ID: 1180228621

View in Genome Browser
Species Human (GRCh38)
Location 21:46413139-46413161
Sequence GTGTCCAGCCTCTCCCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 4, 1: 0, 2: 1, 3: 8, 4: 120}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180228621_1180228627 -6 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228627 21:46413156-46413178 GGACACGCGGCAGCAAGGTGTGG 0: 5
1: 2
2: 0
3: 11
4: 140
1180228621_1180228636 24 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228636 21:46413186-46413208 GGAAGGCACGAGGCCCACCCGGG 0: 4
1: 0
2: 1
3: 19
4: 196
1180228621_1180228633 7 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228633 21:46413169-46413191 CAAGGTGTGGGGAGCGGGGAAGG 0: 3
1: 4
2: 11
3: 176
4: 1948
1180228621_1180228632 3 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228632 21:46413165-46413187 GCAGCAAGGTGTGGGGAGCGGGG 0: 3
1: 2
2: 4
3: 39
4: 477
1180228621_1180228631 2 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228631 21:46413164-46413186 GGCAGCAAGGTGTGGGGAGCGGG 0: 3
1: 2
2: 6
3: 47
4: 601
1180228621_1180228628 -5 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228628 21:46413157-46413179 GACACGCGGCAGCAAGGTGTGGG 0: 5
1: 2
2: 0
3: 1
4: 88
1180228621_1180228630 1 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228630 21:46413163-46413185 CGGCAGCAAGGTGTGGGGAGCGG 0: 4
1: 3
2: 6
3: 290
4: 2194
1180228621_1180228634 14 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228634 21:46413176-46413198 TGGGGAGCGGGGAAGGCACGAGG 0: 3
1: 1
2: 4
3: 50
4: 492
1180228621_1180228629 -4 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228629 21:46413158-46413180 ACACGCGGCAGCAAGGTGTGGGG 0: 5
1: 1
2: 0
3: 5
4: 80
1180228621_1180228637 29 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228637 21:46413191-46413213 GCACGAGGCCCACCCGGGAGAGG 0: 4
1: 0
2: 0
3: 12
4: 143
1180228621_1180228635 23 Left 1180228621 21:46413139-46413161 CCCACCCGGGAGAGGCTGGACAC 0: 4
1: 0
2: 1
3: 8
4: 120
Right 1180228635 21:46413185-46413207 GGGAAGGCACGAGGCCCACCCGG 0: 4
1: 0
2: 1
3: 19
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180228621 Original CRISPR GTGTCCAGCCTCTCCCGGGT GGG (reversed) Intronic
900460624 1:2800784-2800806 GTGGCCTGCCTCTGCCGGGAGGG - Intronic
900896115 1:5484101-5484123 GCTTCCAGCCACTCCCGGGGTGG - Intergenic
901226234 1:7614277-7614299 GTGTCCATCCCCTCCCTTGTTGG + Intronic
901448908 1:9324473-9324495 GTGCCCAGCCTCTGGAGGGTCGG + Intronic
903754508 1:25651531-25651553 GTATCCAGCCTTTCCCTTGTTGG + Intronic
907272542 1:53299304-53299326 GTGTGCAGTCTCTACCTGGTGGG - Intronic
907394254 1:54178406-54178428 GTGGCCTGCCTTTCCCTGGTTGG - Intronic
911088104 1:93996320-93996342 TGGGCCAGCCTCCCCCGGGTAGG - Intronic
913186209 1:116373014-116373036 GTGTCCACCGTGTCCCGGGAGGG - Intronic
914852970 1:151328301-151328323 CTGTCCAGCCCCTCCCTGGAGGG - Intergenic
