ID: 1180228993

View in Genome Browser
Species Human (GRCh38)
Location 21:46414934-46414956
Sequence CAGAGCCTGGAGGAGTAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 283}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180228993_1180229004 24 Left 1180228993 21:46414934-46414956 CCCAACTACTCCTCCAGGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 283
Right 1180229004 21:46414981-46415003 AGTGCTGGGCAGGTGTTTTATGG 0: 1
1: 0
2: 0
3: 20
4: 192
1180228993_1180229000 9 Left 1180228993 21:46414934-46414956 CCCAACTACTCCTCCAGGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 283
Right 1180229000 21:46414966-46414988 GGCTCTAACACCAGAAGTGCTGG 0: 1
1: 0
2: 0
3: 10
4: 149
1180228993_1180229002 14 Left 1180228993 21:46414934-46414956 CCCAACTACTCCTCCAGGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 283
Right 1180229002 21:46414971-46414993 TAACACCAGAAGTGCTGGGCAGG 0: 1
1: 0
2: 2
3: 13
4: 196
1180228993_1180229001 10 Left 1180228993 21:46414934-46414956 CCCAACTACTCCTCCAGGCTCTG 0: 1
1: 0
2: 2
3: 22
4: 283
Right 1180229001 21:46414967-46414989 GCTCTAACACCAGAAGTGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180228993 Original CRISPR CAGAGCCTGGAGGAGTAGTT GGG (reversed) Intronic
900124516 1:1063478-1063500 CAGAGCCTGGGGGTGCAGCTGGG + Intergenic
901370759 1:8795394-8795416 CAGAGGCTGGAGGATTGCTTTGG - Intronic
902020579 1:13342476-13342498 CAGTGCCTGGAAGAGAACTTTGG + Exonic
902375111 1:16026853-16026875 GAGAGCCTGGAGGAGGGGATGGG + Intronic
902380080 1:16048659-16048681 GAGAGCCTGGAGGAGGGGGTGGG + Intronic
904317236 1:29673391-29673413 CAGAGCTTTGGGGAGGAGTTAGG - Intergenic
904892531 1:33789886-33789908 CAGAGCCTGGTGCTGTAATTGGG - Intronic
907082473 1:51636569-51636591 CCGAGCCAGGAGGATTACTTGGG - Intronic
907090328 1:51718196-51718218 CAGAGGCTGGAAGGGTGGTTGGG + Intronic
907592568 1:55689836-55689858 CAGAGCATGGATGAGGAGGTGGG + Intergenic
908991003 1:70089104-70089126 CAGCTCCTGGAGTAGGAGTTAGG - Intronic
910049819 1:82960661-82960683 CAGGGCATGTATGAGTAGTTGGG - Intergenic
912186957 1:107289043-107289065 GAGAAGCTGGAGGAGGAGTTAGG - Intronic
914701570 1:150138718-150138740 CAGAGTTTGGGGGAGAAGTTCGG - Intronic
916014974 1:160741898-160741920 CAGAGCTTGGAGGAGTCTTAGGG - Intronic
916323864 1:163535238-163535260 CAGAAGCTGGAGAGGTAGTTGGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916576478 1:166071485-166071507 GACAGCCAGGAGGAGTAGGTAGG - Intronic
916716780 1:167453340-167453362 CAGAGCCTGGACGAGAAGCCAGG + Intronic
917255805 1:173115161-173115183 CAGAGCCTGGATGGGCAGGTTGG - Intergenic
917518529 1:175728975-175728997 CAGAGCCTGGGAGAGGTGTTTGG + Intronic
918528053 1:185486578-185486600 CAGAGCCTGGAGAAGTGGAATGG + Intergenic
920055051 1:203185380-203185402 CAGAGCCTGAAGGAGAAGTCTGG + Exonic
