ID: 1180228870

View in Genome Browser
Species Human (GRCh38)
Location 21:46414455-46414477
Sequence CTGTGTGTCCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 5, 2: 6, 3: 61, 4: 547}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180228870 Original CRISPR CTGTGTGTCCAGGAGGAGGA GGG (reversed) Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901242005 1:7700575-7700597 CTGTGTGACCATGATGAGTAGGG - Intronic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902568186 1:17329209-17329231 CTGTGTATACAGGAGGCTGAGGG + Intronic
902697283 1:18148895-18148917 TTGTGTGTGCAGGGGCAGGAGGG - Intronic
902725471 1:18333029-18333051 AAGTGTGTCCAGGAGGCTGAAGG + Intronic
902767821 1:18629001-18629023 CTGTGTGTCAAGGTGCAGGTGGG - Intergenic
902797146 1:18807284-18807306 CTCTGTGTCCAGCAGGTGGAAGG - Intergenic
902959753 1:19954845-19954867 CAATGGGTCAAGGAGGAGGAAGG - Intergenic
904453091 1:30629096-30629118 CTGTGTTCTCAGGAGCAGGAAGG - Intergenic
904770438 1:32878237-32878259 GTGTGTGTTTGGGAGGAGGAAGG + Intergenic
904882260 1:33709870-33709892 CTGTGGATTCACGAGGAGGAGGG + Intronic
905258069 1:36698235-36698257 GTGTATGTACAGGAGGAGGGGGG - Intergenic
905369880 1:37477299-37477321 GTTTGTATCCAGAAGGAGGAGGG + Intronic
905641858 1:39595488-39595510 TTGGGTGTTCAGGAGGAGAAGGG - Intergenic
905826870 1:41032486-41032508 GTGTGTGTTGAGGAAGAGGAGGG + Intronic
906147901 1:43570701-43570723 CTTGGTGCCCAGCAGGAGGAGGG + Intronic
906157792 1:43624106-43624128 CTGTGTGTCCAGGGGCCAGATGG - Intergenic
906256975 1:44357853-44357875 CTGTGTGACAGGGAGAAGGAAGG + Intergenic
906613578 1:47219967-47219989 CTCAATGACCAGGAGGAGGAGGG - Exonic
906829949 1:49020593-49020615 GGGGGTGTCCTGGAGGAGGAGGG + Intronic
907291152 1:53413832-53413854 CTGTGTGCTCAGGAGGTGGGAGG - Intergenic
907962589 1:59297067-59297089 CTAAGCGGCCAGGAGGAGGAAGG - Exonic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
909331056 1:74411508-74411530 CTGTGTGTCAGGGTGGGGGAGGG - Intronic
909904852 1:81182239-81182261 TTGTGTGTCCAGGAATAGGGAGG + Intergenic
910209636 1:84779881-84779903 CTGTGGGTCTTGGAGGAGGTTGG - Intergenic
911949731 1:104156748-104156770 ATGTGTCTCCAGGAGCAGGTTGG - Intergenic
913069128 1:115283951-115283973 CTGCGTGTCCGGTAAGAGGAGGG - Intergenic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
915364184 1:155304960-155304982 CTGTGGGGCCAGGAGGCTGACGG + Intergenic
915444475 1:155966960-155966982 CTGTGTGGCCAGGAGGAGATGGG - Intronic
915772406 1:158441538-158441560 CTGGGTGGCAATGAGGAGGAAGG - Intergenic
917024227 1:170624649-170624671 CTGTGGGTCCAGGAAAAGGCTGG + Intergenic
917431444 1:174973824-174973846 CTGTGGGTCCTGTAAGAGGAAGG + Intronic
917638053 1:176956198-176956220 CTGTGGGTCCATGATAAGGAGGG - Intronic
917667977 1:177244000-177244022 CTGTGAGCCCAGGAGGAAAATGG + Intronic
918269127 1:182879202-182879224 CTGTGTATACACAAGGAGGATGG + Intronic
918369751 1:183847577-183847599 CTGTGTGTCCTGGAGGCAGCTGG - Exonic
918578752 1:186099317-186099339 CTGTGTGTCTGGGAGGTGCAGGG + Intronic
918809375 1:189095444-189095466 CTGAGTGTCCAGGAAGAAAAGGG + Intergenic
919678472 1:200409912-200409934 CGGTGGGTCCAGGAGGGAGAGGG - Intronic
920249571 1:204614593-204614615 GTGTGTTTCGAGCAGGAGGAAGG - Intergenic
920298292 1:204973315-204973337 CTGGGTGTCCCGGAAGATGATGG - Exonic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
923341284 1:233009033-233009055 CAGTGTGGCCAGTAGGAGCAAGG + Intronic
923962202 1:239098397-239098419 GTGTGTGTCTGAGAGGAGGAAGG + Intergenic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063443282 10:6090107-6090129 CTGTGTTTCCAGGAGTAGTCAGG + Intronic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1066543030 10:36469758-36469780 CTATGTGTGCAGGAGGGAGAGGG - Intergenic
1068127461 10:52858658-52858680 ATGGGTGTCCAGGAAGTGGAGGG - Intergenic
1068579836 10:58726945-58726967 TTTTGAGTCCAGGAGGAGGAGGG + Intronic
1069313222 10:67065515-67065537 CTGTGGGCCCAGGAAGAAGATGG - Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1070544642 10:77442777-77442799 TTGGGTGTGAAGGAGGAGGAGGG - Intronic
1070720983 10:78756955-78756977 TGCTGTGCCCAGGAGGAGGATGG - Intergenic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1070818792 10:79342731-79342753 CTGTGTCTCCAGGGGCAGGTGGG - Intergenic
1071708431 10:88025005-88025027 CTGTGTGTAAAGCAGGATGAAGG + Intergenic
1072271038 10:93776856-93776878 CTGTGTGCAAAGGAGGAGGTTGG + Intronic
1072619148 10:97068273-97068295 ATGTATGGCCAGGAGGGGGAGGG - Intronic
1072764411 10:98083992-98084014 CTGTCTCTTCAGGAGGTGGAAGG + Intergenic
1073014847 10:100390121-100390143 CTATGTGTCTAGTATGAGGAAGG - Intergenic
1073160086 10:101385716-101385738 GTGTGTGTCTGGGAAGAGGAAGG - Intronic
1073420479 10:103420216-103420238 CTGTGTGACCATCTGGAGGAAGG + Intronic
1073585851 10:104709159-104709181 CTGTGTGTTTGGGAGGAGGCGGG + Intronic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074364046 10:112843990-112844012 TGGGGTGTTCAGGAGGAGGAAGG + Intergenic