915290453 1:154879652-154879674 GTGGCCAGCGTCTCTCAGGTGGG + Intergenic
916233483 1:162562147-162562169 GAGTGGGGCCTCTCCCGGGTGGG + Intronic
919807176 1:201387017-201387039 GCCTCCAGCCTCTCCTGGATGGG + Exonic
920440453 1:205977221-205977243 TTGTCCACCCTCTCCAGGCTAGG + Exonic
1066653674 10:37681089-37681111 GTTTCCAGCCTCTCCCCGCTAGG - Intergenic
1067038078 10:42933708-42933730 GTTTCCAGCCTCTCCCCGCTAGG - Intergenic
1068690110 10:59906058-59906080 GGGTGCAGCCCCTCCCGGGGCGG + Intronic
1071125673 10:82332151-82332173 GTGTTCAGCCTCTCACAGCTGGG + Intronic
1072543116 10:96413428-96413450 CTGGCCAGCCTCTCCCAGGCTGG + Intronic
1073216554 10:101839896-101839918 GTCTCCGCCCTCACCCGGGTAGG + Intronic
1074136080 10:110627340-110627362 GGGTCCAGCCTCTCTCTGGGAGG - Intergenic
1076109630 10:127850960-127850982 GGGACCAGCCTCCCCTGGGTGGG + Intergenic
1076490986 10:130861488-130861510 GTGCTCAGCCTCTCCCAGCTTGG + Intergenic
1076674122 10:132139622-132139644 CTGTCCAGGCTCTCCCCGCTCGG + Intronic
1076841756 10:133049334-133049356 GTGTCCAGCCTCTTCCCGGGAGG + Intergenic
1083041539 11:59692110-59692132 GTGTCCAGTCTATCCCTGGAAGG + Intergenic
1083853293 11:65379925-65379947 GTCTGCAGCCTCACCTGGGTGGG + Exonic
1083860057 11:65415556-65415578 GTGTCCAGCTAGCCCCGGGTTGG - Intergenic
1085520189 11:77133150-77133172 CTGTCCACCCTCTCCCAGGGAGG - Intronic
1088922195 11:114268302-114268324 TTTTCCAGCCTCTCCCAGCTAGG + Intronic
1091330483 11:134727891-134727913 GTGGCCAGTCCCTCCAGGGTAGG - Intergenic
1094104965 12:26801255-26801277 GTTTCCAGCCAGTCCCAGGTTGG - Intronic
1095859535 12:46901032-46901054 TTCTCCAGTCTCTCCTGGGTCGG - Intergenic
1096495231 12:52036144-52036166 CTGACCAGCCTCTCCTGAGTGGG + Intronic
1097050773 12:56221843-56221865 GGTCCCAGCCTCTCCCGGGAAGG + Exonic
1103191420 12:119005207-119005229 GAATCCATCCTCTCCAGGGTTGG - Intronic
1103219773 12:119234021-119234043 GTGTACAGTCTCCCCAGGGTAGG + Intergenic
1105534836 13:21256291-21256313 GTGTCCTGCCTCTGCAGGTTGGG - Intergenic
1122465921 14:101933473-101933495 GTGTCCAGCCCCTCCAGAGGTGG + Intergenic
1122549023 14:102539998-102540020 GGGTCCAGCCTCTCTGGGCTGGG + Intergenic
1122860822 14:104581709-104581731 GTCTCCAGCTTCTCCCAGGGAGG + Intronic
1130779236 15:87017206-87017228 CTGTCCAGACTCTCCAGAGTTGG - Intronic
1130994598 15:88896856-88896878 CTGTCCATCCTCTCCCCTGTCGG - Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132946762 16:2536124-2536146 CTTTCCAGCCCCTCCCGGGATGG + Intergenic
1136297587 16:29312517-29312539 GTGTCCAGCCTCTCGGGGCAGGG + Intergenic
1137434036 16:48441170-48441192 GTGCCAAGCCTCTACCGAGTAGG + Intronic
1137556324 16:49472698-49472720 GTGCCCAGCCCATCCAGGGTGGG - Intergenic
1137621449 16:49879184-49879206 GTGTCCAGATACTCCCAGGTCGG + Intergenic
1141741752 16:85898417-85898439 GGGACCAGCCGCTCCTGGGTGGG - Intergenic
1141786419 16:86203733-86203755 GGGTCCTGCCTCTCCAGGGGTGG + Intergenic