920846068 1:209593972-209593994 CAGAGCCTGAAGGGGCAGTGTGG - Intronic
921261994 1:213392802-213392824 CAGAGCCTGGAGGAAAATTCAGG + Intergenic
923457294 1:234175562-234175584 CTGAGCCAGGAGGAGCACTTGGG + Intronic
1062919829 10:1271378-1271400 CAGTGACTGGAGGAGTCTTTCGG + Intronic
1063636744 10:7788964-7788986 CAGGTCCTGGGGGAGGAGTTCGG + Intronic
1066301680 10:34102661-34102683 CAGAGCATGGAGGCAGAGTTGGG - Intergenic
1067144644 10:43686282-43686304 CAGAGGCTGGAGGAACAGGTGGG + Intergenic
1067180526 10:43982479-43982501 CAGGCCCTGGAGGAGTAGGTTGG - Intergenic
1069754848 10:70767757-70767779 CAGAGCCAGGACCTGTAGTTTGG + Intergenic
1069957689 10:72061863-72061885 CAGAGCCTGGGGGAGCTTTTAGG - Exonic
1070564326 10:77591907-77591929 CAGAGCCTTGATGGGCAGTTGGG - Intronic
1070674970 10:78406190-78406212 CAGAGCCTAGATGGGCAGTTAGG - Intergenic
1071098285 10:82004749-82004771 CAGAGCCTGTATGAGAAGTCTGG + Intronic
1071298705 10:84241037-84241059 AGGAGCCTGGAGGAGGACTTAGG + Intronic
1072521159 10:96231199-96231221 CAGAGCCTGGATAAGAACTTAGG - Intronic
1073283142 10:102369359-102369381 CATAGCCTTGGGCAGTAGTTGGG - Exonic
1075346819 10:121688341-121688363 CACAGTCTGGAGGAGCAGGTGGG + Intergenic
1076746910 10:132519148-132519170 CACCACCTGGAGGAGTAGCTGGG - Intergenic
1077309687 11:1882828-1882850 CTGAACCTGGAGGAGAAGATGGG - Intronic
1077546969 11:3176257-3176279 CAGGGCCTGGGAGAGCAGTTAGG + Intergenic
1083652750 11:64212666-64212688 CAGAGCCTGGCAGAGTGGCTTGG - Intronic
1083692522 11:64419100-64419122 CACAGACAGGAGGAGGAGTTGGG - Intergenic
1083759034 11:64805857-64805879 CAGGGGCTGGGGGAGTAGGTGGG + Intronic
1083822992 11:65183005-65183027 CAGATCCTGGATGAGGAGTAGGG + Intronic
1083944923 11:65918548-65918570 CAGGGCCGGGAGGTGTAGCTGGG - Intronic
1084595827 11:70116535-70116557 CAGAGCCTGGAGGCGTTCTGGGG + Intronic
1085824315 11:79827472-79827494 CAGAGCCTTGGGGAGAACTTTGG + Intergenic
1085862099 11:80246218-80246240 CAGAGCCTTGAGGCATAGGTAGG + Intergenic
1088012758 11:105022761-105022783 CATAGTCTGGAGGATTAATTTGG + Intronic
1088688380 11:112304270-112304292 CAGGGCCTGGTGGAGGTGTTGGG + Intergenic
1089582392 11:119489528-119489550 CAGAGCCTGCAGGAGAAGCAGGG + Intergenic
1089592901 11:119556033-119556055 CAGAGCCTGGGCGAGGGGTTTGG - Intergenic
1089844284 11:121446308-121446330 CAGGGCCTCTAGGGGTAGTTGGG + Intergenic
1090453026 11:126823289-126823311 CAAAGCCTGGAGGACAAGTGGGG + Intronic
1091004333 11:131938898-131938920 GAGAGACTGGTGGAGTAGGTGGG + Intronic
1091203379 11:133800164-133800186 GAGAGCCAGGGAGAGTAGTTTGG + Intergenic
1091304600 11:134529609-134529631 CAGATCCTGGAGGTGGACTTGGG + Intergenic
1091744382 12:2981964-2981986 TAGAGGCTGGAGGAGTTGTGAGG + Intronic
1092140791 12:6182108-6182130 CAGGGGATGGAGGAGGAGTTGGG + Intergenic
1094423328 12:30295208-30295230 CAGAGCCTGGAGTAGCACTCCGG - Intergenic