1074849397 10:117427048-117427070 CTGTATGTCCAGGTGAAGGCTGG + Intergenic
1075060672 10:119254674-119254696 CTATTTCTCCAGGAGGAGGTGGG + Intronic
1075203329 10:120424648-120424670 CTGTGGGTTCTGGAGGAGAAGGG + Intergenic
1075555602 10:123429281-123429303 ATGAGCTTCCAGGAGGAGGACGG + Intergenic
1076063568 10:127431062-127431084 CTGTGTGCTCAGGAGGAAGCTGG + Intronic
1076666988 10:132098859-132098881 CTGTCTCTCCAGGAGGAAGGAGG - Intergenic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1076896759 10:133316988-133317010 CTCTGTGTCCTGGGGGAGGGGGG - Intronic
1076896822 10:133317224-133317246 CTCTGTGTCCTGGGGGAGGGAGG - Intronic
1076896863 10:133317360-133317382 CTCTGTGTCCTGGGGGAGGGGGG - Intronic
1076996711 11:300581-300603 GTGTGCGTCCTGGAGGAGGGAGG - Intergenic
1078567615 11:12430479-12430501 CTGTGTGTCCAGGAGGGGCAAGG - Intronic
1079082036 11:17420469-17420491 CTGGGTTTCCTGGAGGAGGCAGG - Intronic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1080695889 11:34602724-34602746 CTGTGTGTCAGGGAAGAGTAGGG + Intergenic
1082772261 11:57217205-57217227 CTGCTTCCCCAGGAGGAGGAAGG - Intergenic
1083280001 11:61621009-61621031 CAGTGTGACCAAGAGGGGGAGGG - Intergenic
1083290693 11:61688503-61688525 CTGTGTGGCCAGGAGTGGGGCGG + Intronic
1083671848 11:64304355-64304377 CTGAGTGTTAAGGTGGAGGATGG - Intronic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084331523 11:68433214-68433236 GTGTGTTGCCGGGAGGAGGAAGG + Intronic
1084425774 11:69083898-69083920 CAGTGGGGCCAGGAGGAGTAAGG + Intronic
1084592364 11:70098129-70098151 CTGTCTGTCCACGAGGACGCGGG - Intronic
1084736858 11:71110977-71110999 CTGTGTCTTCACGTGGAGGAAGG - Intronic
1084904174 11:72333382-72333404 CTCTGTGTGCAGGATGATGAAGG + Intronic
1085699014 11:78729724-78729746 CTGGGTGTTCAGGAGGTAGAGGG + Intronic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1087237210 11:95733388-95733410 GTGTGTTTCGAGGAGGAGCAAGG - Intergenic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1087615925 11:100486683-100486705 TTATGTTTCCAGGAGGATGATGG - Intergenic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089773043 11:120816861-120816883 ATATGTGACCGGGAGGAGGATGG - Intronic
1090647515 11:128777681-128777703 CTGAGTGTGCAGGAGCGGGAGGG - Intronic
1090789348 11:130076944-130076966 GCATGTGGCCAGGAGGAGGAGGG + Intronic
1091605632 12:1949164-1949186 CTGTATGGGCAGGAGGAGGCTGG + Exonic
1091972288 12:4797414-4797436 CTGAGAGTGCTGGAGGAGGAGGG + Intronic
1093889092 12:24498050-24498072 CTGAGGGTGCAGCAGGAGGAGGG + Intergenic
1096048606 12:48586516-48586538 CAGTGTCTCCTGGAGGGGGATGG - Intergenic
1096256411 12:50064672-50064694 CAGTGTGTCCTGGAGGCAGAAGG + Intronic
1097022142 12:56027952-56027974 GTGTCTGTCCAGTGGGAGGAGGG + Intronic
1097680868 12:62647768-62647790 CTGTGTGGGCTGGAGGAGGTGGG + Exonic
1098079197 12:66766022-66766044 TAGTGAGTCCTGGAGGAGGATGG - Intronic
1099277856 12:80600992-80601014 AAGAGTGTCCAGGAGGAGAATGG - Intronic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1100024464 12:90110959-90110981 CTTTGTTTAGAGGAGGAGGAAGG + Intergenic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1101658730 12:106747544-106747566 CTGTGTGTGACGGAGGAAGAAGG - Exonic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1104399239 12:128461993-128462015 CTGTGTGTTCAGCAGAAGGTGGG + Intronic
1104803552 12:131570822-131570844 CTGTGGCTCCAGGAGGAGAGGGG - Intergenic
1105707977 13:22980596-22980618 CTGTGTCTCCTGGAGGAGGCTGG + Intergenic
1106305026 13:28501757-28501779 AAGTGTGTCCAGGAGGAGCCTGG - Intergenic
1106483715 13:30155245-30155267 CGGGGTGTCCTTGAGGAGGAGGG - Intergenic
1106872590 13:34037801-34037823 CTGTGTGTCCTGGAAGAGGAGGG - Intergenic
1107436962 13:40388771-40388793 TAGAGTGTCAAGGAGGAGGACGG - Intergenic
1107651213 13:42547124-42547146 CTGCATGTCAAGGAGGTGGATGG - Intergenic
1108733161 13:53256225-53256247 CTGTGTGTCCTGGATTAGGCTGG + Intergenic
1109726591 13:66349186-66349208 CAGTGTTTCCTGGAGGAGGGAGG + Intronic
1110899313 13:80800617-80800639 CTCTGTCACCAGGATGAGGATGG + Intergenic
1111555206 13:89871836-89871858 CTTTGTCACCAGGACGAGGATGG - Intergenic
1112025202 13:95405364-95405386 CTGTGTCTTCTGGTGGAGGAGGG + Intergenic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1113399707 13:109979564-109979586 CTGTGGGTCCTGGGGGAGCATGG + Intergenic
1113611950 13:111652985-111653007 CTGTGTATCCAGGAAGATGGAGG + Intronic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113761702 13:112852588-112852610 CTGTCTGTCCAGGAGAAGAGGGG + Intronic
1114268808 14:21089113-21089135 CTCTGTGTCCAGGAAGCAGAGGG - Exonic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114650201 14:24279912-24279934 CTGTGGGTCCTGGGGAAGGATGG + Intergenic
1115791155 14:36880056-36880078 CTGAGTGGCCAGGAAGAAGAGGG - Intronic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1117105807 14:52395841-52395863 CTGGGTGTCCCGGAGGGAGAGGG - Intergenic
1117533079 14:56677532-56677554 CAGTCTGTCCAGGAGGAGAAAGG - Intronic
1117957063 14:61130976-61130998 CTATTTGTCCTGGAGGAGGAGGG - Intergenic
