGGTTTGCTTTTATTTTATGG - Intergenic
957833655 3:85555704-85555726 TTAGGTTGCCATTTGTTCCAAGG + Intronic
957864934 3:86010539-86010561 TTAGGTTAGCTGTTATTTCTAGG - Intronic
957947051 3:87078353-87078375 TTTGGCTTCCACATATTTCATGG - Intergenic
958509003 3:95021443-95021465 TTAGGATTTCTGTTATTTCCTGG + Intergenic
958886186 3:99730023-99730045 TTTGGTTTCAAGTTTTTTAAGGG - Intronic
960556180 3:119033595-119033617 GCATGTTTCCAGTCATTTCATGG - Intronic
960893721 3:122479013-122479035 TGAGCTTATCAGTTATTTCATGG - Intronic
963933570 3:151029091-151029113 CAAGGCTTCCAGTTAATTCATGG + Intergenic
964022421 3:152029319-152029341 TTGGATTTCCATTAATTTCAGGG - Intergenic
964857197 3:161159435-161159457 TAAATTTTCCAGTTAGTTCATGG - Intronic
965967554 3:174512892-174512914 ATAGGTTTCCACTTAAATCAAGG - Intronic
966049599 3:175598467-175598489 TTAGTTTTCTACATATTTCAAGG + Intronic
966792273 3:183684622-183684644 TTATCCTTCCAGTTATTTTATGG - Intergenic
968182617 3:196607805-196607827 TAAGATTTCCATTCATTTCAAGG - Intergenic
970066344 4:12098476-12098498 TTAGATTGCCAGATATTTCATGG + Intergenic
971959149 4:33462648-33462670 TGAGGTTTTGAGTTGTTTCATGG + Intergenic
973812848 4:54589103-54589125 TTAGGATTCCAATTACTTCTGGG - Intergenic
974943440 4:68496409-68496431 GAAGGTTTCAAGGTATTTCAAGG + Intronic
976135383 4:81930503-81930525 TTATGCTTCCAGTTAATTTAGGG - Intronic
977530877 4:98199437-98199459 TTAGTTTCTCAGTGATTTCAAGG + Intergenic
978034187 4:103974231-103974253 TTAGGTTGCTAGTTAGTTCCTGG - Intergenic
978661747 4:111135841-111135863 TTTGTTTTCTAGTTGTTTCATGG + Intergenic
978891168 4:113829765-113829787 AGAGGTTTGCAGTAATTTCAAGG + Intergenic
978980001 4:114932607-114932629 TTAGTTTAACAGTTTTTTCAAGG - Intronic
980985591 4:139691563-139691585 ATGGGATTCCAGGTATTTCAAGG + Intronic
981349736 4:143715790-143715812 TTAGGAATCTTGTTATTTCATGG + Intergenic
982274204 4:153622848-153622870 TGAGGTTGACAGTTGTTTCAGGG + Intronic
982341890 4:154308900-154308922 TAGGGTTTCCGGTTATATCAAGG - Intronic
983676679 4:170302755-170302777 TTACTTTGCCATTTATTTCAAGG + Intergenic
983830218 4:172317479-172317501 TTTATTTTCCAGTTATATCATGG + Intronic
984749334 4:183256767-183256789 TTGGGGTTCCCATTATTTCAGGG + Intronic
984756526 4:183330369-183330391 TTAAGTTTCCAGTTAACACATGG + Intergenic
985200759 4:187482753-187482775 GTAGGTTTCAAGTTATTTTTTGG + Intergenic
986358410 5:6951463-6951485 TTAGGTTTCCAGTGAAAACAAGG + Intergenic
986886911 5:12249957-12249979 TTAGGTTTCCAGTTTTCATAAGG - Intergenic
986970338 5:13327642-13327664 CTAGATTTCCAGTTTATTCAGGG - Intergenic
987164256 5:15177785-15177807 TTAGGTTTTGAATTTTTTCATGG - Intergenic
988388311 5:30595168-30595190 TTAGTATTCTAGTTATTACAGGG + Intergenic
989990479 5:50758250-50758272 TTAGTTTTCCAATATTTTCATGG - Intronic
990302906 5:54466503-54466525 TAAGGTTTCTAGTTATTTTGAGG + Intergenic
990804256 5:59640482-59640504 GTAGGTTTCAAGCCATTTCACGG + Intronic
991403042 5:66274150-66274172 TGAGGTATCCAGCTATTTAATGG - Intergenic
991693249 5:69245744-69245766 TTAGGTTTTCAGTTTTTTCATGG + Intronic
992464476 5:76990174-76990196 TGAGGTGTCCAGATATTTCTGGG - Intergenic
992587465 5:78255192-78255214 TTTGTTTTCTAGTTATTTTATGG - Intronic
993477038 5:88378987-88379009 ATAGGTTTTGTGTTATTTCAAGG - Intergenic
993517719 5:88858326-88858348 GTACTTTTCCAGTCATTTCAGGG + Intronic
993603241 5:89954850-89954872 TTAGGTTTCCAATTAATTCAAGG + Intergenic