1094433647 12:30397793-30397815 CAGAGCCTGGAGGAAGAGCCAGG + Intergenic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097231098 12:57511704-57511726 AAGCGACTGGAGGAGTGGTTGGG + Exonic
1097429891 12:59491901-59491923 CAAAGCCTGGATTAGTGGTTGGG - Intergenic
1097919993 12:65061601-65061623 CAGAGCCTGGACAAGCAGTTTGG + Intronic
1098219655 12:68255549-68255571 CAGAGACTGGGGGAGTAAGTGGG + Intergenic
1101870356 12:108560838-108560860 GAGAGACTGGAGGAGCAGGTGGG - Exonic
1102229340 12:111251752-111251774 CAGAGCCTGGGTGGGTAGGTGGG + Intronic
1103204700 12:119119442-119119464 CAGAGCTTGGGGGAGTAGACAGG + Intronic
1103228607 12:119309050-119309072 CATTGCCTGCAGGAGTAGTTGGG + Intergenic
1105304447 13:19158979-19159001 AAGAGCCTGGAGGCTAAGTTGGG + Intergenic
1105593559 13:21815738-21815760 CGGAGCTTGGAGGAGTAGGTCGG + Intergenic
1106526182 13:30543084-30543106 CAGAGCCTGGAGGATGTGTGTGG - Intronic
1107631550 13:42348336-42348358 CACAGCCTCGAGAAGTTGTTTGG - Intergenic
1107671114 13:42747238-42747260 CAGAGGCTGAAGTAGAAGTTTGG + Intergenic
1107994429 13:45846842-45846864 CAGAGCCTGGAGCAGTAATTTGG - Intronic
1108559037 13:51625108-51625130 CAGAGGCTGGAGGACCAGTTAGG + Intronic
1109249323 13:59999804-59999826 GAGACCCTGGAGGAGGAGCTGGG - Intronic
1109689201 13:65864341-65864363 CAGACCTTGGAGGAGTAACTTGG + Intergenic
1112885635 13:104167808-104167830 CAGAAGCTGGAGGAGGATTTGGG + Intergenic
1113035332 13:106041449-106041471 CAGAACCTTGTAGAGTAGTTTGG - Intergenic
1113792543 13:113036773-113036795 CAGGGTCTGGTGGAGGAGTTGGG - Intronic
1116942984 14:50809336-50809358 CAGATCCTGGAGGAGAAGGCAGG - Intronic
1117411337 14:55454058-55454080 CAGAGCCTGGAAGTGTCATTTGG - Intronic
1118613831 14:67561990-67562012 CAGCGCCTGGTGGAGCAGGTGGG + Exonic
1119735241 14:76977446-76977468 CAGACCCTGGAGGAGTGGTCTGG - Intergenic
1119898810 14:78243057-78243079 CAGAGCCCGGAGGAGCAGACAGG - Intronic
1121109624 14:91303507-91303529 TAGAGCCTGGAGGAGGGGTGGGG - Intronic
1121320782 14:92990573-92990595 CAGAGCCTGGAGGGGAAGCAGGG - Intronic
1121492223 14:94368841-94368863 CAGAGCCTGGAAGAGAAGCCAGG - Intergenic
1121865615 14:97359748-97359770 CAGAGCCTGGGGGAATAGCAGGG + Intergenic
1122782895 14:104151045-104151067 CAGAGCCTGGTGGGGTGGTGAGG + Intronic
1123986719 15:25652827-25652849 CAGAGCCTGGAGCAGCTGTCTGG + Intergenic
1126399296 15:48252886-48252908 GAGAGCCTGGAAGAGTTGGTGGG + Intronic
1127286994 15:57541185-57541207 CAGAGCCAGCAGGACAAGTTAGG + Intronic
1128056715 15:64705014-64705036 TTGAACCTGGAGGAGTAGGTAGG - Intergenic
1128227728 15:66013878-66013900 CTGAGGCTGGAGGAGCAGTTAGG + Intronic
1129341448 15:74889113-74889135 CTCAGCCTGGAGTAGAAGTTGGG + Intergenic
1132375663 15:101326778-101326800 GAGAGCCTGGAGGGGTAGCGGGG + Intronic
1132816340 16:1829168-1829190 CAATGCCTGGAGGAGTCCTTTGG + Intronic
1133209975 16:4258074-4258096 CAGAGCCGGGAGGAGCCGTCGGG - Exonic