1118811308 14:69276272-69276294 GTGAGTGTCCTGGAGAAGGATGG + Intronic
1119379502 14:74219547-74219569 CTCTGTGTCCAGGCTGGGGAGGG - Intergenic
1119770250 14:77216200-77216222 CAATGTTTCCAGGAGGAGGGAGG - Intronic
1120641236 14:87015756-87015778 CTCTGTGTCCAAGAGCAGTAAGG - Intergenic
1121416644 14:93783863-93783885 CTGATTGGCCAGGAGTAGGATGG - Intronic
1121416651 14:93783896-93783918 CTGATTGGCCAGGAGTAGGATGG - Intronic
1121416658 14:93783929-93783951 CTGATTGGCCAGGAGTAGGACGG - Intronic
1121871075 14:97408001-97408023 CGGTGTGTTCAGGAAGAGCAGGG - Intergenic
1122121420 14:99555466-99555488 CTGTGTGCCAGGGAGGAGAAGGG - Intronic
1122416070 14:101550094-101550116 CTGAGGGTCCGGGAGGAGGTGGG - Intergenic
1123681224 15:22765636-22765658 CTCTGTGTCCAGCTGGGGGAAGG + Intergenic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1124333435 15:28840098-28840120 CTCTGTGTCCAGCTGGGGGAAGG + Intergenic
1125717576 15:41827931-41827953 GTGTGTGTCCAGGGGCAGGACGG + Intergenic
1126675662 15:51157738-51157760 CTGTGTGTCCAGGACAAAGTGGG + Intergenic
1127899320 15:63329583-63329605 GTGTGTGTCTTGGAGGAAGAAGG + Intronic
1127914552 15:63444700-63444722 CTGTGTGTGCAGGGAGAGGGTGG + Intergenic
1128261506 15:66236192-66236214 CTGTGTGTTCTGGAGGAGGGAGG + Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128760271 15:70212065-70212087 CTGTGTGGCCATGAAAAGGAAGG + Intergenic
1129147243 15:73659779-73659801 CTGTGTGTGCAGAAGGAAAAAGG + Intergenic
1129693832 15:77729344-77729366 CTGAGGGTCCTTGAGGAGGAGGG + Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1132027821 15:98417892-98417914 CTGGGTGTCCCTGGGGAGGATGG - Intergenic
1132514022 16:357979-358001 GTGTGTGTCCAGCAGGGTGATGG + Intergenic
1133147894 16:3803698-3803720 CTGTGGGTCCAGGAAGAGAGTGG - Intronic
1134389225 16:13803716-13803738 ATGTTTGACCAGGAGAAGGAAGG - Intergenic
1135520451 16:23172838-23172860 CTGTGTGGCAAGGACCAGGAAGG + Intergenic
1135588611 16:23689941-23689963 CTGAGTCTCCTGGAGGAGTACGG + Exonic
1136230439 16:28882673-28882695 CCAGGTGTCCAGGAGGATGACGG + Intronic
1137675867 16:50303683-50303705 CTGAGTGTCCAGCATGAGGCTGG + Intronic
1137893148 16:52183310-52183332 CTTTGTGTCCAGGAATACGAAGG + Intergenic
1138099668 16:54242487-54242509 CTGGGTGCCCAGGAGGAAAAGGG + Intergenic
1139970544 16:70771417-70771439 CTGTTTGTCCAGGATGATGGGGG - Intronic
1141336064 16:83156501-83156523 CTGTGTGTCCAAGCTGATGAAGG + Intronic
1141336800 16:83163545-83163567 CTGTGTGCCCAGGAGGAACGGGG - Intronic
1141618998 16:85226809-85226831 GTGTGTGTGAAGGAGGACGAAGG + Intergenic
1141709132 16:85687932-85687954 CTGGGAGTCCTGGAGAAGGAGGG - Intronic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1142108380 16:88318333-88318355 CAGCGTCTCCAGGAGGAGGCTGG - Intergenic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1143780369 17:9225919-9225941 CTGCGAGGCCTGGAGGAGGAAGG - Intronic
1143786665 17:9260763-9260785 CTGAGTTTCCAGGGTGAGGAGGG - Intronic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146812999 17:35918400-35918422 CAGTATGGCCAAGAGGAGGAAGG - Exonic
1147131363 17:38411405-38411427 CTGTGTGTGGAGGATGAGGCAGG + Intergenic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147228947 17:39003186-39003208 CTGTGGCTCGAGGGGGAGGAGGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147382577 17:40063975-40063997 CTTTGGCTCCAGGAGGGGGAGGG + Intronic
1147607840 17:41784542-41784564 CTCTGTGCCAAGGTGGAGGAGGG - Intronic
1147862269 17:43530475-43530497 CTGCGAGTTCAGGGGGAGGAGGG + Intronic
1148638476 17:49167266-49167288 CTGCATGGCCAGGAGGAAGAGGG + Intronic
1148760082 17:49995089-49995111 GTGTGTGTCCAGAAGGCGAAGGG + Exonic
1148856927 17:50583996-50584018 CTTAGTGTCCAGAGGGAGGAAGG + Intronic
1150470432 17:65432677-65432699 CTATGTGTCCAGGAGGAAAATGG - Intergenic
1151425700 17:74029786-74029808 CTGTGTGATCAGGAGAAGAAAGG + Intergenic
1151430872 17:74061857-74061879 CTCTGTGCCCAGGTGGAGGCTGG + Intergenic
1151548236 17:74806403-74806425 CTGGATGTCAAGGAGGAGGGAGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152567428 17:81106550-81106572 CTTCATGGCCAGGAGGAGGAAGG + Intronic
1152643250 17:81457830-81457852 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152643321 17:81458010-81458032 CTGGGTAACCAGGAGGGGGAGGG + Intronic
1152684386 17:81686931-81686953 GGGTCTGTCCGGGAGGAGGAGGG + Intronic
1152848562 17:82617653-82617675 CTGTGTGTCTGGGAGAGGGAAGG + Intronic
1153073258 18:1131526-1131548 CTGTGTGTGTAGGAGGATGGAGG + Intergenic
1153226327 18:2902820-2902842 TTGTGTGTGAAGGAGCAGGAGGG + Intronic
1153228418 18:2914858-2914880 CTCTTTGTCCAGGAGCGGGAGGG + Exonic
1153589733 18:6660423-6660445 GTGTGTGTCAAGGAGGAGTCGGG + Intergenic
1155986861 18:32239074-32239096 CCCTGTGGCCAGGAGGGGGATGG + Intronic
1156263503 18:35466476-35466498 GGGGGTGTCCAGGAGGGGGATGG - Intronic