993838994 5:92852709-92852731 TTATGTTTGCAGTTATAACAGGG + Intergenic
994768124 5:103947432-103947454 TTCTGTTTCTAATTATTTCAAGG + Intergenic
995539913 5:113175340-113175362 TTAGTTTTCCTTTGATTTCAGGG + Intronic
995572832 5:113499140-113499162 TTAGGTTTGCAGTTTCTTCATGG + Intergenic
996100214 5:119437608-119437630 TGAGCTTTCCACATATTTCAGGG + Intergenic
997711983 5:136013401-136013423 TTAGGTTTCCTGTGCTTTCGAGG + Intergenic
1000067719 5:157709865-157709887 TGAGGTTTTCAGTTATTTGCAGG + Intergenic
1001427569 5:171633663-171633685 TTAGAATCCCAGTGATTTCAAGG + Intergenic
1001766814 5:174255589-174255611 TTAGGATTCCAACTATATCAAGG + Intergenic
1004089977 6:12491001-12491023 TTTTGTTTCCTGTTATTGCAGGG - Intergenic
1004231709 6:13839795-13839817 TTTTTTTTCCAGTTATTCCAGGG + Intergenic
1005750652 6:28879327-28879349 TCCAGTTTCCAGTTATTTAAAGG + Intergenic
1005777033 6:29145240-29145262 TTAGGTTTTCAATTGTTACAGGG + Intergenic
1007288358 6:40764778-40764800 TTGGATTTCCAGTTATTGAATGG - Intergenic
1008469813 6:51871976-51871998 TTAGGCTTCTATTTGTTTCATGG - Intronic
1009446210 6:63745225-63745247 TTAGGGTTCCAGTTTTTTGGTGG - Intronic
1009581632 6:65542655-65542677 TTAGATTTTAAGTTATTTAAGGG + Intronic
1011022435 6:82829292-82829314 TTAGCTTTACAGCCATTTCAAGG + Intergenic
1011226122 6:85109200-85109222 TTAGCTTTCCCTTTATTTCAGGG - Intergenic
1011562629 6:88637132-88637154 TTTGCTTTCCTGTTATTTCCTGG + Intronic
1011991485 6:93524433-93524455 TTAGGTTTCCAGAGCTTACAGGG + Intergenic
1012591788 6:100990681-100990703 CCAGGTTTCCAGTTGTTTTATGG + Intergenic
1014170278 6:118271041-118271063 TTACTTTTACATTTATTTCAAGG + Intronic
1014395455 6:120922766-120922788 TCAGTTTTCCAGTTATGTAATGG + Intergenic
1014561296 6:122893995-122894017 TTAGGTTTCCAGAGATGTCAGGG - Intergenic
1014833864 6:126135433-126135455 TTAGGTTTTCTATTTTTTCATGG - Intergenic
1015831179 6:137370614-137370636 TAAAATTTCCAATTATTTCAGGG - Intergenic
1016591157 6:145745165-145745187 TTATGCTTCCATTTATTTTATGG - Intergenic
1017510591 6:155111423-155111445 GTTAGTTTCCTGTTATTTCAGGG - Intronic
1018286964 6:162250860-162250882 TTAGGGCTCTAGTTATTTCCAGG + Intronic
1020979477 7:15050247-15050269 TTAGGATTGCAGTTGTTTCCAGG - Intergenic
1023010545 7:35921482-35921504 TCAGATCTCCAGTTATATCAAGG - Intergenic
1023963557 7:44948388-44948410 TTAGGGTTACAGTTAGTTTAGGG - Intergenic
1025056066 7:55766050-55766072 TCAGATCTCCAGTTATATCAAGG + Intergenic
1025124184 7:56331579-56331601 TCAGATCTCCAGTTATATCAAGG - Intergenic
1028445417 7:90916437-90916459 TTAACTTTACTGTTATTTCAAGG + Intronic
1032318057 7:130859357-130859379 TTAGGTTTTCTGTTTCTTCATGG - Intergenic
1032497515 7:132373837-132373859 TTAGGTTTTCTGTTCTATCAGGG + Intronic
1032529975 7:132611917-132611939 CTTGGTCTCCAGTGATTTCATGG - Intronic
1032767412 7:135010654-135010676 TTATGTTTGCAAATATTTCAGGG + Intronic
1035247109 7:157569971-157569993 ATAGGATTCCAGTCATTTCTTGG - Intronic
1037508232 8:19554570-19554592 TTATGCTTACAGTTATTTCCTGG - Intronic
1039664439 8:39508490-39508512 TTATGCTTTCACTTATTTCAAGG - Intergenic
1041436056 8:57842875-57842897 TCATGTTTCTAGTCATTTCAAGG + Intergenic
1042374552 8:68034778-68034800 TCATGTTTCTTGTTATTTCATGG + Intronic
1043348581 8:79330764-79330786 TGAGATTTGCATTTATTTCAAGG - Intergenic
1043548084 8:81337565-81337587 TTAGATTTCCATTGATTTAAAGG + Intergenic