1135082174 16:19445732-19445754 ATGAGCCTTGAGGAGTAGATGGG + Intronic
1136379751 16:29887744-29887766 CAGAGCCTGGGGGAGCCGTAGGG - Exonic
1137016810 16:35385043-35385065 CAGTGGATGGAGGAGTAGTGGGG + Intergenic
1137446272 16:48534478-48534500 CAGAGCCTGGAAGTATAGATGGG - Intergenic
1137575633 16:49598202-49598224 CACAGCCTGGAGGTATAGTCAGG - Intronic
1137977200 16:53041958-53041980 CAGAGCCTGGAGGAGCAGGAGGG - Intergenic
1138385457 16:56633015-56633037 CAGAGCCTGGAGGAGAACACTGG - Intronic
1138386025 16:56636104-56636126 CAGAGCCTGGAGGAGAACACTGG - Intergenic
1139099854 16:63752439-63752461 CATAGCCAGGAGGAAGAGTTAGG + Intergenic
1139380478 16:66527433-66527455 CAGAGCCTGGGGAACAAGTTGGG + Intronic
1139949948 16:70663885-70663907 CACAGCCTGGTGGAGAAGCTGGG - Exonic
1141263475 16:82474850-82474872 CAAAACCTGGAGGAGGAATTGGG - Intergenic
1143020837 17:3916543-3916565 CAGAGCCAGGAGGGGCAGTGGGG - Intergenic
1143579472 17:7817287-7817309 CAGGGCCTGGAGGAGGACCTGGG + Exonic
1144189056 17:12826613-12826635 CAGGGCCAGGATGAGAAGTTTGG - Intronic
1144641032 17:16936760-16936782 CTGAGCCTGGAGGATTGCTTGGG - Intronic
1144726606 17:17505545-17505567 CAGAGGCTGGAGCAGATGTTGGG + Exonic
1146276303 17:31517801-31517823 CAGAGCCTGGAGGGGTCTGTCGG + Exonic
1147124649 17:38358152-38358174 CAAAGACTGGAGGAGTAGGGTGG - Intronic
1147795091 17:43036563-43036585 CTGGTCCTGGAGGAGGAGTTGGG + Intergenic
1147881996 17:43660277-43660299 CAGAGGCTGGAGGATGAGATTGG - Intronic
1148069930 17:44902734-44902756 CAGGGTCTGGAGGAGCAGTCTGG + Exonic
1148783961 17:50136172-50136194 CAGAGCCTGGAGCAGGAGAAGGG - Exonic
1148788070 17:50155660-50155682 CAGAGCCTGGCGGGCTAGTGGGG - Intergenic
1149313410 17:55417938-55417960 CTGAGACTGGAGGGGTAGTGAGG - Intronic
1151236127 17:72720948-72720970 GAGAGCCTGGGGGAGTGGGTGGG - Intronic
1151451334 17:74200118-74200140 AAGAGGCTGGAGGGGGAGTTGGG - Intergenic
1151621815 17:75250243-75250265 CAGAGCCCGGAGGGGCGGTTCGG - Intronic
1151852382 17:76698492-76698514 CCCAGCCTGGAGCTGTAGTTTGG - Intronic
1152390650 17:80001889-80001911 CAGAGCCTGGAGCAGGAGACGGG - Intronic
1152413726 17:80145678-80145700 GAGAGCCTGGAGAAGAGGTTGGG - Intronic
1152851524 17:82639414-82639436 TAGAGCCTTGTGGAGTAATTTGG - Intronic
1153476861 18:5506504-5506526 CAGAGCCAGGAGGGGTAGACAGG - Intronic
1154290633 18:13102942-13102964 CTGAGCCTGGAGGAGGCGTAGGG - Intronic
1157001547 18:43532475-43532497 GAGAGTCTGGAGGAATAGTTTGG + Intergenic
1158422953 18:57312500-57312522 CAGGGCCTGGAGGGGAAGGTGGG - Intergenic
1158740236 18:60133769-60133791 CAGAGCCTGGAAGGGTACTAGGG - Intergenic
1159649278 18:70958234-70958256 CAGGGCCTGTAGGGGGAGTTGGG - Intergenic
1161378391 19:3951511-3951533 CAGGGCCTGGAGCAGGTGTTGGG - Intergenic
1161423346 19:4187832-4187854 CAGAGCCTGGAAGAATAGGGAGG + Intronic
1161699523 19:5787243-5787265 CAGGGCCCGGGGGAGTTGTTTGG + Intronic