1156388377 18:36626916-36626938 CTGTTATCCCAGGAGGAGGAGGG + Intronic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1158185116 18:54762717-54762739 CGGTGTGTTGGGGAGGAGGAAGG - Intronic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159779314 18:72642868-72642890 TTTTGTTTCCAGCAGGAGGAAGG - Intergenic
1159781268 18:72663371-72663393 CTGACTGTCCATGAGGTGGAAGG + Intergenic
1160159607 18:76461244-76461266 CGGAGTGTCCAGGAGGAGCTTGG - Intronic
1160181228 18:76638405-76638427 CTGTGTGCCCTAGAGAAGGAGGG - Intergenic
1160905607 19:1450339-1450361 GTGTGTGTCCTCGGGGAGGAGGG + Intronic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1160946014 19:1644408-1644430 CTCTGTGTCCAGGAGCTGGGGGG + Intronic
1161554613 19:4933615-4933637 CTGGGTGACCAGGCAGAGGAGGG - Intronic
1161719690 19:5895976-5895998 CTGTGAGTCAGAGAGGAGGATGG - Intronic
1161854960 19:6759022-6759044 CTGTGTGACCAGCATGAGGAGGG + Intronic
1162080310 19:8214111-8214133 CTGGGAGTCCAGGAGGGGGTAGG - Intronic
1162127691 19:8508146-8508168 CTGTATATCCAGGAGGATGAGGG + Intergenic
1162230612 19:9262836-9262858 CTGCATGTCCAGGAGCAGTATGG - Intergenic
1162328467 19:10012262-10012284 CTCTGTGTCCCTGAAGAGGAGGG + Intergenic
1162500788 19:11052473-11052495 CAGTATGGCCAGGTGGAGGAAGG - Intronic
1162966094 19:14156814-14156836 CTCTGGGATCAGGAGGAGGAAGG + Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163123834 19:15233456-15233478 CTGTTGGGCCAGCAGGAGGACGG - Intergenic
1163371763 19:16904830-16904852 GTCTGTGTCCAGGAAGGGGAAGG - Intronic
1163689544 19:18731060-18731082 GTTTGAGTCCAGGAGGTGGAGGG - Intronic
1164037748 19:21468907-21468929 CTGTGTGGCCAGGACCAGGTAGG - Intronic
1164082054 19:21867133-21867155 CTCATTGTCCAGGAGAAGGAAGG - Intergenic
1164598911 19:29548183-29548205 CTCCGTGTCCAGGACGTGGAAGG - Intronic
1165355028 19:35299370-35299392 CGGGGTGACCAAGAGGAGGAAGG + Intronic
1165376910 19:35449404-35449426 CTGTGAGGACAGGAGGAGAAAGG + Intronic
1165383376 19:35496075-35496097 CTGTGTTTCCAGGATGCAGAGGG - Intergenic
1165912205 19:39236586-39236608 CTTTGGGTCCTGGGGGAGGATGG - Intergenic
1166158421 19:40933191-40933213 GTGTGTGTCAAGGCTGAGGAAGG + Intergenic
1166373804 19:42316146-42316168 CCCTGGGTCCTGGAGGAGGAGGG + Intronic
1166384990 19:42375874-42375896 CTGGGGATCCAGGAGGAGCAGGG + Exonic
1166881900 19:45934942-45934964 CTGTGTGTCCGGCAGGGGGGAGG - Exonic
1167246015 19:48373668-48373690 CTGTGTGTCCAGGACGAGGAAGG - Exonic
1167384063 19:49153830-49153852 CTGTGTGTCCTGGGGGGTGATGG + Exonic
1167403667 19:49289892-49289914 ATGTGTGTTGAGGAAGAGGATGG + Exonic
1167445558 19:49535096-49535118 CTGGGGGCCCAGGAGGGGGAGGG - Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1167552008 19:50167817-50167839 CCGTGTGTGCATGTGGAGGAAGG - Intergenic
1167716404 19:51145024-51145046 GGGTGAGTCCAGGATGAGGAGGG - Intronic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
1168652119 19:58098020-58098042 CTGTGCGTCCAGGAGGCCGAGGG - Intronic
1168687942 19:58359460-58359482 CTGTGTGTCCAGGTGCCTGAGGG + Intronic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925018979 2:553711-553733 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925018993 2:553742-553764 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925019004 2:553772-553794 CTGTGCCCCCAGGAGGAGGTGGG + Intergenic
925098164 2:1224057-1224079 CTGTGTCTCCCTGTGGAGGAAGG + Intronic
925180118 2:1812049-1812071 CAGTGTGTCCAGTGGCAGGAAGG - Intronic
925363538 2:3295822-3295844 GTGTGTGTGCAGGGAGAGGATGG - Intronic
925675895 2:6360679-6360701 CTGTGTCTGCAGGAGGAGATCGG + Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
925977601 2:9151969-9151991 CTGTGTGTACAGCAAGAGCATGG - Intergenic
926806059 2:16712297-16712319 TTGTGTCTCCAGGAGGTGGGTGG + Intergenic
927136413 2:20099895-20099917 CTGTGTGCGCAGGAGAAGGGAGG + Intergenic
927154547 2:20213879-20213901 CTGTGTGTGAAGGTGGGGGAGGG + Intronic
927827266 2:26317469-26317491 GTGTATGGACAGGAGGAGGAGGG - Intronic
928100851 2:28436732-28436754 CTGTGATTCCAGGAGGGCGAGGG - Intergenic
929300248 2:40295904-40295926 CTTTGTGAGCAGGAGGAGAAGGG + Intronic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
929828943 2:45332073-45332095 CTGTAACACCAGGAGGAGGAAGG + Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
931089569 2:58870957-58870979 CTGTGTGTCCAGGAAGTAAAGGG + Intergenic
931668601 2:64627354-64627376 CTGCGTGCCCAGGAGGAGTCAGG - Intergenic
931826161 2:66003194-66003216 TTGTGTGTCCATGTGGATGATGG + Intergenic
931879264 2:66549890-66549912 CTGTGAATGCAGGAAGAGGAAGG + Intronic
931974630 2:67629704-67629726 CTAGGTGCCCAGGAAGAGGAGGG + Intergenic
932475763 2:72004803-72004825 GTGGGAGTCAAGGAGGAGGAGGG + Intergenic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
933316719 2:80724330-80724352 CTCTGTGTCCAGAAGGAAAAGGG - Intergenic
933844727 2:86315971-86315993 TTGTGTGTCCAGCAGAAAGAAGG - Intronic
934106652 2:88700992-88701014 CTGTGTCTCCAGGATTGGGAGGG - Intronic
934521517 2:95023030-95023052 GTGTGTGTTCAGGGGGAGGGAGG - Intergenic
934545076 2:95207658-95207680 CTGAGTGTCCGGGAGGAGGGTGG + Exonic
934965969 2:98722921-98722943 CTGTCTTGCCAGGAGGAGCATGG - Intronic