1141867613 16:86761380-86761402 GTGCCCCTTCTCTCCCGGGTGGG - Intergenic
1142261276 16:89043549-89043571 CTGTCCAGCACCTCCCGGGCTGG + Intergenic
1143203288 17:5126865-5126887 GTGCCCATGCTCTCCTGGGTGGG + Intronic
1144960327 17:19041004-19041026 GTCTCCAGCATCACCCGGGCTGG + Intronic
1144974832 17:19133520-19133542 GTCTCCAGCATCACCCGGGCTGG - Intronic
1147154364 17:38536192-38536214 GTGTCCAGAGTCTCCCGGGAGGG - Intronic
1147265040 17:39229530-39229552 CTGGCCAGCCTCTCCTGGGAAGG + Intergenic
1147998594 17:44374993-44375015 CTGCCCAGCCTCTACCAGGTGGG - Exonic
1148647024 17:49225074-49225096 CTAACCAGCCTCTCCCGGGCGGG - Exonic
1148680826 17:49472626-49472648 GTGGCCACCCCCTCCTGGGTGGG - Intronic
1154000198 18:10476110-10476132 GGTTCCAGCCTCTCCTGGGCAGG - Intronic
1160473867 18:79165771-79165793 ATGGCCAGCCCCTCCTGGGTGGG - Intronic
1160753770 19:747472-747494 GTTACCGGCCCCTCCCGGGTGGG - Exonic
1161056221 19:2191767-2191789 GTGCCCTGCCCCTCCCAGGTTGG + Intronic
1164703529 19:30303163-30303185 GTGTCCAGGGTCTCCTGGGATGG + Intronic
1165336392 19:35173045-35173067 GTTTCCAGCCCCTCCAGGGGTGG + Intergenic
1165851161 19:38851110-38851132 GTGGCCACCCTCTCCAGGGTCGG - Intronic
927096046 2:19748254-19748276 GTGACCTGCCTCTCCCAGGCAGG + Intergenic
927570465 2:24154689-24154711 GTGTCCTGCCTCTCGTGGGAGGG + Intronic
928639997 2:33288334-33288356 GTCTCAAGCCCCTCCCTGGTGGG - Intronic
932345641 2:70993765-70993787 GAGTCCAGCCGCTGCAGGGTGGG + Exonic
936945997 2:117931447-117931469 GTCTCCAGACACTGCCGGGTGGG - Intronic
938790532 2:134671740-134671762 GTGTCAAGCCCCTCAGGGGTGGG - Intronic
948007640 2:234623547-234623569 TTGTTCAGCTTCTCCGGGGTAGG + Intergenic
948763844 2:240209513-240209535 CTGTCCCTCCTCTCCCGGGCAGG + Intergenic
948918193 2:241048881-241048903 GTGGCCAGTCCCTCCTGGGTGGG - Intronic
1175171012 20:57081580-57081602 GTACCCAGCATCTCCCAGGTGGG - Intergenic
1175902741 20:62366549-62366571 GGTTCCAGCCTGTCCCGGGTAGG + Intronic
1176033167 20:63023612-63023634 CTGACCAGCCTCAGCCGGGTTGG - Intergenic
1176042765 20:63073876-63073898 GTGTCCAGCCTGTGCAGGGAGGG - Intergenic
1178486229 21:33021409-33021431 GTGTCTAGCATCTCCTGGGGTGG + Intergenic
1179197943 21:39183388-39183410 GTGTCCAGCCGGTCACGGGGCGG - Exonic
1180228603 21:46413079-46413101 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228621 21:46413139-46413161 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228639 21:46413199-46413221 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1180228657 21:46413258-46413280 GTGTCCAGCCTCTCCCAGGGGGG - Intronic
1180228676 21:46413318-46413340 GTGTCCAGCCTCTCCCGGGTGGG - Intronic
1181048632 22:20228324-20228346 GTCTCCAGCCTCTCCCCCATGGG + Intergenic
1181142801 22:20819636-20819658 GTGTCCAGCATCTCTCAGGTGGG - Exonic
1182097750 22:27637515-27637537 GAGGCCAGCTTCTCCAGGGTGGG - Intergenic
1185021887 22:48381420-48381442 GGGTCGATCCTCTCCTGGGTTGG - Intergenic