1161992215 19:7690401-7690423 CACAGCCCGGAGGAGCAGGTGGG - Exonic
1165180983 19:33968924-33968946 CAGAGGCTGGAGGGGTAGCAAGG - Intergenic
1165866923 19:38945283-38945305 CAGAGCCTGGCGGAGGAGCCTGG + Intronic
1165866939 19:38945324-38945346 CAGAGCCTGGGGGAGGAGCCTGG + Intronic
1165866955 19:38945365-38945387 CAGAGCCTGGGGGAGGAGCCTGG + Intronic
1165867097 19:38945724-38945746 CAGAACCTGGAGGAGAAGCCTGG + Intronic
1165867113 19:38945765-38945787 CAGAGCCTGGGGGAGGAGTCTGG + Intronic
1167719688 19:51169924-51169946 TTGAGGCTGGAGGAGTATTTAGG - Intergenic
1168627252 19:57929122-57929144 CAGAGACTGGAAGATTCGTTGGG + Intronic
925695767 2:6576902-6576924 CACAGCCTGAAGGAGAAGTTTGG - Intergenic
926861690 2:17316856-17316878 CGCTGCCTGGAAGAGTAGTTGGG + Intergenic
927844074 2:26462308-26462330 CTGGGGCTGGAGGAGTGGTTTGG + Intronic
929312718 2:40444238-40444260 CTGAGCCAGGAGGATTACTTGGG + Intronic
930154510 2:48092467-48092489 CAGAGCCTGGATGAGGATGTGGG - Intergenic
930728859 2:54709073-54709095 AGGAGCCTGGAGGAGGAGCTGGG + Intergenic
931764085 2:65439168-65439190 CAGATCCTGGAGGTGGAGATGGG + Intergenic
932275703 2:70450837-70450859 AAGAGCCCAGAGGAGGAGTTTGG - Exonic
932298106 2:70643353-70643375 GTGAGCCTGGAGGCATAGTTAGG + Intronic
934561275 2:95314780-95314802 CAGAGCCTGGAGTATTGGTGAGG + Intronic
936097636 2:109544813-109544835 CAGAGCCTAGAGCAGTTGTCTGG - Intronic
938566545 2:132523883-132523905 CAGAACCTGGGGGAAGAGTTTGG + Intronic
940482721 2:154255520-154255542 AAGGGCCTGAAAGAGTAGTTAGG + Intronic
940561085 2:155298277-155298299 CAGAGCCTTGAAAAGCAGTTAGG - Intergenic
941003168 2:160222047-160222069 CAGAGCCAGGGGGAGTAGGCAGG - Intronic
941264412 2:163342037-163342059 CAGTGCCTGGAAGAGTAAGTAGG + Intergenic
945170710 2:206991915-206991937 CAGAGCCTGGAGAATCAGTAGGG + Intergenic
945172679 2:207013130-207013152 CAGAGCCTGGTGAGATAGTTAGG + Intergenic
947239944 2:227983824-227983846 CAGAGCCTGGAGTAGGAGAGTGG + Intronic
1169193066 20:3669870-3669892 CAGAGCCTGGAGGAAATGTTAGG - Intronic
1172588360 20:36100726-36100748 CAGAGCCTGCGGGAGCATTTAGG + Intronic
1173121117 20:40290075-40290097 CAGAGCCTGGAAGAAAATTTAGG + Intergenic
1174809730 20:53635452-53635474 AAGAGCCTGGAGGGGAAGTTGGG - Intergenic
1175048016 20:56125578-56125600 CAGAGGCTGGAAGACCAGTTAGG + Intergenic
1175246298 20:57584259-57584281 CAGAGCCTAGAGGACTGGTTAGG - Intergenic
1175465699 20:59190073-59190095 CTAAGCCAGGAGGAGTAGCTTGG - Intergenic
1177139161 21:17340379-17340401 CAGAGCCTTCAGGAATGGTTTGG - Intergenic
1179272944 21:39865728-39865750 CACAGCCTGGAGGTGTAGAAGGG - Intergenic
1179523681 21:41961749-41961771 GAGAGCCCGGAGGAGGAGCTGGG - Intergenic
1180228993 21:46414934-46414956 CAGAGCCTGGAGGAGTAGTTGGG - Intronic
1181020492 22:20099302-20099324 CAGAGGCTGGGGCACTAGTTGGG - Intronic