934980233 2:98833410-98833432 CTGTGTGTGCAGCAGGCTGAGGG + Intronic
935175386 2:100644199-100644221 TTGTGTCTGCGGGAGGAGGAAGG + Intergenic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
935743370 2:106170308-106170330 CAGTGTCTCCTGGAGCAGGAGGG - Intronic
936011965 2:108930603-108930625 CGGCGTGTCCAGGAGGATGGGGG + Intronic
936169085 2:110152488-110152510 CTCTGAGTCCAGAAGGAGCATGG + Intronic
937071829 2:119069655-119069677 GAGTATGTCCAGGAGAAGGAAGG + Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937352252 2:121173485-121173507 CCCTGTGTCCAGGAGGTGAAGGG + Intergenic
938059643 2:128242265-128242287 TTGTGTTTCTAGCAGGAGGAGGG + Intronic
938407180 2:131039173-131039195 GTGGCTCTCCAGGAGGAGGAAGG - Intronic
938900972 2:135798234-135798256 CTGGGGGTCCAGGAAAAGGAGGG - Intronic
939418730 2:141937293-141937315 CTGTGAAGCCAGGAGGTGGAAGG + Intronic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
941177562 2:162217385-162217407 CTGAGTGTGCAGTAGGAGAATGG - Intronic
941601733 2:167551176-167551198 CTGTGTGCCCAGGAGGAAAGGGG + Intergenic
941619904 2:167765400-167765422 TTGTGAGTCCAGGAGGAAGTGGG + Intergenic
942068783 2:172296550-172296572 CAGTAGGTCCAGGAGGAGGTGGG - Intergenic
945007352 2:205422990-205423012 CTGGGTGTCAAGGAGTATGAAGG - Intronic
946136298 2:217650360-217650382 CTGTGTGCCCAGGAAGATGTGGG - Intronic
946651380 2:221895575-221895597 CTGTGTCTCGAGGAGTGGGAAGG - Intergenic
946901252 2:224374040-224374062 TTGTGTCTCAAGGAGTAGGAAGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947339885 2:229127175-229127197 CTGTGTGTCCAGGAGGAAAGGGG + Intronic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948800667 2:240432047-240432069 CTGAGTGTCCAGGCAGAGCAGGG + Intergenic
948900313 2:240953476-240953498 CTGTGGGTCCAGGGGAGGGAGGG - Intronic
1169244429 20:4015045-4015067 CTGGGAGGCTAGGAGGAGGATGG - Intronic
1169244491 20:4015239-4015261 CGGTGTCTCCAGGCTGAGGAGGG - Intronic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170534324 20:17324956-17324978 CTGTGTGGCAAGGAGAAGCATGG - Intronic
1171069137 20:22049415-22049437 ATGTGTGTATAGGAGAAGGATGG - Intergenic
1171305536 20:24102646-24102668 CTGTGTGGCCATGGGCAGGATGG - Intergenic
1171972325 20:31572200-31572222 CTCTGTGTTGAGGAAGAGGAGGG + Intronic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172820473 20:37728838-37728860 CTGTGTGTGAGGGAGGAGGTTGG + Intronic
1172987126 20:39000688-39000710 CTGGGTTTCCTGGAGCAGGATGG + Intronic
1174059814 20:47825099-47825121 CTGTGTGTCCAGCAGCTGGCAGG + Intergenic
1174072057 20:47906172-47906194 CTGTGTGTCCAGCAGCTGGCAGG - Intergenic
1174147192 20:48460154-48460176 CTGTGTGTCCAGCAGCTGGCAGG + Intergenic
1174151985 20:48492497-48492519 CTGTGTGTCCAGCAGCTGGCAGG + Intergenic
1175140812 20:56859307-56859329 CTGTGTCTCCTGGGGGAGGTGGG + Intergenic
1175154539 20:56961198-56961220 CTGGGTGTACAGGAGCAGGGAGG - Intergenic
1175345692 20:58272994-58273016 ACCTGTGTCCAGAAGGAGGACGG + Intergenic
1175394096 20:58646911-58646933 CTGTGGCTGCAGGATGAGGAGGG + Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175515668 20:59568384-59568406 CTCTGTGCCCAGGTGGAGGAGGG + Intergenic
1175744311 20:61443527-61443549 CTGTGTGATCAGGAGAAGAAAGG - Intronic
1175932745 20:62500419-62500441 CTGTGTGTCCATGAGTGTGAGGG + Intergenic
1176149379 20:63581510-63581532 CTGTATGTCCAGGGAGAAGAGGG - Intergenic
1176179400 20:63742321-63742343 CTGTGTCTCCCGCAGGAGGCAGG + Exonic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1178787391 21:35666414-35666436 CTTGGTGTGAAGGAGGAGGAAGG - Intronic
1178945806 21:36946793-36946815 CTGTGTGTCTGCGAGGAGGTGGG - Intronic
1179571657 21:42282165-42282187 CGGTGTGTCCAGCAGGCTGAGGG + Intronic
1179803933 21:43825635-43825657 ACGCGTGTCCAGTAGGAGGATGG - Intergenic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1179899623 21:44382649-44382671 CTATGTGTCCTGGAGGAGGCAGG + Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180228898 21:46414566-46414588 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228941 21:46414734-46414756 CTGCGTGTCCAGGAGGAGGAGGG - Intronic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1181324783 22:22036477-22036499 CTCTGTGCCCAGGAGAAGGTAGG + Intergenic
1181395771 22:22620275-22620297 CTGTGGGTCCTAGAGCAGGAAGG - Intergenic
1181418249 22:22775779-22775801 CTGGATGTCAATGAGGAGGAAGG - Intronic
1181437456 22:22918982-22919004 CTGGGAGTCCAGGAGATGGAGGG - Intergenic
1181559329 22:23690956-23690978 CTCTGTGTCTTGGAGGGGGATGG - Exonic
1181855100 22:25775617-25775639 GTGTGTTTCCAGGAAGAGGGAGG - Intronic
1181949939 22:26546537-26546559 CTGTGTTCCCTGGAGGGGGATGG - Intronic
1182099958 22:27650810-27650832 GTGCGTGTCCAGGAGGCGGGGGG - Intergenic
1182700155 22:32230227-32230249 CTGTGTGTCAGGGTGGAGGAAGG + Intronic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183359933 22:37378203-37378225 TTGTGTGTGCAGGGGCAGGAAGG + Intronic
1183505784 22:38208146-38208168 CTGTCTGTCCAGGAGGGGTCAGG - Intronic