1046872135 8:119215391-119215413 GTTGGTTTCCATTCATTTCAAGG + Intronic
1047544243 8:125799910-125799932 TTTTGGTACCAGTTATTTCAGGG - Intergenic
1048073960 8:131048592-131048614 TCAGGATTCCAGTTATATCGGGG + Intergenic
1048538364 8:135318853-135318875 TTAGGTTCCCAAATACTTCAGGG + Intergenic
1050807564 9:9700867-9700889 TTAGATTGTCAGTTATTTGATGG - Intronic
1050840126 9:10138334-10138356 TTAGGTTTTTAATTTTTTCATGG - Intronic
1051500780 9:17775533-17775555 TCAGTTTTTCAGGTATTTCAGGG + Intronic
1052374180 9:27699043-27699065 GCAGGTTTACAGTTATTTTATGG + Intergenic
1052809977 9:33049572-33049594 CTAGCTTATCAGTTATTTCATGG - Intronic
1053556318 9:39141234-39141256 TCAGGTATTCAGTTATTACAGGG - Intronic
1053617761 9:39786604-39786626 TCAGGTTTCCTGTTTCTTCATGG + Intergenic
1053820429 9:41961489-41961511 TTAGGTATTCAGTTATTACAGGG - Intronic
1053875946 9:42545973-42545995 TCAGGTTTCCTGTTTCTTCATGG + Intergenic
1053896714 9:42748666-42748688 TCAGGTTTCCTGTTTCTTCATGG - Intergenic
1054089291 9:60829617-60829639 TTAGGTATTCAGTTATTACAGGG - Intergenic
1054110702 9:61105175-61105197 TTAGGTATTCAGTTATTACAGGG - Intergenic
1054235753 9:62555749-62555771 TCAGGTTTCCTGTTTCTTCATGG - Intergenic
1054266399 9:62920827-62920849 TCAGGTTTCCTGTTTCTTCATGG - Intergenic
1054610155 9:67225950-67225972 TTAGGTATTCAGTTATTACAGGG + Intergenic
1055368337 9:75570216-75570238 AAAGGTTTCCAGTTATTTGGAGG + Intergenic
1056209102 9:84348494-84348516 TTATGTTTACAGCTATCTCATGG + Intergenic
1058388270 9:104463811-104463833 CTAGATTTCCAGATATTTAAGGG + Intergenic
1059123871 9:111665109-111665131 TTAATTTTCCAGTTATTTGGAGG + Intronic
1059818200 9:117941784-117941806 TTATGTTTCTAGTTACTTCTGGG - Intergenic
1059818957 9:117950477-117950499 CTAGGATTCCAGTGATTTTAAGG - Intergenic
1061640383 9:131949776-131949798 TGGGGTTTCCAGTTTCTTCAAGG + Intronic
1185972310 X:4679005-4679027 TTATGTTTTCAGTTATTATATGG + Intergenic
1186712008 X:12208039-12208061 TTAGTTTTGCCATTATTTCAAGG - Intronic
1186737628 X:12482254-12482276 TCAGGTTTACAGTTCTTTCAGGG - Intronic
1188119789 X:26290182-26290204 TTAGGATTCCTATTTTTTCATGG + Intergenic
1191152294 X:57232585-57232607 TGATGTTTCCAGTTATTTCTAGG + Intergenic
1191922018 X:66267028-66267050 TTGGGTTTCTACTTCTTTCAAGG + Exonic
1192024752 X:67437635-67437657 TAAGCTTTCCACTTATTTCCTGG + Intergenic
1193182946 X:78480276-78480298 TGAGGGTTCCAGTTTCTTCAAGG - Intergenic
1193563132 X:83044505-83044527 TTAGGTTTCCTGTTCTTGCAGGG + Intergenic
1193622214 X:83768971-83768993 TTAGGTTTCCTATTGCTTCAAGG + Intergenic
1194842861 X:98766009-98766031 TTATGTTTTCAATTTTTTCAAGG + Intergenic
1194860134 X:98989112-98989134 TTAGGTTAACAGTTTTTTCTTGG - Intergenic
1195296527 X:103483956-103483978 TAAGGTTTCCTGTTTTTTCTCGG + Intergenic
1196208425 X:112967669-112967691 TTAGGTTTTCAGTTATTGGCAGG + Intergenic
1196348021 X:114689884-114689906 TTAAGTTTGCAGTTATTGCTGGG + Intronic
1196693660 X:118587728-118587750 TTATGCTTCCAATTAGTTCATGG - Intronic
1198850324 X:140959688-140959710 ATAGTTTTCCAGTTTTTTCTTGG + Intergenic
1200918201 Y:8589989-8590011 TTTGGCTGCCAGGTATTTCAGGG + Intergenic
1200927868 Y:8670774-8670796 TTTGGTTGCCAGGGATTTCAGGG + Intergenic
1200928483 Y:8675696-8675718 TTTGGCTGCCAGGTATTTCAGGG + Intergenic
1200981125 Y:9264092-9264114 TTTGGTTGCCAGTAATTTCAGGG - Intergenic
1202129300 Y:21595648-21595670 TTTGGCTGCCAGTAATTTCAGGG + Intergenic