1181322715 22:22020760-22020782 CTGAGACTGGGAGAGTAGTTAGG + Intergenic
1182234750 22:28866448-28866470 AAGAGGCAGGAGGTGTAGTTCGG + Intergenic
1182504838 22:30774192-30774214 TAGAGCTTGGAGGAGTTGGTGGG - Intronic
1184018026 22:41800519-41800541 CAGAGCCTGGAGGGGCAGGCAGG + Intergenic
1184089438 22:42284552-42284574 CAGAGCCTGAAGGGCTAGCTGGG + Intronic
1184535258 22:45082340-45082362 CAGAGCCTGGGAGAGGAGTCAGG + Intergenic
949985633 3:9538363-9538385 AGGAGCCTGGAGAAGTAGTTAGG - Intronic
950520872 3:13496962-13496984 CCGAGCCTTGAGGAATATTTAGG - Intronic
951060780 3:18204617-18204639 CACAGACTGAAGAAGTAGTTTGG - Intronic
953003606 3:38957553-38957575 CAGAGCCTGGGAGAGCAGTGAGG + Intergenic
953473573 3:43186871-43186893 CAGAGCATGGTGGAGAGGTTAGG - Intergenic
953587803 3:44220951-44220973 AAGAGTCTGGAGGTGTAGGTAGG + Intergenic
954847120 3:53569132-53569154 GAGTGCCTGGAGGAGTCTTTAGG + Intronic
956468723 3:69542893-69542915 CAGAGCTTGGAGGAGTCGGAGGG - Intergenic
957240890 3:77659921-77659943 TAGAGGCTGGAGGAGTTGTGAGG + Intergenic
958723437 3:97874649-97874671 CAGAGACTGGAGCAGTTGCTGGG + Exonic
958847552 3:99283082-99283104 CAGAGGCGGGAGGGGTAGTCGGG + Intergenic
959039548 3:101405286-101405308 CAGAGCCTGGTAGAATAGCTGGG + Intronic
961140036 3:124547963-124547985 CAGAACCTGGAGGAACACTTGGG - Intronic
961432098 3:126890521-126890543 CAGAGTCAGGAGGAGAGGTTGGG + Intronic
962310623 3:134324437-134324459 CAGAGCCTGGAGCAGTGGCATGG + Intergenic
962816055 3:139001849-139001871 CAGAGGCTGGAGGAGGAGGGTGG - Intergenic
963044048 3:141089479-141089501 TAGAGCCTGGAGGAGAAGGAGGG + Intronic
964437679 3:156671844-156671866 TAGAGCCTAGAAGACTAGTTAGG + Intergenic
964448721 3:156788361-156788383 CAGAGTGTGGAGGAGTGGATGGG + Intergenic
967501841 3:190206471-190206493 CAGAGCCTCGAGGCATAGTCTGG + Intergenic
967648235 3:191952710-191952732 CAGAGCCTCGTGGAGTACGTAGG - Intergenic
968432653 4:567818-567840 CAGACCCAGGAGGAGGAGTCAGG + Intergenic
972326557 4:38021958-38021980 CTGAGGATGGAGGAGGAGTTAGG + Intronic
972937164 4:44150844-44150866 GAGAGCCTAGGGGAGAAGTTTGG + Intergenic
973791845 4:54385173-54385195 CATAGCCTGGAGGAGGAGCTGGG + Intergenic
977071757 4:92399048-92399070 CAGAAACTGGATGAGTAATTTGG - Intronic
981269219 4:142824378-142824400 AAGAGCCTAGAGGACTATTTTGG - Intronic
981584015 4:146280917-146280939 AAGAGCCAGGATGAGTATTTAGG + Intronic
981714138 4:147736233-147736255 CAGAGCCTGGACAAGAATTTAGG + Intronic
983486102 4:168332554-168332576 CAGAGCCTGGAAAAGCAGGTGGG - Intergenic
985037845 4:185859348-185859370 CACAGCGTGGAGGAGCAGCTGGG - Intronic
986184128 5:5420962-5420984 CGGAGCCTGGAAGAGCAGGTAGG + Intronic
986776648 5:11021237-11021259 GAGAGCTTTGAGGAGTGGTTTGG - Intronic
988180674 5:27787459-27787481 CAGAGACTGGAGGAGTTTTGAGG - Intergenic
988364590 5:30279921-30279943 CAGAGTCTGGAAGAGTAGCAGGG - Intergenic