1183936516 22:41265526-41265548 CTGTTCGTGCAGGAGGAGGGAGG + Intronic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184437435 22:44487970-44487992 CTGTGTGCCCTGGAGGACCAGGG - Intergenic
1184808206 22:46810109-46810131 CTGGGTGTTCTGGAGGAGGGAGG + Intronic
1185124648 22:49001926-49001948 CTTTCTGTCCAGGACCAGGAAGG - Intergenic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950255920 3:11505748-11505770 TTGTGTGTCCTGGAGGCAGATGG + Intronic
950449747 3:13058961-13058983 CTCTGGGTGCAGGAGGTGGATGG + Intronic
950634909 3:14307828-14307850 CAGTATGTGCTGGAGGAGGAGGG - Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952750014 3:36817425-36817447 CTGTATGTGCTGGAGGAGGTAGG - Intergenic
952878132 3:37965313-37965335 CTGTTTTTCCAGCAGGAAGATGG - Intronic
952898106 3:38092703-38092725 GTGTGTGTCCGAGAGGAGGAGGG + Intronic
952953583 3:38543079-38543101 CAGTCTGTCAAGGATGAGGAGGG - Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953868756 3:46607887-46607909 CTTTGTGTCCAGAAGAGGGAGGG + Intronic
953956437 3:47235477-47235499 CTATGTCTCCAGGAGGATGGGGG - Intronic
954150016 3:48652654-48652676 CTGTGGGTCCAGGAGGGAGGGGG - Intronic
954595771 3:51822993-51823015 CAGTGAGTCCAAGAGGTGGAAGG - Intronic
954595936 3:51824730-51824752 CTGTGCGTTAAGGAGGAGGATGG - Intronic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
956621986 3:71230450-71230472 CTTTGTTTCCAGGTAGAGGAGGG - Intronic
958662477 3:97088561-97088583 CTGTGTCTTCAGGTGCAGGAAGG - Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
959132953 3:102380660-102380682 CTATGAATCCAGGATGAGGATGG - Intronic
959664135 3:108902688-108902710 CAGCTGGTCCAGGAGGAGGACGG - Intergenic
960396550 3:117144485-117144507 ATGAGTGAGCAGGAGGAGGAAGG + Intergenic
960433934 3:117602498-117602520 TTGTGTGTCGGGGAGTAGGAGGG + Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
962429804 3:135308545-135308567 CTGTGTGTCTGGGATGAGAATGG - Intergenic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
962756391 3:138468250-138468272 AGGTGTGTGCAGGTGGAGGAAGG + Intronic
962842543 3:139249003-139249025 ATGTGTTGCAAGGAGGAGGATGG - Intronic
963665223 3:148176338-148176360 CTGTGTGTCCAAGATGTGAATGG - Intergenic
967144938 3:186598511-186598533 ATGTGTGTGAAGGAGGAGGAAGG - Intergenic
967256128 3:187593906-187593928 AAGTGTGTCCAGGAGGAGAGGGG - Intergenic
968126469 3:196163956-196163978 CTGTGGGTCCCGCAGGAGGTGGG - Intergenic
968454167 4:688814-688836 CTGTCTGTCCTGGAGGTGGCTGG - Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
968790990 4:2661740-2661762 CTGTGTGCCCAGGCTGAAGATGG + Intronic
969220231 4:5754332-5754354 CTGCAAGTCCAGGAGAAGGAAGG + Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
971494810 4:27252279-27252301 CTCAGGGTCAAGGAGGAGGAGGG + Intergenic
973321569 4:48816101-48816123 CTGTGTGACTAGCAGGAAGAAGG - Intronic
973781105 4:54288938-54288960 CTGTGGGTCTAGGGGGAGGGAGG + Intronic
974474455 4:62361615-62361637 TTGTGTATCCAGGAGGATTATGG + Intergenic
975473349 4:74794554-74794576 GGGTGTGTGCAGGAGGAGGGGGG - Exonic
975838920 4:78454038-78454060 ATGAGTGTCTAGGAGAAGGAAGG + Intronic
978351590 4:107825266-107825288 CGGAGGGGCCAGGAGGAGGATGG + Intronic
978530025 4:109703425-109703447 CTGTGGCTTCAGGAAGAGGAGGG - Exonic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
980654943 4:135769514-135769536 CTGTGTCTCAGGGAGTAGGAAGG + Intergenic
982206993 4:153004295-153004317 GTGTGTGGGGAGGAGGAGGAAGG + Intergenic
982536581 4:156614426-156614448 CTGTGTGTGAAGCAGGAGGCGGG + Intergenic
982536853 4:156617652-156617674 CTGTGTGTCCAGAAGTTGCAGGG - Intergenic
983608846 4:169620382-169620404 CTGGGTCTCGAGGAGGAGGAGGG - Intronic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984675975 4:182548140-182548162 CTGTGAGCCCAGGAGGTGGAGGG + Intronic
984828099 4:183946393-183946415 CTCGGTGTCCATGAGGAGGGGGG + Intronic
985168615 4:187124478-187124500 TTCTGTGTGCAGGAGGTGGACGG - Intergenic
985630756 5:1012786-1012808 CTGGGTGGCCAGGAGGGGCAGGG - Intronic
985754227 5:1703649-1703671 CTGGGTGTCCAGGAGGATCATGG - Intergenic
986032443 5:3906749-3906771 CTGTGGGACCAGGAGGAGCCAGG + Intergenic
986315901 5:6586173-6586195 CTGAGTGCCAGGGAGGAGGAGGG - Intergenic
986392213 5:7297630-7297652 CTCTGTGTCCAGCTGGGGGAAGG + Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
987491264 5:18582908-18582930 CTGTGAGGCCAGGAGCAAGATGG + Intergenic
987589477 5:19904823-19904845 TTGTGGGAACAGGAGGAGGAAGG + Intronic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
989458515 5:41669381-41669403 CTGTGAGTCCTTGAGGATGAAGG + Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990805488 5:59656000-59656022 TTGTGTGTGTAGGAGGAGGGGGG - Intronic
991577101 5:68115966-68115988 CTGTGTATCCAGGATGGAGAAGG + Intergenic
992152087 5:73914824-73914846 CAGTGAGTCCAGGAGGTGGATGG - Intronic
992779641 5:80116363-80116385 TTCTCTGTCCAGGAAGAGGAAGG - Intronic
994269276 5:97757982-97758004 AGGTGTGTACAGGAGGAAGATGG - Intergenic
994613445 5:102074983-102075005 CTGTGTGCCCAAGAGGAAAAGGG - Intergenic