1185317388 22:50185048-50185070 GTACCCAGCCTCTACCGGGGCGG - Intergenic
952679573 3:36074891-36074913 TTGTCCTGCCACTCCTGGGTGGG + Intergenic
952716204 3:36483320-36483342 GTGACCAACTTCTCCCAGGTTGG + Intronic
952999570 3:38920272-38920294 GTGTCCAGCTTCCCCCAGGGAGG - Intronic
954288467 3:49636346-49636368 GGGTCCAGCCTCTCCTGGAGAGG + Intronic
961035404 3:123638281-123638303 GTGTCTGGCCCCTCCCAGGTTGG - Intronic
961311715 3:126006502-126006524 GTGTACAGCCTCCCCAGGATGGG - Exonic
966423520 3:179757181-179757203 GTGTGCAGCTTTTCCCAGGTGGG + Intronic
968082552 3:195856806-195856828 GTGTCGGGCCTAACCCGGGTCGG - Intergenic
970513626 4:16805478-16805500 GTGTCCAGTGTCTCCTGGGGAGG + Intronic
982468511 4:155759513-155759535 ATGCCCAGCCTCTCCCGGAGCGG + Intronic
997589463 5:135063932-135063954 GGGGCCAGCTCCTCCCGGGTGGG + Intronic
998156921 5:139792327-139792349 GAGTCAAGCCTCTTCTGGGTTGG + Intergenic
1005992497 6:30912138-30912160 CTGTCCCGCCTCACCCGTGTAGG - Exonic
1007045864 6:38773668-38773690 GTGTCCAGACTCTCAAAGGTGGG + Intronic
1010179196 6:73065499-73065521 GCATCCAGCCTCTTCCTGGTTGG + Intronic
1015366376 6:132401547-132401569 GGGTCCTGCCCCTCCCGGGCGGG - Intergenic
1017028139 6:150198413-150198435 GTGACCATCCTCTCCAGGGAGGG + Intronic
1017385918 6:153883101-153883123 GTATCCAACCCCTCCCAGGTTGG - Intergenic
1018945308 6:168343718-168343740 GTAGCCAGCCTCTCCATGGTTGG + Intergenic
1020785921 7:12571868-12571890 ATGTCCAGCCTCTCCCCAGGAGG + Intronic
1023847419 7:44130335-44130357 GGGTCCAGCCTCAGCCGGGGTGG + Intergenic
1024559749 7:50632893-50632915 GTGACCAGGCTCTCCAGGGCAGG - Intronic
1033210138 7:139454171-139454193 GTCTCCAGGCACTCCTGGGTGGG - Exonic
1035626060 8:1071407-1071429 ATGTGCAGTCTCTCCTGGGTGGG + Intergenic
1035682368 8:1497311-1497333 GCGTCCAGCCTCTCCCTGGGAGG + Intergenic
1040044462 8:42948171-42948193 TTGTCTAGCCTCTCACAGGTAGG - Intronic
1041957057 8:63567689-63567711 GTATCCAGCCTTTCCAGGTTAGG + Intergenic
1045046260 8:98281953-98281975 GTGTCCTGGCTCACCCAGGTGGG - Intronic
1048899488 8:139023986-139024008 GTGTCCCTCCTCACCAGGGTGGG - Intergenic
1057825660 9:98370471-98370493 GTGTCCAACCCCTCCAGAGTTGG - Intronic
1058138737 9:101336162-101336184 GAGTCAAGGCTCTCCAGGGTTGG + Intergenic
1060297017 9:122349850-122349872 GTGCCCAGCCTCACCCAGCTAGG - Intergenic
1060748109 9:126151030-126151052 GTGCCCACCCTCTCCTGGGGAGG + Intergenic
1062384533 9:136303940-136303962 GTGGCCAGCCCATCCCGGGCAGG - Exonic
1062447840 9:136603111-136603133 GGGTCCAGGCCCTCCCGGGAGGG - Intergenic
1062596484 9:137302115-137302137 GCATCCAGCCGCGCCCGGGTGGG + Exonic
1185616951 X:1427830-1427852 CTGTCCCGCCTCTCCCGCCTCGG + Exonic
1187609503 X:20926654-20926676 GTGTCCTGCTTCTACCAGGTGGG + Intergenic
1190282747 X:48941783-48941805 GTTTCCAGCCTCGCCTGGATGGG - Intronic
1199927118 X:152479679-152479701 TTCTCCAGCTTCTCCCGAGTGGG + Intergenic