989595832 5:43155321-43155343 CAGGGCCTGTATGGGTAGTTAGG + Intronic
991157381 5:63455323-63455345 CTGAGTCTGGAGGATTACTTGGG - Intergenic
993968808 5:94391254-94391276 TAGAGACTAGAGGTGTAGTTTGG - Intronic
994002814 5:94801215-94801237 TAGAGCCTGGAACAGTACTTGGG + Intronic
994473020 5:100234174-100234196 CAGATGCTGGAGAAGTTGTTGGG - Intergenic
997646441 5:135485080-135485102 CTTAGCCTGGAGAAGAAGTTGGG + Intergenic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998825832 5:146100282-146100304 CAGAGCTTGGAAGAGGGGTTAGG + Intronic
999953180 5:156672018-156672040 CAGGGCCTAGAGGAGGTGTTTGG - Intronic
1002072465 5:176688363-176688385 CTGAGCCTGCAGCAGCAGTTTGG + Intergenic
1002660986 5:180791123-180791145 CAGGGCCTGGTGGAGTTGGTGGG - Exonic
1003367441 6:5488734-5488756 CAGAGACTGAAAGAGAAGTTAGG - Intronic
1004358792 6:14952693-14952715 CAGAGTCTGGAGGAGATGCTGGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005685901 6:28252728-28252750 CAGGGTCGGGAGGAGTAGTCTGG - Intergenic
1014014717 6:116517149-116517171 CAGAGCCTTGAGAAGTAATTGGG - Exonic
1014139667 6:117926691-117926713 CAGAGGCTGGAGGAGTAGGTAGG + Intronic
1018923539 6:168191743-168191765 CACAGCCTTGAGGAGAAGGTGGG + Intergenic
1019420042 7:946528-946550 CAGAGCCTGGGGGGGTCCTTGGG - Intronic
1019476407 7:1246754-1246776 CAGAGTCTGGAGGATGATTTGGG + Intergenic
1022318861 7:29269203-29269225 CAGAGGCTGGCAGAGTAGTGGGG - Intronic
1022437161 7:30399310-30399332 CAGAGGCTGGAGGAGGAGGAGGG + Intronic
1022482484 7:30753011-30753033 CTGAGCCTGGAGGAGCAGGCCGG + Intronic
1022807942 7:33841987-33842009 CAGAGCCTAGAAGAGGAGTCAGG + Intergenic
1023177176 7:37446653-37446675 CAGGGCCTGGAGCAGTCATTGGG - Intronic
1023237163 7:38101440-38101462 CAGGGCCTTGAGAAGTAGTATGG + Intergenic
1023934384 7:44729019-44729041 CTGAGGCTGGAGGATTACTTAGG + Intergenic
1024991483 7:55237817-55237839 CAGAGCCTGGATGAGTTCCTCGG - Intronic
1025176210 7:56803730-56803752 CATAGCCAGGAGGAAGAGTTGGG + Intergenic
1025695582 7:63772692-63772714 CATAGCCGGGAGGAAGAGTTGGG - Intergenic
1025819107 7:64946788-64946810 GCGAGCCTGGAGGAAGAGTTAGG - Intergenic
1027948653 7:84783636-84783658 CAGGGCCTGAAGGAGTGGCTAGG + Intergenic
1029594931 7:101532662-101532684 CAGAGTCTGGGGAAGGAGTTGGG - Intronic
1030345972 7:108433259-108433281 CACAGGCTGGAGGGGTAGTTAGG - Intronic
1030590594 7:111476835-111476857 CAGAGGCAGAAGTAGTAGTTAGG - Intronic
1032062501 7:128736767-128736789 AAGAGCCTGGAGGAGATATTTGG - Intergenic
1032198987 7:129805709-129805731 CTGAGCATGAAGGAGTAGTGGGG + Intergenic
1032283653 7:130525537-130525559 CAAATAGTGGAGGAGTAGTTAGG + Intronic
1034254994 7:149720050-149720072 CAGAGCCTGGAAGAGCTGTTGGG + Exonic
1034469280 7:151246987-151247009 CAGAGCCTGGAGGACCAGGAGGG - Intronic
1035316112 7:157998330-157998352 CAGAGCCAGGAGCAGCAGTCAGG + Intronic