994691836 5:103029051-103029073 CTTGGTTTTCAGGAGGAGGAAGG - Exonic
995646911 5:114323123-114323145 CTCTTTTTCCAGGAGGAGCATGG - Intergenic
996105778 5:119500811-119500833 AAGTGTGTCAAGAAGGAGGAGGG + Intronic
996741088 5:126799588-126799610 CTGAGGGTCCAGAAGAAGGAAGG + Intronic
997715522 5:136039838-136039860 CTGTGTTTCCAAGACCAGGAGGG + Intronic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
999247007 5:150160421-150160443 CTGAGTGTCCAGGAGGTAGGGGG - Intergenic
1000245077 5:159442381-159442403 CTGAGAGCGCAGGAGGAGGAAGG - Intergenic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1001105319 5:168848403-168848425 CTATGGGTCCAGGATGAAGATGG + Intronic
1001197835 5:169689553-169689575 CTGTGTGTGCAGGAGTGAGACGG - Intronic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1002001129 5:176196810-176196832 CTGGGTGTGCATGTGGAGGAAGG - Intergenic
1002052409 5:176578564-176578586 ATCTTCGTCCAGGAGGAGGAGGG + Exonic
1002086798 5:176780978-176781000 CAGTGTCTCCATGAGCAGGAAGG + Intergenic
1002253206 5:177942162-177942184 CTGGGTGTGCATGTGGAGGAAGG + Intergenic
1002570409 5:180136628-180136650 CTCTGTGCCAGGGAGGAGGAGGG + Intronic
1002637693 5:180616280-180616302 CTGCCTGTCCAGGAGAGGGAGGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002889977 6:1324012-1324034 CTCTGTGCCCAGCTGGAGGATGG + Intergenic
1003073088 6:2959988-2960010 CTGTGAGTTCAGGCGCAGGAAGG - Exonic
1004057787 6:12158542-12158564 TTGTGGGGCAAGGAGGAGGATGG + Intronic
1004097369 6:12570809-12570831 GTGTGAGAGCAGGAGGAGGAAGG + Intergenic
1004259371 6:14095026-14095048 GTGTGTGTCTGGGAGCAGGAGGG - Intergenic
1004423603 6:15492741-15492763 CTGGGTTTCGAGGAGGAAGATGG + Intronic
1005276983 6:24229955-24229977 CTGTGTGGCCAAGAGCAGGCTGG - Intronic
1005391121 6:25334233-25334255 CTGTGTGTCCAGAATCAGGAAGG - Intronic
1005441484 6:25873800-25873822 CTGGGTGACCTGGAGGAAGAGGG - Intronic
1005809070 6:29502535-29502557 CTTTGTGCCCAGGAGGGAGAGGG + Intergenic
1006171816 6:32097441-32097463 CTGTCTGACCTGGAGTAGGAGGG + Intronic
1007865944 6:44971020-44971042 CTGTGTATCCTTGGGGAGGATGG - Intronic
1008274425 6:49526618-49526640 GTGTGTGTCCGGGATGAGAAGGG + Exonic
1008499252 6:52164380-52164402 CTTTGTGACAAGGAGGAAGAGGG + Intergenic
1008715583 6:54285390-54285412 CTGTGGGTCCAAGTGAAGGAAGG + Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1011556247 6:88573792-88573814 CTGTGTGCTCTGGAGAAGGAGGG - Intergenic
1011586659 6:88933403-88933425 GTGTGTGGGCAGGAGGAGCATGG - Intronic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1014320161 6:119917983-119918005 CTGTGTTTTCAGGAGAAGGTTGG + Intergenic
1014545640 6:122732354-122732376 CTGTTTTTCCAAGAGCAGGAAGG + Intergenic
1015281991 6:131443636-131443658 CTGTCTCTCCAGGAGGAGAGTGG - Intergenic
1015464106 6:133528702-133528724 CTGTGTGGTTAGGAGAAGGAGGG - Intronic
1016705223 6:147099309-147099331 GTGTGTGTGCAGAAGGAAGATGG - Intergenic
1017513206 6:155132424-155132446 CTCTGTGTGAAGGAAGAGGAGGG - Intronic
1017677961 6:156834305-156834327 TGGTGTGTCCAGGATGAGAAAGG + Intronic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1018956499 6:168413619-168413641 CTGCTTGTCCAGCAGGAGGGAGG + Intergenic
1019073911 6:169371434-169371456 CTCAGTGTCCTGGAGAAGGACGG - Intergenic
1019604615 7:1902171-1902193 CTGTGATTCCAGGAGGAGGCAGG - Intronic
1019773714 7:2899621-2899643 CTCTGGCTGCAGGAGGAGGAAGG - Intergenic
1019796551 7:3054206-3054228 CTGAGTGTGCAGGAGGAGAGTGG + Intergenic
1021623640 7:22571992-22572014 ATGTGGGCCCAGGAGGAAGAAGG + Intronic
1021685538 7:23182159-23182181 CTAGGGGTGCAGGAGGAGGACGG + Exonic
1021737428 7:23653572-23653594 CTGTGTGTCAAGAAACAGGATGG + Intergenic
1022796510 7:33735665-33735687 CTGAGTGTCAGTGAGGAGGATGG - Intergenic
1022905239 7:34849401-34849423 CTGTGAGTCATGGAGAAGGAAGG + Intronic
1022981674 7:35610470-35610492 CCCTGTTTCCTGGAGGAGGAAGG - Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023728453 7:43167614-43167636 ATGTGTGTTCAGGAGGAATAAGG + Intronic
1023770418 7:43551891-43551913 CTGTGTCTTCATGTGGAGGAAGG + Intronic
1023872910 7:44272345-44272367 CTGGGTGCCCAGGAGGAGAGGGG - Intronic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1024248997 7:47492257-47492279 CTGTTTGGCCAGCAGCAGGAAGG + Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1024989748 7:55223874-55223896 CTGTGTGTCCAGGAAAGAGAGGG - Intronic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025235089 7:57228901-57228923 CTGTGTGTCCAGCAGCTGGCAGG - Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1029330469 7:99849479-99849501 CTGTGTGTATAGCAGAAGGAAGG + Intronic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032483911 7:132268692-132268714 TGGTGCCTCCAGGAGGAGGAAGG + Intronic
1032667795 7:134054295-134054317 CTGGGTGGCGAGGAGGAGGTGGG - Intronic
1033074949 7:138240118-138240140 CTGTGCGGCCAGAAGGAAGATGG + Intergenic
1033077021 7:138259131-138259153 CTTTGAGTCCACGTGGAGGAAGG + Intergenic
1034275514 7:149822150-149822172 CTGGGTGTCCAGGTGGAGGAAGG - Intergenic
1034865277 7:154636385-154636407 CTGCTTGCCCAGGAGAAGGAAGG - Intronic
1034954707 7:155327375-155327397 CTTTCTGTCCAGGTGGAGGAGGG - Intergenic
1036066356 8:5385337-5385359 GTGTGAGTGCTGGAGGAGGAGGG - Intergenic
1036723431 8:11200034-11200056 CTGGGAGTGCAGGAGGGGGAAGG + Intronic
1037550129 8:19962689-19962711 CTGTGTGTCCCGGAGTATGCTGG - Intronic
1037671022 8:21015476-21015498 CTCTGTGTCCAGGAAGACGTTGG + Intergenic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1037928521 8:22864061-22864083 CTGTGTGCCCAGGAGCAAGGCGG - Intronic
1038542768 8:28402751-28402773 CTGTGTGTGCAGGAGGCAGGAGG - Intronic
1039410626 8:37352286-37352308 ATGTGGCTCCAGGAGGAGGAGGG + Intergenic
1040033997 8:42851146-42851168 CTGTGTGTCCAGGAGCCCAATGG - Intronic
1040516072 8:48136263-48136285 CTGAGTATCAAGGAGGAAGAGGG - Intergenic
1040873029 8:52120539-52120561 CTGAGCATCCAAGAGGAGGAAGG + Intronic
1040984555 8:53279634-53279656 CTGTGTCTTCAGGTGGGGGAAGG - Intergenic
1041811905 8:61921183-61921205 ATGTGTGTGCAGGAGGTGTACGG - Intergenic
1042329574 8:67564076-67564098 CTGTATATCCAGGATGTGGAAGG + Intronic
1043363200 8:79499735-79499757 CTGAGTTTCCAGGGGGAGGGAGG - Intergenic
1043413725 8:80027978-80028000 CAGTTTTTCCAGGAGGAGGCTGG - Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1044794685 8:95885011-95885033 GTCTGTGACCAGGAAGAGGATGG - Intergenic
1048173715 8:132132642-132132664 GTGTGTGTGCAGGTGGAGAAGGG + Intronic
1048233189 8:132663869-132663891 CTGTTTGTCAGGGAGGTGGATGG + Intronic
1048302636 8:133262691-133262713 CTGAGTGCCCAGGAGGAAAAGGG - Intronic
1048329952 8:133464646-133464668 TTGTGTGTGCCGGAGGAGGCTGG + Intronic
1048996257 8:139795365-139795387 CTCTGTGTCCAGGAGAAGTGTGG - Intronic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1049219799 8:141423999-141424021 GTGTGTGACCAGGATCAGGAAGG + Intronic
1049603264 8:143517851-143517873 CTGTGTGTGCAGGTGGGGCAGGG - Intronic
1050130418 9:2406551-2406573 CTGGGGGGCCAGGAGCAGGAAGG + Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1050776043 9:9261668-9261690 GTGTGTGTTCAGGAGGGAGAGGG + Intronic
1051298248 9:15619124-15619146 TTGTGTCTCAAGGAGTAGGAAGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1056566120 9:87774081-87774103 CATGTTGTCCAGGAGGAGGATGG + Intergenic
1056731061 9:89167104-89167126 CTGGGGGTCCAGCAGGAGGGAGG + Intronic
1056761846 9:89421073-89421095 CCGTGTGTGCAGGAGGAGGCTGG - Intronic
1057485882 9:95483750-95483772 ATGTGTGGCTAGGTGGAGGATGG - Intronic
1057740671 9:97708772-97708794 CTATGTGGCCAGGACGGGGAGGG + Intergenic
1057817241 9:98304624-98304646 CTGCATGTCCAGGAGGATGGAGG + Intronic
1058114788 9:101072483-101072505 CTGTGTGCCCAGGAAGAGAAGGG + Intronic
1058165035 9:101609625-101609647 CTGTGTGTCCAGGTAGAGTTAGG + Intronic
1058195572 9:101970891-101970913 GTGTGTGTCCAGGAGGAAAAGGG + Intergenic
1058418349 9:104811239-104811261 CTCAGTCTTCAGGAGGAGGAAGG - Intronic
1058743637 9:107968446-107968468 CTGTGTGTCCAGTTGGAGGGAGG + Intergenic
1058756568 9:108088210-108088232 CTGAGTCCCCAGGAGGAGAAGGG - Intergenic
1059275797 9:113096077-113096099 AAGTGTGTCCTGGAGGAGAATGG - Intergenic
1059999852 9:119948405-119948427 CACTGGTTCCAGGAGGAGGATGG - Intergenic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1060620122 9:125057666-125057688 CCGAGTGTGGAGGAGGAGGAGGG + Intronic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1062220153 9:135410680-135410702 CTGTGGATCCAGGAAGAGGCAGG + Intergenic
1062261363 9:135664807-135664829 CTGTGAGACCAGGAGGAGCCTGG - Intronic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185975057 X:4710897-4710919 CCGTGTGTGCATTAGGAGGATGG + Intergenic
1186906829 X:14119789-14119811 CTCTGTGTCCAAGAAGAAGAGGG + Intergenic
1187987469 X:24829730-24829752 CTGTGTATTTAGGAGGAGGGAGG + Intronic
1189142895 X:38625336-38625358 CTGTGTGCCTAGGAAGAAGATGG - Intronic
1189823975 X:44898516-44898538 CTGTGTGTGCAGGAGGGAGGTGG + Intronic
1190327163 X:49213694-49213716 CTGAGTCTCCAGGAGTAGGGAGG + Intronic
1190509572 X:51162061-51162083 CTCAGTGTCCAGGAGCATGAGGG + Intergenic
1192799388 X:74451361-74451383 GTATGTGTCAAGGAGGAGGGAGG - Intronic
1193851368 X:86541819-86541841 GTGTGTGTGCATGAGGAGGAAGG + Intronic
1195596272 X:106693781-106693803 CTGTGTGTACAGCTGGAGGAGGG + Intronic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1198542317 X:137652916-137652938 GTGTGTGTGTAGGAAGAGGAGGG + Intergenic
1198963632 X:142206038-142206060 CTGTCTGGACAGGAGAAGGAAGG - Intergenic
1199743319 X:150756267-150756289 CTGTTAGTCCAGCAGTAGGAGGG + Intronic
1201235710 Y:11908902-11908924 CTGTGGGCCCTGGAGGAGAAAGG + Intergenic
1201302052 Y:12516625-12516647 CTGTATGTCCAGGAGTTGGTGGG - Intergenic
1201642506 Y:16194584-16194606 CTGTGGGTGCACTAGGAGGATGG - Intergenic
1201660308 Y:16390736-16390758 CTGTGGGTGCACTAGGAGGATGG + Intergenic
1201771410 Y:17620412-17620434 CTGTGTGGCAAGGATCAGGAAGG + Intergenic
1201830145 Y:18285574-18285596 CTGTGTGGCAAGGATCAGGAAGG - Intergenic