1035993556 8:4519622-4519644 CAGCTTCTGGAGGAGTAGCTGGG - Intronic
1036685285 8:10905302-10905324 CAGAGCCAGGAGGAGAAGCACGG - Intronic
1036920660 8:12851252-12851274 CAAAGCCTGGAGGAGTGTCTGGG + Intergenic
1039159876 8:34605643-34605665 CAGAGGCTGGAGGTGGAGATTGG - Intergenic
1040932567 8:52750232-52750254 CACTGCCTTGAGGAGAAGTTTGG + Intergenic
1042624978 8:70748204-70748226 CAGAGCCAGCAGGAGCAGGTGGG + Intronic
1042809673 8:72810398-72810420 CAGAGCCTGCAGGATTGTTTTGG - Intronic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1043040857 8:75260035-75260057 CAGAGCCTGGTAGACTTGTTGGG + Intergenic
1043526062 8:81097539-81097561 CAGAGGCTGGAGGAGGAGGTGGG + Intronic
1045069418 8:98485781-98485803 ATGAGCCTGGAGAAGTAGATGGG + Intronic
1046443619 8:114286765-114286787 CAGGGCATGTATGAGTAGTTAGG - Intergenic
1047742764 8:127820095-127820117 CTGAGCCTGGAAGAGAAGTATGG + Intergenic
1047861546 8:128972619-128972641 CAGAGGCTGGAAGACTAATTAGG - Intergenic
1049403484 8:142441299-142441321 GAGAGCCTGGAGGGGAAGCTGGG + Intergenic
1051343181 9:16129778-16129800 CAGAGCCAGTCTGAGTAGTTGGG - Intergenic
1053066983 9:35075803-35075825 CAGAGCCTGGTGAAGAGGTTGGG - Intronic
1053543523 9:38998882-38998904 CAGAGCCTGCAGCAGGAGCTGGG + Intergenic
1053807954 9:41822387-41822409 CAGAGCCTGCAGCAGGAGCTGGG + Intergenic
1054622638 9:67365041-67365063 CAGAGCCTGCAGCAGGAGCTGGG - Intergenic
1056112123 9:83406372-83406394 CAGTGTCTGGAGGACCAGTTGGG + Intronic
1057850671 9:98564765-98564787 CTGGGCCTGAAGGAGTTGTTTGG + Intronic
1058303725 9:103409576-103409598 CAGCGTCCGGAGGAGTAGCTGGG + Intergenic
1059905866 9:118985168-118985190 CAGTGACTGAAGGAGAAGTTTGG + Intergenic
1061826710 9:133262411-133262433 CAGAGTCTGCAGGAGCAGTCGGG - Intronic
1062024309 9:134333267-134333289 CAGTGCCTGGAAGAGGAGCTGGG - Intronic
1186947465 X:14584824-14584846 CAAGGCCTGGAGGATTAGCTGGG - Intronic
1186985833 X:15012591-15012613 GAGGGCCTGGAGTAGTATTTAGG + Intergenic
1188002578 X:24996021-24996043 CAGATGCTGGAGGAGCATTTAGG - Exonic
1188588233 X:31802860-31802882 CAGGGCCTGGATGAGGACTTGGG + Intronic
1189929392 X:45992116-45992138 CAGAGGCTGAAAGAGTAGTGGGG - Intergenic
1190058739 X:47197517-47197539 CAGTGCCTAGAGGAGCACTTGGG + Intronic
1190289547 X:48983223-48983245 CAGATCCGGGAGGAGAAGGTGGG - Exonic
1192656007 X:72995654-72995676 CAGAGGCTGGAAAAGTAGTGGGG + Intergenic
1195636625 X:107123735-107123757 CAGAGCAGGGAGGAAAAGTTAGG - Exonic
1195706201 X:107739602-107739624 CAGAGTCTGGAGAAGTTGTGTGG + Intronic
1195981137 X:110579788-110579810 CAGAGCTTGAAGGAGTAGAAAGG + Intergenic
1198662298 X:138982739-138982761 CAGAGCCTGGATGAGAACCTTGG - Intronic
1199811673 X:151356055-151356077 CAGAGGATTGATGAGTAGTTGGG - Intergenic
1200371709 X:155733000-155733022 CAGAGCCTAGAAGTGTAGTGGGG + Intergenic
1201135657 Y:10988203-10988225 CAGAGCCTAGAGGAGTGGAGTGG - Intergenic